> Chemicals & Drugs > Amino Acid > Mismatch repair protein 1, human

Mismatch repair protein 1, human

Mismatch Repair Protein 1, Human: A key component of the DNA mismatch repair system, responsible for recognizing and repairing base-pairing errors that occur during DNA replication.
This protein plays a crucial role in maintaining genomic stability and preventing the accumulation of mutations.
It is invovled in several cellular processes, including DNA damage response, cell cycle regulation, and apoptosis.
Dysfunction of Mismatch Repair Protein 1 has been linked to various types of cancer, making it an important target for research and therapeutic development.

Most cited protocols related to «Mismatch repair protein 1, human»

Visualizing Long Single-Stranded DNA

Cited 13 times

φ29 DNA polymerase is highly processive and can generate ssDNA molecules (≥=70,000 nucleotides (nt) in length)^{15 ,16 (link)} in rolling circle replication assays using a circular ssDNA template (M13mp18; 7,249-nt) (Figure 1A & 1B). The ssDNA products harbor a single biotin at the 5′ end, which can be linked to a lipid bilayer through a tetravalent streptavidin linkage (Figure 1C). Single-stranded DNA molecules cannot be stretched by the hydrodynamic forces accessible within our system (≳1 pN), nor can they be labeled with fluorescent intercalating dyes. To overcome these issues, we chose scRPA-eGFP as an ssDNA-labeling reagent based on several criteria. First, scRPA binds tightly to ssDNA (K_a≈10⁹–10¹¹ M⁻¹),^{13 (link)} so ssDNA binding is expected to occur at low protein concentrations amenable to single-molecule imaging. Second, RPA eliminates secondary structure in ssDNA, protects ssDNA from damage, and increases the persistence length of ssDNA;^{13 (link),17 (link)} these features should ensure that ssDNA bound by RPA could be readily stretched by buffer flow (Figure 1C & 1D). Third, scRPA retains biological function in vivo when labeled with eGFP on the C-terminus of the 32-kDa subunit,^{18 (link)} ensuring that the labeled protein would retain all relevant activities related to its biological functions.
To assemble single-tethered ssDNA curtains, the products of a rolling circle replication assay were anchored to the lipid bilayer, and scRPA-eGFP (0.2 nM) was then injected at a rate of 1.0 ml/min. Upon injection of the scRPA-eGFP the ssDNA becomes visible and begins extending towards its full contour length (Figure 2A). When flow was paused, the ssDNA-scRPA-eGFP diffused away from the surface and out of the evanescent field, confirming that the molecules were not stuck to the bilayer (Figure 2B). Wide-field images revealed varying lengths of ssDNA, as expected, with molecules ranging from 1.8–212 μm, and an average length of ~20 μm (Figure 2C). Electron microscopy (EM) images of human RPA bound to ssDNA reveal that the protein-coated ssDNA had a contour length that was approximately 17% shorter than naked ssDNA, corresponding to a distance of ~0.40 nm between adjacent bases for RPA-bound ssDNA.^{17 (link)} Assuming S. cerevisiae and human RPA interact similarly with ssDNA, and that the structure of RPA-ssDNA is similar in solution and on EM-grids, then the substrates observed in our assays would be expected to range from 4,500–530,000 nucleotides (nt) in length, with an average length of ~50,000 nt. Importantly, scRPA-eGFP remained bound to the ssDNA with little or no dissociation, or exchange with free RPA in solution, even after observations over times ranging up to ≥60 minutes. The eGFP fluorophores do bleach over extended observation periods, but the ssDNA itself does not shorten, indicating that the photo-bleached scRPA-eGFP remained bound to the ssDNA and did not exchange with protein in solution (Figure 2D). In addition, scRPA-eGFP remained bound to the ssDNA when chased with buffers containing either 1 M NaCl or 3.5 M urea (not shown & Figure 2E), as expected based upon prior bulk biochemical experiments.^{13 (link)}Single-tethered DNA curtains require constant buffer flow through the sample chamber in order to visualize the DNA substrates. In contrast, double-tethered curtains can be visualized in the absence of flow, which is advantageous in experimental scenarios where reagents are limiting or when the application of buffer flow might perturb the biological reactions under investigation.^{2 (link),3 (link),7 (link)} To make double-tethered ssDNA curtains, we utilized nanofabricated patterns consisting of linear barriers for aligning the ssDNA, and pentagon-shaped anchor points for tethering the downstream ends of the molecules (Figure 1D). The scRPA-eGFP-ssDNA adsorbed nonspecifically to the anchor points, allowing the molecules to be viewed even in the absence of buffer flow (Figure 3A). As a simple proof-of-principle, we next visualized the protein Sgs1 bound to the double-tethered ssDNA; Sgs1 is the S. cerevisiae RecQ helicase that participates in a number of reactions involving ssDNA.^{14 (link),19 (link)} Sgs1 was tagged with a quantum dot (QD), and injected into a flowcell containing double-tethered ssDNA curtains labeled with scRPA-eGFP. Both the ssDNA and the bound Sgs1 were readily visible with two-color imaging (Figure 3B).
In summary, ssDNA is a key intermediate in nearly all reactions related to DNA metabolism and genome maintenance. However, the lack of approaches for studying long ssDNA molecules by real-time single molecule imaging has greatly hindered progress on studies of a number of ssDNA-binding proteins essential for DNA repair and metabolism.^{10 (link)} Here we have presented a simple technique for preparing and visualizing ssDNA curtains bound by scRPA-eGFP. The remarkable stability of the scRPA-eGFP -ssDNA complex is of great benefit because it eliminated the need to maintain a pool of free RPA, which would contribute to background signal. Moreover, RPA is a ubiquitous protein involved in all biological reactions that have an ssDNA intermediate (e.g. homologous DNA recombination, nucleotide excision repair, post-replicative mismatch repair, DNA replication, etc.), so the experiments shown will permit in-depth biological studies involving a broader compliment of proteins involved in the various reactions.^{13 (link)} Importantly naked ssDNA is unlikely to exist in vivo because it becomes rapidly coated with RPA (or SSB in prokaryotes),^{13 (link)} therefore development of methods for observing RPA-bound ssDNA provides a biologically relevant context for experimentally accessing a range of other proteins that act on ssDNA (such as the homologous recombination proteins Rad51, Srs2, Rad52, etc.).

