Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Lysostaphin

Lysostaphin

Lysostaphin is an antibacterial enzyme produced by Staphylococcus simulans.
It has the ability to cleave the pentaglycine cross-links in the cell wall of Staphylococcus aureus, leading to cell lysis and death.
Lysostaphin has been studied as a potential therapeutic agent for treating Staphylococcal infections, including methicillin-resistant S. aureus (MRSA).
Experienxe the power of data-driven decision making with PubCompare.ai's innovative AI-driven Lysostaphin Protocol Optimization to enhance your research accuracy and identify the best protocols and products for your needs.

Most cited protocols related to «Lysostaphin»

1
Random Transposon Mutagenesis in S. aureus
Cited 103 times
The mariner-based transposon (Tn) bursa aurealis was used to generate random Tn insertion mutations in S. aureus strain JE2 essentially as described by Bae et al. (4 (link), 43 (link)). First, bacteriophage ϕ11 was used to transduce the bursa aurealis delivery plasmid pBursa into JE2 containing the transposase-encoding plasmid pFA545, with selection on TSA medium containing chloramphenicol (Cm) (10 µg/ml) and Tet (5 µg/ml). After growth for 48 h at 30°C to allow for transposition events, one colony was resuspended in 100 µl of prewarmed 45°C water and then 10 µl was plated onto TSA plates containing erythromycin (Erm) (25 µg/ml) and grown at 45°C for 12 to 24 h. Resulting colonies, irrespective of colony size, were then screened for loss of the temperature-sensitive plasmids pBursa and pFA545 by patching them on TSA-Erm (25 µg/ml), TSA-Cm (10 µg/ml), and TSA-Tet (5 µg/ml). Those colonies that were Cm and Tet susceptible but resistant to Erm were arrayed into 1-ml deep-well plates containing 400 µl of TSB-Erm (5 µg/ml) and grown at 37°C overnight. The next day, 400 µl of 50% glycerol was added to each well and the plates were stored in a −80°C freezer.
To identify the locations of the bursa aurealis transposon insertions, 400 µl of TSB-Erm (5 µg/ml) was inoculated into 96-well plates using a 96-prong replicator. After overnight growth, the Wizard genomic DNA purification kit (Promega) was used to isolate genomic DNA from the cultures with the following modifications. Briefly, after centrifugation at 4,100 rpm for 5 min in a Sorvall (Newtown, CT) Legend tabletop centrifuge, supernatants were removed, the content of each well was resuspended in 110 µl of 50 mM EDTA (pH 8.0), and 5 µl of 10-mg/ml lysostaphin was added. After incubation at 37°C for 60 min, 600 µl of Nuclei Lysis solution was added and the genomic DNA was collected according to the manufacturer’s instructions. After resuspension in Tris-EDTA (TE) buffer, approximately 2 µg of genomic DNA was digested with 10 units of AciI (New England Biolabs) at 37°C for 4 h. AciI was then heat inactivated at 65°C for 30 min; T4 DNA ligase (200 U) (Monserate Biotechnologies, San Diego, CA) was then added to each sample and ligated overnight at 4°C, followed by heat inactivation at 65°C for 30 min. DNA fragments spanning the bursa aurealis insertion sites in each sample were amplified using the Buster (5′ GCTTTTTCTAAATGTTTTTTAAGTAAATCAAGTACC 3′) and Martn-ermR (5′ AAACTGATTTTTAGTAAACAGTTGACGATATTC 3′) primer set. PCR conditions included 30 cycles with an annealing temperature of 63°C and an extension time of 3 min. Once amplified, samples of the DNA products were separated in a 1% agarose gel by electrophoresis, and the remainder was purified for sequencing using Exo-SAP-IT (GE Healthcare) according to the manufacturer’s instructions. Finally, determination of the nucleotide sequences of the genomic DNA flanking the transposons was achieved using the Buster primer at the DNA Microarray and Sequencing Core Facility at the University of Nebraska Medical Center.