Gibb B., Silverstein T.D., Finkelstein I.J, & Greene E.C. (2012). Single-Stranded DNA Curtains for Real-Time Single-Molecule Visualization of Protein-Nucleic Acid Interactions. Analytical chemistry, 84(18), 7607-7612.

Publication 2012

TALEN-Mediated MSTN Gene Editing

Cited 9 times

Assembly of MSTN-TALENs. We constructed a pair of TALENs to target the MSTN locus using the published Golden Gate platform.^{27 (link)} The Golden Gate TALEN kit (Kit#1000000016) was obtained from Addgene. TALENs were assembled in the same way as described^{27 (link)} with the following modifications. Instead of the pTAL scaffold,^{27 (link)} we used the GoldyTALEN scaffold^{41 (link)} to construct our TALENs because GoldyTALEN scaffold has an increased gene-editing efficiency. The GoldyTALEN scaffold was constructed by PCR using the following primer pairs: TAL-F1, CAAGGTACCTATGGTGGATCTACGCACGCTCGGCTACAG; TAL-R1, ACGGTCGACGTCTCCAGGGGAGCACCCGTCAGTGCATTG; TAL-F2, GACGTCGACCGTCTCCAACGACCACCTCGTC; TAL-R2, TTGGGATCCGGCAACGCGATGGGACGTGCGTTC. The two PCR fragments were ligated into the KpnI and BamHI sites of a mammalian expression plasmid designated as pTAL5, which is based upon pEGFP-C3 with the following modifications: (i) a 3xFLAG tag and nucleus localization signal (NLS) sequence, (ii) a wild-type (WT) FokI domain, and (iii) BsaI and BsmBI sites removed outside of the GoldyTALEN scaffold. The final pTAL5 plasmid contains a unique BsmBI site within the scaffold in order to be compatible with the Golden Gate platform. To construct TALENs with obligate heterodimer variants of the FokI domain (ELD-sharkey and KKR-sharkey), we used QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies, Cedar Creek, TX) to obtain the ELD-sharkey and KKR-sharkey variants. To streamline the assembly of a functional pair of TALENs into one plasmid, we placed two GoldyTALEN scaffolds linked by a self-cleaving 2A peptide into a final plasmid designated as pTAL6, which has a unique BsaI site instead of BsmBI site within the second GoldyTALEN scaffold. Both pTAL5 and pTAL6 are available upon request. The protein sequences of MSTN TALENs are provided in the Supplementary Figures S1 and S2 online).
Construction of mouse and human donor plasmids. The homology arms (~800 bp) of the human and mouse MSTN locus were PCR amplified from genomic DNA of mouse C2C12s cell or human HEK293 cells. The primer sequences are as follows:
hGDF8-HL-F: 5′-ATCTACTAGTGCCTGGCCCTAAAGACAAT-3′ hGDF8-HL-R: 5′-ATCTGGTACCTCTAGATTGTAGGAGTCTCGACGGG-3′
hGDF8-HR-F: 5′-TCTGGTACCGATATCCTCTGAAACTTGACATGAACCC-3′ hGDF8-HR-R: 5′-ATCTGCGGCCGCCCACATCAGTGCATCAACATCC-3′
mGDF8-HL-L: CGTACTAGTCAAGGCCACTGCTTTCTGAT-3′ mGDF8-HL-R: AGACTCGAGAAACACTGTTGTAGGAGTCTTGAC-3′
mGDF8-HR-L: AGCCTCGAGAGCGATATCCGATCTCTGAAACTTGAC-3′ mGDF8-HR-R: ATCTGCGGCCGCGCAAGTATGCTAAAGGAGTCCA-3′. PCR products for left and right arms were digested with SpeI/KpnI and KpnI/NotI, respectively and ligated into SpeI and NotI restriction sites of AAVS1 SA-2A-puro-pA donor plasmid (#22075 from Addgene) to generate human and mouse GDF8 donor plasmids. To add a mCherry-puromycin expression cassette with a CMV promoter, we assembled the following pieces together: (i) a CMV promoter was amplified from pmCherry-C1 plasmid (Clontech, Mountain View, CA) with primers:
CMV-F, AGTGGTCTCCACCGTCGACTAGTTAT TAATAGTAATCAATTACGGGGTC-3′ and CMV-R, ACTCTC GAGAGCGCTAGCGGATCTGACGGTTCACTAAAC-3′ and the PCR product was digested with SpeI and NheI; (ii) mCherry fragment was obtained by digesting pmCherry-C1 plasmid (Clontech, Mountain View, CA) with Nhe1 and Sal1; and (iii) puromyocin was obtained from AAVS1 SA-2A-puro-pA donor plasmid (#22075 from Addgene) by XhoI and NotI. These three fragments were ligated into the SpeI and NotI site of the human or mouse GDF8 donor plasmids to create the final human or mouse GDF8 donor plasmids carrying a complete mCherry-puromycin expression cassette. Moreover, a ECFP-dysferlin fragment fused to mCherry-puromycin with a 2A self-cleaving peptide sequence was added to form the mCherry-puromycin-2A-ECFP-dysferlin donor plasmids.
Cell culture and transfection. HEK293, BAEC, NIH 3T3, HT1080, and C2C12 cells were cultured in DMEM supplemented with 10% FBS. Cells were seeded in six-well plates until they reached ~80% confluence. HEK293 cells were transfected with 2 µg TALENs-encoding plasmid using X-tremeGENE HP DNA transfection reagent (Roche, Indianapolis, IN) and media was changed after 24 hours. Typically, this resulted in about 60% transfection efficiency. BAEC, NIH3T3, HT1080, and C2C12 cells were transfected with 7.5 µg TALENs-encoding plasmid with Xfect transfection reagent (Clontech, Mountain View, CA) and media was changed after 4 hours. The cells were assayed 48 hours after transfection. The transfection efficiency for BAEC varies from 20 to 30%, and for NIH 3T3, C2C12 and HT1080 cells varies from 10 to 20% (we thus did three rounds of transfection). Primary mouse and human myoblasts (#10067 control patient and #9501 dysferlin-deficient patient, obtained from Telethon Genetic BioBank Network) were cultured in DMEM/F-12 supplemented with 20% FBS. These primary myoblasts were transfected with Neon Transfection System (Invitrogen, Carlsbad, CA). Briefly, 1 × 10⁵ cells were electroporated with 0.5 µg TALENs-encoding plasmid. The electroporation conditions for mouse FDB myoblasts and human myoblasts were 1700 V, 20 ms, 1 pulse and 1400 V, 20 ms, 2 pulses, respectively. These conditions consistently resulted in about 50% transfection efficiency in mouse FDB myoblasts with about 20% survival rate and 30% transfection efficiency in human myoblasts with 20% survival rate.
T7E1 mismatch-detecting assay. The cleavage activities of the MSTN TALENs were assayed by mismatch-recognizing T7E1 as described previously.^{31 (link)} The T7E1 assay detects small deletion/insertion mutations (indels) originated from NHEJ DNA repair events following TALENs-induced double-strand break. Briefly, the cells transfected with TALENs-expressing plasmid were harvested 3 days post-transfection and genomic DNA was extracted. A DNA fragment surrounding the TALEN target site was amplified by PCR with the AccuPrime PCR kit (Invitrogen, Carlsbad, CA). The primer pairs were 5′-TGGAGGGGTTTTGTTAATGG-3′ and 5′-TATTGGGTACAGGGCTACCG-3′ for human, 5′-AGTGGTCTCACTATACGTACACACTACCCCAACAGC-3′ and 5′-AGTGGTCTCACGCCCATGGGACATGAGATTGACACA-3′ for mouse, and 5′-TCC CGAGGCTCAGTTAGTTGC-3′ and 5′-CACTGGGGTAAGGCACCTTTG-3′ for bovine. The primer pairs used to detect off-target activities were 5′- TCTTATCTGCTGGGCCACTC-3′ and 5′- CTGCTCCCGTTTTCTGTAGC-3′ for human chromosome 5 site, 5′- CACAGGACATGTGGGAACAG-3′ and 5′- GCCCAATGGAAAATCGTATG-3′ for human chromosome 12 site, 5′- GTTGTGGGACCAAAGACGAT-3′ and 5′- ACGCTGGGAATTTCCTCTCT-3′ for human chromosome 2 site. The DNA fragment was purified and denatured at 95 °C for 10 minutes, and reannealed slowly using the following temperature program: 90 cycles of 95 to 59 °C with a 0.4 °C decrease per cycle for 20 seconds, 90 cycles of 59 to 32 °C with a 0.3 °C decrease per cycle for 20 seconds, 20 cycles of 32 to 26 °C with a 0.3 °C decrease per cycle for 20 seconds. This allows the formation of DNA heteroduplex if NHEJ occurred. The reannealed DNA samples were incubated with 0.5 µl T7E1 (New England BioLabs, UK) for 45 minutes and subjected to electrophoresis on a 2% TAE agarose gel. The gels were stained with ethidium bromide and imaged using Chemidoc (BioRad, Hercules, CA). Densiometric quantification of DNA bands was done using ImageJ. Mutation frequencies were calculated using the formula: fractional modification = 1– (1– (fraction cleaved))^0.5 as described.^{32 (link)}Fluorescence-activated cell sorting (FACS). Two days after transfection with EGFP-tagged MSTN-TALEN plasmid, NIH 3T3 cells and C2C12 cells were sorted by FACS (FACSAria II, BD) to enrich EGFP-positive cells. The sorted EGFP-positive cells were further cultured for 1 week and then the genomic DNA was extracted. The genomic DNA of sorted cells was analyzed for gene-editing activities by T7E1 assay. DNA fragment surrounding the TALEN target sites were PCR amplified from the genomic DNA of sorted cells with a forward primer 5′-AGTGGTCTCACTATACGTACACACTACCCCAACAGC-3′ and a reverse primer 5′-AGTGGTCTCACGCCCATGGGA CATGAGATTGACACA-3′. The PCR products were digested with SnaBI and NcoI restriction enzymes, and subcloned into a temporary vector based on pFastBac (Invitrogen, Carlsbad, CA). Ten clones were randomly picked up for direct DNA sequencing.