Fey P.D., Endres J.L., Yajjala V.K., Widhelm T.J., Boissy R.J., Bose J.L, & Bayles K.W. (2013). A Genetic Resource for Rapid and Comprehensive Phenotype Screening of Nonessential Staphylococcus aureus Genes. mBio, 4(1), e00537-12.
Publication 2013
Bacteriophages Cell Nucleus Centrifugation Chloramphenicol DNA Chips DNA Primers Edetic Acid Electrophoresis Erythromycin Genome Glycerin Jumping Genes Lysostaphin Microarray Analysis Obstetric Delivery Oligonucleotide Primers Plasmids Promega Sepharose Sequence Determinations, DNA Strains Synovial Bursa T4 DNA Ligase Transposase Tromethamine
2
Staphylococcal DNA Isolation and Manipulation
Cited 29 times
The bacterial strains and plasmids used in this study are described in Table 2. Oligonucleotides were purchased from Integrated DNA Technologies and are listed in Table 3. Genomic DNA was isolated using the Qiagen 100/G genomic tip (Qiagen). Weakening of the staphylococcal cell wall required the addition of 100 µg of lysostaphin (Ambi) into the lysis buffer and incubation at 37°C for 30 min. Plasmids and PCR products were isolated using the Wizard plus kits (Promega), with T4 DNA ligase also purchased from Promega. Plasmids were isolated from staphylococci as described previously (3 (link)). Restriction enzymes, T4 DNA polymerase, and Phusion DNA polymerase were purchased from New England Biolabs. Phire Hotstart DNA polymerase was purchased from Thermofisher. Sanger sequencing was supplied by Eurofins. Routine manipulation of S. aureus and E. coli was performed as described by Monk et al. (3 (link)). X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside; Melford) was used at 50 µg/ml in E. coli and 100 µg/ml in S. aureus. Antibiotics were purchased from Sigma Aldrich and used at the following concentrations: carbenicillin (Car), 100 µg/ml; chloramphenicol (Cm), 10 µg/ml; and kanamycin (Kan), 50 µg/ml (E. coli) and 100 µg/ml (S. aureus).
Monk I.R., Tree J.J., Howden B.P., Stinear T.P, & Foster T.J. (2015). Complete Bypass of Restriction Systems for Major Staphylococcus aureus Lineages. mBio, 6(3), e00308-15.
Publication 2015
5-bromo-4-chloro-3-indolyl beta-galactoside Antibiotics Bacteria Buffers Carbenicillin Cell Wall Chloramphenicol DNA-Directed DNA Polymerase DNA Restriction Enzymes Escherichia coli Galactose Genome Kanamycin Lysostaphin Monks Oligonucleotides Plasmids Promega Staphylococcus Staphylococcus aureus Strains T4 DNA Ligase
3
Bacterial Strain and Plasmid Cultivation
Cited 22 times
Bacterial strains, plasmids, and oligonucleotides used in this study are described in Table 1. E. coli, S. aureus, and S. epidermidis were routinely cultured at 37°C in L broth (1% tryptone, 0.5% yeast extract, 0.5% NaCl), Trypticase soy broth (TSB) (Difco) or brain heart infusion broth (BHI) (Difco). For growth on agar, L broth or brain heart infusion broth was solidified with 1.5% agar, yielding LBA and BHIA, respectively. The following antibiotics and concentrations were used: chloramphenicol (Cm), 10 µg/ml; kanamycin, 50 µg/ml; erythromycin (Em), 25 µg/ml; and carbenicillin, 100 µg/ml (Sigma).
Oligonucleotides and DNA sequencing were purchased from IDT. Restriction enzymes and LigaFAST T4 DNA ligase were purchased from NEB and Promega, respectively. High-fidelity PCR was performed with KOD Hotstart DNA polymerase (Novagen) or Phusion DNA polymerase (Finnzymes) on genomic DNA isolated with the Genelute bacterial genomic DNA kit (Sigma). Plasmids and PCR products were purified using WizardPlus kits (Promega). To isolate plasmid DNA from S. aureus, a 10-ml overnight culture was treated with 100 µg lysostaphin (Ambi Products, New York) in P1 buffer for 30 min at room temperature and then processed as recommended by the manufacturer (GeneJET plamsid miniprep kit; Fermentas).
For colony PCR, a small amount of colonial growth was touched to the side of a PCR tube and microwaved for 5 min at 800 W. The tube was placed on ice, Phire Hotstart II master mix (Finnzymes) was added to the PCR tube, and thermocycling conditions were conducted as recommended by the manufacturer.
Monk I.R., Shah I.M., Xu M., Tan M.W, & Foster T.J. (2012). Transforming the Untransformable: Application of Direct Transformation To Manipulate Genetically Staphylococcus aureus and Staphylococcus epidermidis. mBio, 3(2), e00277-11.
Publication 2012
Agar Antibiotics Bacteria Brain Buffers Carbenicillin Chloramphenicol DNA, Bacterial DNA-Directed DNA Polymerase DNA Restriction Enzymes Erythromycin Escherichia coli Genome Heart Kanamycin Lysostaphin Oligonucleotides Plasmids Promega Sodium Chloride Staphylococcus aureus Staphylococcus epidermidis Strains T4 DNA Ligase trypticase-soy broth Yeast, Dried
4
Extraction and Analysis of Cell Surface Proteins
Cited 11 times
Overnight cultures of S. aureus strains were diluted 1:100 into fresh TSB and grown for 3 h at 37°C. Staphylococci were centrifuged and washed twice with PBS. 3 ml of cells was spun down and suspended in 100 µl TSM buffer (50 mM Tris-HCL [pH 7.5], 10 mM MgCl2, and 0.5 M sucrose); lysostaphin (final concentration = 70 µg/ml−1) was added and allowed to incubate for 30 min at 37°C. The solution was spun down for 5 min at 9,000 g, and supernatants containing released cell-surface proteins were collected. 15 µl of lysostaphin extracts were incubated with 3 µCi [14C]AMP for 30 min at 37°C. Samples were spotted on a silica plate, followed by separation by TLC using a (75:25 isopropanol/double-distilled H2O) 0.2-M ammonia bicarbonate solvent. For cell-wall extracts of S. aureus, E. faecilis, B. anthracis, and S. epidermidis digested with mutanolysin, mutanolysin was substituted for lysostaphin and used according to the manufacturer's recommended conditions. When assayed with purified proteins, 2 µM of purified AdsA or BasA was incubated in a final volume of 15 µl with 3 µCi [14C]AMP in the presence of the metal cations in TSM buffer indicated in the figures.
Thammavongsa V., Kern J.W., Missiakas D.M, & Schneewind O. (2009). Staphylococcus aureus synthesizes adenosine to escape host immune responses. The Journal of Experimental Medicine, 206(11), 2417-2427.