PCR genotyping of targeted integration. HEK293 cells in six well plates were transfected with 1 µg MSTN-TALEN and 1 µg human donor plasmid using X-tremeGENE HP DNA transfection Reagent (Roche, Indianapolis, IN). C2C12 cells were transfected with 4 µg MSTN-TALEN and 6 µg mouse donor plasmid using Xfect reagent (Clontech). After 48 hours, genomic DNA was extracted and targeted integration events in cell lines were identified by PCR analysis. The primers used are provided in Supplementary Table S1 online.
Fluorescence microscopy. Fluorescence and bright-field images were taken with NIS-Elements Advanced Research software package (Nikon, Tokyo, Japan) using an inverted Nikon Ti-E microscope equipped with a Xenon lamp (Hamamatsu Photonics Systems, Bridgewater, NJ), a 40x 1.30 NA objective (Nikon, Tokyo, Japan), and an Evolve 512 EMCCD camera (Photometrics, Pleasanton, CA). The EMCCD camera was cooled to –80 °C during imaging. ECFP-dysferlin integrated cells were also imaged with a confocal microscope (TCS-SP5, Leica Microsystems, Wetzlar, Germany), using the 514 nm line of an argon continuous laser as the excitation source. Fluorescence emission was collected with a 63x water immersion objective (HCX PL APO, 1.2 NA).
Western blotting. Cells were lysed with cold RIPA buffer supplemented with protease inhibitors and extracted protein samples were separated by SDS-PAGE and transferred onto Nitrocellulose membranes (0.45 µm). The mouse monoclonal anti-FLAG (Sigma-Aldrich, Saint Louis, MO), rabbit polyclonal anti-myostatin (#ab98337, Abcam), and rabbit monoclonal anti-GAPDH (Cell Signaling) antibodies were used for immunoblotting analysis. HRP conjugated rabbit antimouse and goat antirabbit secondary antibodies were obtained from Millipore, Billerica, MA. The membranes were developed using ECL2 western blotting substrate (Pierce Biotechnology, Rockford, IL) and imaged using ChemiDoc XRS+ system with Image Lab software (Bio-Rad).
Measurement of myotube diameter. Myotube cultures were photographed with a Nikon Ti-E microscope (as mentioned above) after 3 days and 6 days differentiation. Dexamethesone (100 µM) was added into the cultures on day 3 to day 6. The diameters were measured as previously described.^{44 (link)} Briefly, a total of 35–62 myotubes in different groups from at least five random fields were measured using ImageJ software (NIH, Frederick, MD). The measurements were conducted in a “blinded” fashion on coded pictures with the investigator being unaware of the group from which the cultures originated. Results were expressed as per cent of the diameters on day 3.
SUPPLEMENTARY MATERIALFigure S1. Amino acid sequences of the left MSTN TALEN.
Figure S2. Amino acid sequences of the right MSTN TALEN.
Figure S3. Sequence alignment of the MSTN genes from various species at the TALEN target sites.
Figure S4. Sequence variants in additional clones (a) and estimation of biallelic genome-editing activities (b).
Figure S5. Genotyping analysis of C2C12 cells transfected with either donor (mCherry-puromycinR) only, TALENs only, or donor plus TALENs.
Figure S6. Confocal images of HEK293 cells integrated with mCherry-puromycinR-2A-ECFP-dysferlin donor.
Figure S7. Genotyping analysis of HEK293 cells transfected with either donor (mCherry-puromycinR-2A-ECFP-dysferlin) only, TALENs only, or donor plus TALENs.
Table S1. Primers used for genotyping analysis of HR integration.
Table S2. List of potential off-target sites of the MSTN TALEN pair.

Xu L., Zhao P., Mariano A, & Han R. (2013). Targeted Myostatin Gene Editing in Multiple Mammalian Species Directed by a Single Pair of TALE Nucleases. Molecular Therapy. Nucleic Acids, 2(7), e112-.

Publication 2013

Meiotic Chromosome Analysis of Rock Lizards

Cited 4 times

Four adult animals were captured and examined in May 2017 and two in September 2017 and were deposited in the research collection of the Zoological Museum of Lomonosov Moscow State University (ZMMU). One male D. raddei (Zuar population, ZMMU R-15598, specimen VS0029) collected by E.A. Galoyan and V.E. Spangenberg in May 2017, one male D. raddei (Zuar population, ZMMU R-15599, specimen VS0039) collected by M.S. Arakelyan and V.E. Spangenberg in September 2017) and two males D. portchinskii (Zuar population, ZMMU R-15600, specimen VS0028, ZMMU R-15600, specimen VS0050) collected by M.S. Arakelyan, E.A. Galoyan, and V.E. Spangenberg in May and September 2017, respectively. The manipulations of the animals followed international rules of the Manual on Humane Use of Animals in Biomedical Research and the rules of the Ethics Committee for Animal Research of the Vavilov Institute of General Genetics (protocol No. 3 from November 10, 2016).
Spread SC preparations were prepared and fixed using the technique of Navarro et al. (1981) (link). Poly-l-lysine-coated slides were used for all immunofluorescence studies. The slides were washed with phosphate-buffered saline (PBS) and incubated overnight at 4 °C with primary antibodies diluted in antibody dilution buffer (ADB: 3% bovine serum albumin, 0.05% Triton X–100 in PBS).
Synaptonemal complexes were detected by rabbit polyclonal antibodies to the SC and axial element protein SYCP3 (1:250; Abcam, Cambridge, UK), centromeres were detected by anti-kinetochore proteins antibodies ACA (1:500; Antibodies Incorporated, Davis, CA, USA). The late recombination nodules (sites of crossing over) were detected using mouse monoclonal antibodies to the DNA mismatch repair protein — MLH1 (1:250; Abcam, Cambridge, UK). After washing, we used the secondary antibodies diluted in ADB: goat anti mouse immunoglobulin G (IgG), Alexa Fluor 555 (1:500; Abcam, Cambridge, UK), Rhodamine-conjugated chicken anti-rabbit IgG (1:400; Santa Cruz Biotechnology, Dallas, TX, USA), FITC-conjugated goat anti-rabbit IgG (1:500; Jackson ImmunoResearch, West Grove, PA, USA), goat anti-rabbit Alexa Fluor 488 (1:500; Invitrogen, Carlsbad, CA, USA), goat anti-human Alexa Fluor 546 (1:500; Invitrogen, Carlsbad, CA, USA). Secondary antibody incubations were performed in a humid chamber at 37 °C for 2 h. Mitotic chromosomes were prepared from bone marrow and spleen following Ford and Hamerton with modifications and fixed in an ice-cold acetic acid–methanol solution (1:3) (Ford & Hamerton, 1956 (link)). Telomere FISH probe (Telomere PNA FISH Kit/FITC, Dako, K5325) was used according to the manufacturer protocol.
The slides were examined using an AxioImager D1 microscope (Carl Zeiss, Oberkochen, Germany) equipped with an Axiocam HRm CCD camera (Carl Zeiss, Oberkochen, Germany), Carl Zeiss filter sets (FS01, FS38HE, and FS43HE) and image-processing AxioVision Release 4.6.3. software (Carl Zeiss, Oberkochen, Germany). All preparations were mounted in Vectashield antifade mounting medium with DAPI (Vector Laboratories, Burlingame, CA, USA). CENP proteins were compared by alignment (COBALT software program, http://www.ncbi.nlm.nih.gov/tools/cobalt/cobalt.cgi?CMD=Web).
Prophase I stages were determined by the analysis of the combination of basic morphological criteria used in studies of meiotic cells (Zickler & Kleckner, 1999 (link); Bogdanov & Kolomiets, 2007 ). The rock lizards-specific features of the prophase I stages were described before (Spangenberg et al., 2017 (link)). Early presynaptic stages criteria for leptotene: multiple fragments of unpaired axial elements, and for the zygotene: long partially synapsed axial elements, «bouquet» formation (telomere clustering at zygotene), no signs of desynapsis in telomere regions, no MLH1-protein foci. Mid-prophase I stage (pachytene) criteria: complete homologous chromosome synapsis, non-fragmented lateral elements of SCs, MLH1-protein foci. Postsynaptic stage (diplotene) criteria: signs of SCs disassembly (lateral elements desynapsis start in peritelomeric or interstitional regions, elongation and fragmentation), MLH1-protein foci maintenance.

Spangenberg V., Arakelyan M., Galoyan E., Pankin M., Petrosyan R., Stepanyan I., Grishaeva T., Danielyan F, & Kolomiets O. (2019). Extraordinary centromeres: differences in the meiotic chromosomes of two rock lizards species Darevskia portschinskii and Darevskia raddei. PeerJ, 7, e6360.