Publication 2009
Ammonia Bacillus anthracis Bicarbonates Buffers Cations Cells Cell Surface Proteins Cell Wall Isopropyl Alcohol Lysostaphin Magnesium Chloride Metals mutanolysin Proteins Silicon Dioxide Solvents Staphylococcus Staphylococcus epidermidis Strains Sucrose Tromethamine
5
Quantifying Bacterial Survival in Blood
Cited 10 times
To measure bacterial replication and survival ex vivo, 0.5 ml of freshly drawn mouse or human blood anticoagulated with 0.005 mg desirudin per ml was incubated with 50 µl of a bacterial suspension containing 5 × 105 CFU (mouse) or 5 × 106 CFU (human). Where indicated, human blood was processed to generate desirudin-plasma or serum. Where indicated, 5% Alexa Fluor 488–conjugated human fibrinogen (Life Technologies), CD (0.04 mM), or purified mouse monoclonal antibodies (∼10 µg ml−1 final concentration) were added to the samples. After incubation at 37°C for 0, 30, or 60 min, 0.5 ml of PBS with 0.5% saponin or 0.5 ml agglutination lysis buffer (0.5% saponin, 200 U SK K, 100 µg trypsin, 2 µg DNase, 10 µg RNase per ml PBS) were added to each sample for 10 min at 37°C before plating on agar for enumeration of CFU. Treatment with agglutination lysis buffer is annotated as +SK in the figures. Statistical analysis was performed by two-tailed Student’s t test. For flow cytometry analysis, samples were incubated first with lysostaphin (10 µg ml−1) for 5 min to lyse extracellular bacteria and next with erythrocyte lysis buffer (QIAGEN) for 30 min on ice. Blood leukocytes were recovered after centrifugation at 400 g, washed three times, and suspended in PBS containing 1% FBS. Cells were stained with allophycocyanin-conjugated α-GR1 and analyzed using a FACSCanto (BD). The data were analyzed with the two-tailed Student’s t test. Human volunteers were enrolled under a protocol that was reviewed and approved by the University of Chicago's Institutional Review Board.
Thomer L., Emolo C., Thammavongsa V., Kim H.K., McAdow M.E., Yu W., Kieffer M., Schneewind O, & Missiakas D. (2016). Antibodies against a secreted product of Staphylococcus aureus trigger phagocytic killing. The Journal of Experimental Medicine, 213(3), 293-301.
Publication 2016
Agar Agglutination alexa fluor 488 allophycocyanin Bacteria BLOOD Buffers Cells Centrifugation Deoxyribonucleases desirudin DNA Replication Endoribonucleases Erythrocytes Ethics Committees, Research Fibrinogen Flow Cytometry Homo sapiens Human Volunteers Leukocytes Lysostaphin Monoclonal Antibodies Mus Plasma Saponin Serum Student Trypsin

Most recents protocols related to «Lysostaphin»

1
Bacterial Genomic DNA Isolation and Sequencing
Genomic DNA was isolated from overnight bacterial cultures of the strains using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA), with the enzyme pretreatment step modified to 50 μg/mL lysostaphin and 500 μg/mL lysozyme in 10 mM Tris-HCl 1 mM EDTA (pH 8.0). Sequencing libraries were prepared using the TruSeq DNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) following the manufacturer’s instructions. WGS was performed using the Illumina MiSeq platform (Illumina). The paired-end sequencing reads were assembled using CLC Genomics Workbench 7.3 (CLC Bio, Aarhus, Denmark). Genes were predicted using Glimmer 3 [15 (link)] and annotated by homology searches against the Clusters of Orthologous Groups and SEED databases (https://theseed.org) [16 (link)]. To validate the results, the assembled sequences were compared with the N315 and Mu50 MRSA reference genomes.
Kim J.W, & Lee K.J. (2023). Development of a Single-nucleotide Polymorphism Genotyping Assay for the Rapid Detection of Vancomycin-intermediate Resistance in Staphylococcus aureus Epidemic Lineage ST5. Annals of Laboratory Medicine, 43(4), 355-363.