Publication 2019

Neuroendocrine Carcinoma of the Endometrium: A Clinicopathologic Study

Cited 3 times

Institutional Review Board approval was obtained prior to the initiation of this study. Twenty-five cases of NECa arising in the endometrium were retrieved from the files of the Department of Pathology at The University of Texas, MD Anderson Cancer Center (MDACC) covering a 15 year period (1999–2014). Twelve patients had their primary surgery performed at another hospital and were referred to MDACC for further treatment recommendations (i.e., referrals), and in 6 cases pathology material had been sent in consultation to our Pathology Department for a definitive diagnosis (i.e., consults). The remaining 7 patients had their primary surgery performed at MDACC. Both pure NECa and those associated with other histotype(s) were included in this study.
The diagnoses of SCNECa and LCNECa were made according to the WHO criteria for neuroendocrine tumors of the uterus ¹⁵. Briefly, SCNECa was recognized histologically as a tumor that resembled pulmonary small cell carcinoma (i.e., a tumor composed of cells with scant cytoplasm, a “salt and pepper chromatin pattern,” and nuclear molding). LCNECa was recognized by the following features: 1) the presence of polygonal cells with abundant cytoplasm and prominent nucleoli, 2) a NE growth pattern (i.e., organoid nesting, trabecular or cord-like growth), and 3) the expression of at least one NE immunomarker (chromogranin, synaptophysin, or CD56) in >10% of tumor cells. Other histotypes of endometrial cancer were diagnosed according to the WHO classification ¹⁵.
Clinical information was obtained from the patients’ charts or from their treating physicians. The following parameters were recorded: patients’ ages, clinical presentation, treatment, and follow-up. In all cases, pathology reports and all available original hematoxylin-and-eosin (H&E) stained slides were re-reviewed (1 to 49 slides per case; median, 5 slides). In addition, we re-reviewed all available original IHC stained slides. The following parameters were recorded: tumor size, histotype (SCNECa, LCNECa, mixed), lymph-vascular space invasion (LVSI), geographic necrosis, and mitotic index (MI). MI was obtained by counting 10 consecutive high power fields (HPFs) in the most mitotically active area of the tumor.
On 18 cases with available unstained slides or blocks, additional IHC stains were performed using the avidin-biotin method. These additional IHC stains included pankeratin cocktail (AE1/AE3, 1:50, Dako, Carpinteria, CA; Cam5.2, 1:50, BD Biosciences, San Jose, CA; MNF116, 1:50, Dako), cytokeratin 18 (DC10, 1:50, Dako), PAX-8 (polyclonal, 1:100, Protein Tech, Chicago, IL), p16 (E64H, 1:3 of pre-dilute, Ventana, Tuscon, AZ), CD117 (polyclonal, 1:100, Dako), TTF-1 (8G7G3/1, 1:20, Dako), MLH1 (G168-728, 1:300, Cell Marque, Rocklin, CA), PMS2 (A16-4, 1:125, BD Biosciences), MSH2 (FE11, 1:100, Calbiochem, San Diego, CA), and MSH6 (44, 1:300, BD Biosciences). In situ hybridization for Human papillomavirus (HPV) types 16, 18, 31, 33, and 51 (ENZ-32882, pre-dilute, Enzo Life Solutions, Farmingdale, NY) was also performed. IHC stain results were assessed semiquantitatively as follows: negative (no cells stained), focally positive (≤ 10% cells stained), patchy positive (11% to 49% cells stained) and diffusely positive (≥ 50% of cells stained). Of note, in most cases the IHC studies were obtained from blocks that contained the NECa component exclusively.
In a subset of cases that demonstrated mismatch repair (MMR) protein expression abnormalities, the H&E stained slides were re-reviewed to assess for the presence or absence of tumor-infiltrating lymphocytes. The clinical record was also re-reviewed for any history of previous or concurrent malignancies in the patient and close family members.
The International Federation of Gynecology and Obstetrics (FIGO) classification ^{16 (link)} was used for staging.

Pocrnich C.E., Ramalingam P., Euscher E.D, & Malpica A. (2016). Neuroendocrine Carcinoma of the Endometrium: A Clinicopathologic Study of 25 Cases. The American journal of surgical pathology, 40(5), 577-586.

Publication 2016

Genetic Screening for Colorectal Cancer Families

Cited 2 times

Participants in this study were recruited by the Australasian Colorectal Cancer Family Registry (ACCFR), a large family cohort which is part of the Colon Cancer Family Registry, an international consortium funded by the National Cancer Institute (U.S.A.) (Newcomb et al. 2007 ). The ACCFR was established in 1997 and currently contains data from approximately 10,500 participants representing approximately 1500 colorectal cancer families. The ACCFR recruited family members via population-based probands (i.e., recently diagnosed CRC cases) from the Victorian Cancer Registry (Australia), and via clinic-based probands from multiple-case families referred to family cancer genetics clinics in Australia (Melbourne, Adelaide, Perth, Brisbane, Sydney) and New Zealand (Auckland).
At the time of recruitment for this study there were 1250 ACCFR participants from 188 mismatch repair gene mutation-carrying families. Deceased participants and those lost to followup were excluded. To be eligible for this study, participants had to be from families in which at least one person had been identified by genetic testing as carrying a deleterious mutation in a mismatch repair gene, had to be between 18 and 69 years old at recruitment into this study, had no previous diagnosis of CRC or any other cancer, and had to have declined an offer within the previous ten years by the ACCFR to attend a genetics service to receive their individual genetic test results (n = 134). Of these, 47 agreed to be contacted about the study; 21 of these were found to be ineligible because of having previous genetic testing or cancer, or they subsequently declined to be interviewed. The 26 participants included in the study represent 22 mismatch repair mutation-carrying families (two participants per family for four families). Screening for germline mutations in MLH1, MSH2, MSH6 and PMS2 was performed for all population-based probands who had a colorectal tumour displaying evidence of impaired mismatch repair function. Impaired mismatch repair was evidenced by either microsatellite instability (MSI), or by lack of mismatch repair protein expression by immunohistochemistry. Screening was performed also for the youngest onset CRC case from each clinic-based family regardless of MSI or mismatch repair protein expression status, and for their family members if they were found to have deleterious mismatch repair gene mutations (described in detail elsewhere) (Win et al. 2012 (link)). Participant characteristics including mutation status are summarised in Table 1.
This study was approved by the Human Research Ethics Committee of the University of Melbourne and all participants gave informed consent.

Flander L., Speirs-Bridge A., Rutstein A., Niven H., Win A.K., Ouakrim D.A., Hopper J.L., Macrae F., Keogh L., Gaff C, & Jenkins M. (2013). Perceived versus predicted risks of colorectal cancer and self-reported colonoscopies by members of mismatch repair gene mutation-carrying familieswho have declined genetic testing. Journal of genetic counseling, 23(1), 79-88.

Publication 2013

Most recents protocols related to «Mismatch repair protein 1, human»

Immunohistochemical Analysis of MMR Proteins

Staining for MMR proteins was performed on all specimens. It was used to stain the 10% FFPE four-micrometer-thick sections according to the manufacturer’s instructions (Agilent Dako, Glostrup, Denmark). Monoclonal antibodies specific to the mismatch repair genes were employed, including Mouse Monoclonal Anti-Human MutL Protein Homolog 1 (MLH1, Clone ES05), Mouse Monoclonal Anti-Human MutS Protein Homolog 2 (MSH2, Clone FE11), Rabbit Monoclonal Anti-Human MutS Protein Homolog 6 (MSH6, Clone EP49), and Rabbit Monoclonal Anti-Human Postmeiotic Segregation Increased 2 (PMS2, Clone EP51). All four proteins were detected in the nucleus. When nuclear staining of any of the four proteins was missing, or MLH1/PMS2 or MSH2/MSH6 were negative, mismatch repair deficiency (MMRd) was suspected. Endometrial cancer that lacked a pathogenic POLE variant but retained MMR protein expression and wild-type p53 IHC was classified as a “no specific molecular profile” (NSMP) variant. Upon observation of a complete loss of nuclear expression of certain MMR proteins (MLH1, MSH2, MSH6, PMS2) in carcinoma cells using IHC, the proteins are considered deficient or absent. Atypical p53 protein expression in carcinoma cells was identified as either intense and widespread nuclear staining or a total absence of staining, termed “null.” Meanwhile, faint and uneven staining was categorized as indicative of wild-type expression. For both MMR and p53 staining, stromal and inflammatory cells served as internal controls. When applicable, samples with few carcinoma cells or completely negative staining of the internal controls were discarded.

Dobrzycka B., Terlikowska K.M., Kowalczuk O., Niklinski J., Kinalski M, & Terlikowski S.J. (2024). Prognosis of Stage I Endometrial Cancer According to the FIGO 2023 Classification Taking into Account Molecular Changes. Cancers, 16(2), 390.

Publication 2024

Hereditary Cancer Predisposition Genetics

In order to evaluate whether variants in DNA repair genes might be associated with hereditary predisposition in the Tunisian population, a set of 169 genes (Supplementary Table S1) have been investigated. This list included known genes associated with hereditary predisposition to cancer in addition to other genes belonging to 7 major DNA repair pathways retrieved from KEGG GENES Database (https://www.genome.jp/kegg/genes.html) and mdanderson data (https://www.mdanderson.org/documents/Labs/Wood-Laboratory/human-dna-repair-genes.html) and it was limited to 24 genes for patients investigated by gene panel. The 7 major DNA repair pathways are as follows: 1) Base-excision repair (BER) 2) Mismatch repair (MMR) 3) Nucleotide-excision repair (NER) 4) Homologous recombination (HR) 5) Nonhomologous end joining (NHEJ) 6) Translesional synthesis (TLS) and 7) Fanconi Anemia pathways. Among these genes, unclassified genetic variants described as variants of uncertain significance, having conflicting interpretations of pathogenicity in the ClinVar database or not described in public databases were selected for further analyses.
Protein-protein interaction network and functional enrichment analyses were performed using String (Jensen et al., 2009 (link)) and EnrichR databases (Kuleshov et al., 2016 (link)).