Publication 2023
Bacteria CLCN7 protein, human Edetic Acid Enzymes Genes Genome Lysostaphin Methicillin-Resistant Staphylococcus aureus Muramidase Promega Strains Tromethamine
2
Infant Gut Microbiome Profiling by Shotgun Metagenomics
We analyzed fecal samples from 105 infants. The caregivers were asked to collect the fecal samples carefully from the infant on the evening before or the morning of the study visit. They were provided with: i) a specific tube (OMNIgene GUT, OM-200, DNAgenotek, Canada) for the analysis of gut microbiota profile; and ii) polystyrene stool tubes (Sarstedt, Sevelen, Switzerland) for the determination of fecal calprotectin levels and fecal pH. Fecal samples were split into aliquots and frozen at −20°C. All aliquots were stored at the study site until shipment on dry ice to the ETH Zurich, Switzerland, for further analyses. Fecal calprotectin was determined with an ELISA kit (Eurospital, Italy) and fecal pH was determined with a digital pH meter (Metrohm, Switzerland). For fecal DNA extraction, samples were vortexed for 60s and incubated at 50°C for 30 min (as recommended by OMNIgene.GUT for viscous samples). The pellet obtained after centrifugation (1 min at 13. 800 g) was incubated with 200 μL enzyme cocktail (50 mg/mL lysozyme, 20 U/mL lysostaphin and 150 U/mL mutanolysin, all from Sigma-Aldrich, St. Louis, USA), at 37°C for 30 min before mechanical disruption with a FastPrep‐24™ instrument (MP Biomedicals™) set at speed 6.0, for two 60-second periods. DNA was isolated with the QIAamp®PowerFecal®Pro DNA-kit (QIAGEN®, Hilden, Germany) according to the manufacturer’s instructions. DNA was eluted in a final volume of 75 μL. The DNA preparation was subjected to quality control by spectrophotometry on a NanoDrop™ 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, USA), according to the manufacturer’s instructions.
Metagenomic shotgun sequencing and preprocessing. In total, 105 samples were analyzed by Shotgun metagenomics at ADM-Biopolis (Paterna, Spain). DNA was quantified fluorometrically with a Qubit Fluorometer (Themo Fisher Scientific, Carlsbad, USA). Sequencing libraries were prepared with the Nextera XT DNA sample preparation kit, according to the manufacturer’s instructions. Samples were sequenced on a NovaSeq 6000 platform with the kit for 151 bp paired-end reads, resulting in 34.7 million (± 7.8 million) paired-end reads per sample. Demultiplexed reads were filtered with BBTools64 (link) and quality filtering was performed with NGLess v1.0.0-Linux64 software.65 (link) Reads were filtered for 97% identity to the human genome (hg19), to obtain Q20 reads with a minimal length of 45 nt and no trace of human DNA contamination. After filtering, a mean of 26.6 million (± 5.6 million) paired-end reads per sample were retained.
Derrien M., Mikulic N., Uyoga M.A., Chenoll E., Climent E., Howard-Varona A., Nyilima S., Stoffel N.U., Karanja S., Kottler R., Stahl B., Zimmermann M.B, & Bourdet-Sicard R. (2023). Gut microbiome function and composition in infants from rural Kenya and association with human milk oligosaccharides. Gut Microbes, 15(1), 2178793.
Full text: Click here
Publication 2023
Centrifugation DNA Contamination Dry Ice Enzyme-Linked Immunosorbent Assay Enzymes Feces Freezing G-800 Gastrointestinal Microbiome Genome, Human Homo sapiens Infant Leukocyte L1 Antigen Complex Lysostaphin Metagenome Muramidase mutanolysin Polystyrenes Spectrophotometry Viscosity
3
Lysostaphin Sensitivity Assay for Staphylococcus
Overnight cultures were back diluted to an OD600nm of 0.05 in 20 mL of fresh TSB and grown to an OD600nm 0.5–0.7. Cultures were normalised to give 1 ml of OD600nm 0.6. Lysostaphin was subsequently added to give a final concentration of 0.5 μg/mL. 200 μL of each strain was then added to a 96-well plate and incubated for 3 h at 37oC in a CLARIOstar plate reader. OD600nm readings were taken every 10 min (500 rpm shaking before readings). Values were blank corrected according to 200 μL of PBS. The PBP4::tn mutant was included as a control.
Douglas E.J., Palk N., Brignoli T., Altwiley D., Boura M., Laabei M., Recker M., Cheung G.Y., Liu R., Hsieh R.C., Otto M., O’Brien E., McLoughlin R.M, & Massey R.C. (2023). Extensive re-modelling of the cell wall during the development of Staphylococcus aureus bacteraemia. bioRxiv.
Full text: Click here
Publication Preprint 2023
Lysostaphin Strains
4
Biosensor Assay for Antimicrobial Activity
CWBIs and negative control compounds were either from Sigma–Aldrich or the sources listed in Table S2. Susceptibility testing29 was used to define appropriate concentrations of control compounds for assay. Biosensor strains were cultured in tryptone soya broth (TSB; Oxoid) at 37°C with vigorous aeration to an OD600 of 0.2 and challenged with antimicrobial agents for 60 min. In the case of biosensor constructs in Ts mutants, strains were grown at 30°C to an OD600 of 0.2, before shifting the temperature to 42°C for 60 min. Post-challenge, OD600 was measured to allow changes in cell density to be accounted for in calculating biosensor induction. An aliquot of culture (typically 200 µL) was centrifuged, and the washed cells resuspended in 0.5 volumes of AB buffer30 (link) containing lysostaphin (15 mg/L) and the fluorogenic β-galactosidase (β-gal) substrate, 4-methylumbelliferyl β-D-galactopyranoside (MUG, 500 mg/L; Sigma–Aldrich), and incubated at 25°C with shaking for 90 min. Production of β-gal was determined as described.30 (link)
Galarion L.H., Mitchell J.K., Randall C.P, & O’Neill A.J. (2023). An extensively validated whole-cell biosensor for specific, sensitive and high-throughput detection of antibacterial inhibitors targeting cell-wall biosynthesis. Journal of Antimicrobial Chemotherapy, 78(3), 646-655.
Full text: Click here
Publication 2023
beta-Galactosidase Biological Assay Biosensors Cells Fluorogenic Substrate Galactose Lysostaphin Microbicides Soybeans Strains Susceptibility, Disease
5
Daptomycin Susceptibility of Growth-Arrested Staphylococcus
The mid-exponential phase and growth-arrested cultures (3 mL) were generated as described above. CaCl2 was added to a final concentration of 1.25 mM, and daptomycin was added to 20 μg mL−1. The cultures were incubated at 37°C with shaking (180 rpm) for 6 h. At each time point, aliquots were taken, serially diluted 10-fold in PBS, and plated onto TSB to determine the CFU mL−1. Where appropriate, after growth arrest, cells were incubated with 1 μg mL−1 lysostaphin in TSB for 1 h at 37°C to partially remove the cell wall prior to the addition of daptomycin.
Ledger E.V, & Edwards A.M. (2023). Growth Arrest of Staphylococcus aureus Induces Daptomycin Tolerance via Cell Wall Remodelling. mBio, 14(1), e03558-22.
Full text: Click here
Publication 2023
Cell Wall Daptomycin Lysostaphin

Top products related to «Lysostaphin»

1
Lysostaphin by Merck Group
Sourced in United States, Germany, United Kingdom, China, Canada, Portugal, France, Sao Tome and Principe
Lysostaphin is a bacteriolytic enzyme that is effective against Staphylococcus aureus, including methicillin-resistant strains. It is produced by the bacterium Staphylococcus simulans. Lysostaphin functions by cleaving the pentaglycine cross-links in the peptidoglycan layer of the Staphylococcus cell wall, leading to cell lysis.
2
Lysozyme by Merck Group
Sourced in United States, Germany, United Kingdom, Japan, China, Poland, Ireland, Switzerland, Italy, Sao Tome and Principe, India, Canada, France, Belgium, Australia, Netherlands, Singapore, Denmark, Macao, Portugal
Lysozyme is an enzyme that catalyzes the hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in peptidoglycan, which is a major component of the cell walls of gram-positive bacteria. This function makes lysozyme an effective antimicrobial agent.
3
Mutanolysin by Merck Group
Sourced in United States, Germany, United Kingdom, Australia, Poland, Canada, Japan, Israel, Macao, Ireland, Switzerland
Mutanolysin is a muralytic enzyme that cleaves the peptidoglycan layer of bacterial cell walls. It is commonly used in laboratory settings for the preparation and analysis of bacterial samples.
4
Dneasy blood and tissue kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Canada, Netherlands, Japan, China, France, Australia, Denmark, Switzerland, Italy, Sweden, Belgium, Austria, Hungary
The DNeasy Blood and Tissue Kit is a DNA extraction and purification product designed for the isolation of genomic DNA from a variety of sample types, including blood, tissues, and cultured cells. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing high-quality samples suitable for use in various downstream applications.
5
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
6
Qiaamp dna mini kit by Qiagen
Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark
The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.
7
Wizard genomic dna purification kit by Promega
Sourced in United States, France, Germany, China, United Kingdom, Japan, Switzerland, Australia, Italy, Spain, Ireland, Canada, Brazil
The Wizard Genomic DNA Purification Kit is a product designed to isolate and purify genomic DNA from a variety of sample types. It utilizes a simple, rapid, and efficient protocol to extract high-quality DNA that can be used in various downstream applications.
8
Proteinase k by Merck Group
Sourced in United States, Germany, United Kingdom, Italy, Japan, Sao Tome and Principe, Canada, Belgium, Macao, Australia, Israel, France, China, Czechia, Singapore, Norway, Austria, Switzerland, Spain
Proteinase K is a serine protease enzyme that is commonly used in molecular biology and biochemistry laboratories. It is a highly active enzyme that efficiently digests a wide range of proteins, including those found in cell membranes, cytoplasmic proteins, and nuclear proteins. Proteinase K is known for its ability to effectively inactivate DNases and RNases, making it a valuable tool for the purification and isolation of nucleic acids.
9
Rnaprotect by Qiagen
Sourced in Germany, United States, United Kingdom, Italy, Spain, Netherlands
RNAprotect is a reagent designed to immediately stabilize and protect RNA in samples. It helps prevent RNA degradation and changes in gene expression during sample collection, storage, and transportation.
10
Phusion dna polymerase by New England Biolabs
Sourced in United States, United Kingdom, China, Japan, Canada, Germany
Phusion DNA polymerase is a high-fidelity DNA polymerase used for PCR amplification. It is a thermostable enzyme with proofreading activity, ensuring accurate DNA synthesis.

More about "Lysostaphin"

Lysostaphin is an antibacterial enzyme produced by Staphylococcus simulans.
It has the ability to cleave the pentaglycine cross-links in the cell wall of Staphylococcus aureus, leading to cell lysis and death.
Lysostaphin has been studied as a potential therapeutic agent for treating Staphylococcal infections, including methicillin-resistant S. aureus (MRSA).
Discover how PubCompare.ai's innovative AI-driven Lysostaphin Protocol Optimization can enhance your research accuracy.
Easily locate protocols from literature, pre-prints, and patents, and leverage AI-driven comparisons to identify the best protocols and products for your needs.
Experience the power of data-driven decision making with PubCompare.ai.
Lysozyme is another enzyme that can break down bacterial cell walls, while Mutanolysin is a muralytic enzyme that specifically targets the cell walls of Streptococcus and Staphylococcus bacteria.
The DNeasy Blood and Tissue Kit, RNeasy Mini Kit, QIAamp DNA Mini Kit, and Wizard Genomic DNA Purification Kit are all tools used for extracting and purifying DNA and RNA from various samples.
Proteinase K and RNAprotect are used to lyse cells and stabilize RNA, respectively.
Phusion DNA polymerase is a high-fidelity enzyme used for PCR amplification.
Experienxe the power of data-driven decision making with PubCompare.ai's innovative AI-driven Lysostaphin Protocol Optimization to enhance your research accuracy and identify the best protocols and products for your needs.