Boujemaa M., Nouira F., Jandoubi N., Mejri N., Bouaziz H., Charfeddine C., Ben Nasr S., Labidi S., El Benna H., Berrazega Y., Rachdi H., Daoud N., Benna F., Haddaoui A., Abdelhak S., Samir Boubaker M., Boussen H, & Hamdi Y. (2024). Uncovering the clinical relevance of unclassified variants in DNA repair genes: a focus on BRCA negative Tunisian cancer families. Frontiers in Genetics, 15, 1327894.

Publication 2024

Gastric Cancer PD-1 Inhibitor Retrospective Study

This retrospective study included 140 patients with advanced gastric cancer who were treated with PD-1 inhibitors in the Oncology Department of our hospital from June 2021 to June 2023. The following clinical characteristics of the patients were recorded: (1) General demographic data, including age (taking into account differences in immune status between older and younger patients); (2) Differences in (with 65 years as the classification limit) sex and number of treatment lines; (3) Basic tumor characteristics, including tumor-node-metastasis (TNM) stage, Ki-67 index, human epidermal growth receptor 2 (Her-2) expression, PD-1/PD-L1 expression, mismatch repair (MMR) protein expression; and (4) Laboratory test indicators before receiving PD-1 inhibitor treatment, tumor markers (alpha-fetoprotein), carcinoembryonic antigen, carbohydrate antigen 19-9 (CA19-9), CA125, CA153, CA724, and cytokeratin fragment antigen 21-1, CA50, CA242, squamous cell carcinoma antigen, neuron-specific enolase, and prostate-specific antigen, endocrine related indicators (thyroid-related hormone, growth hormone, sex hormone 6, cortisol, adrenocorticotropic hormone, amylase), antinuclear antibody expression, routine blood indicators [white blood cell count, neutrophil count, monocyte count, lymphocyte count, C-reactive protein (CRP) level, neutrophil count/lymphocyte count, neutrophil count/CRP, white blood cell count/CRP], lymphocyte subsets [differentiated antiprogenitor 19 (CD19), CD3, CD4, CD8, CD4/CD8, CD56], regulatory T cells (Treg), interferon-α, interleukin-17 (IL-17), tumor necrosis factor-α, IL-2, IL-4, IL-6, IL-8, IL-10.

He X.X., Du B., Wu T, & Shen H. (2024). Prognostic analysis of related factors of adverse reactions to immunotherapy in advanced gastric cancer and establishment of a nomogram model. World Journal of Gastrointestinal Oncology, 16(4), 1268-1280.

Publication 2024

Comparison of MMR and MSI Tests

Sample collection. Throughout 2018–2023 we have tested 1306 tumor samples for dMMR/MSI status where the two methods have been run parallel in 703 cases for the request of the interdisciplinary panel (Table 1). Our Department serves as molecular pathology center for primary and secondary oncology clinics, accordingly the waste majority of these cases were primarily diagnosed in local pathology departments. In 64 cases technical failures, mostly due to identified preanalytical factors (typically poor fixation) prevented the performance of the tests. The retrospective analysis of this cohort was approved by the local Ethic Committee of the Semmelweis University (RKEB62/2023).Table 1

Characterization of the cancer patient cohort

	Male	Age mean ± SD	Female	Age mean ± SD	MMR and/or MSI tests	MMR and MSI tests
Cancers	701	65 ± 8.9	605	64 ± 9.2	1306	703
Colorectal	556	65 ± 8.8	422	65 ± 9.0	978	543
Endometrial			39	59 ± 9.3	39	27
Pancreatic	15	67 ± 7.4	21	61 ± 8.0	36	14
Gastric	22	67 ± 9.3	11	71 ± 9.2	33	27
Biliary	8	65 + 6.8	12	67 ± 6.8	20	10
Esophageal	13	65 + 6.5	3	54 ± 6.9	16	13
Ovarian			14	58 ± 10.2	14	10
Breast			11	51 ± 7.5	11	4
Liver	4	48 ± 7.1	6	71 ± 11.9	10	3
Others	17	60 ± 11.0	6	63 ± 12.1	23	12
CUP	66	63 ± 9.4	60	61 ± 9.4	126	40

Other cancers: appendiceal, nasopharyngeal, peritoneal, pharyngeal, prostate, small intestinal, testicular, thyroideal

CUP cancer of unknown primary, MMR mismatch repair protein, MSI microsatellite instability

MMR protein staining. Immunohistochemistry of the MMR proteins was performed on FFPE blocks by using ready-to-use mouse monoclonal antibodies of Ventana (Tucson, AR), anti- MLH1(M1), anti-MSH2 (G219-1129), anti-PMS2 (A16-4) and rabbit monoclonal anti-MSH6 (SP93). The immunoreaction was developed by the DAB Ultraview kit in the BenchmarkUltra automatic stainer (Ventana). Two types of positive controls have been used: in case of each antibodies a parallel positive control sample was used as well as in the tumor stroma fibroblasts and lymphoid cells served as inner controls. dMMR was reported as classical two-protein negativities (MLH1/PMS2 or MSH2/MSH6 losses), non-classical single- or multiple negativities in > 90% of tumor cells or as unusual (focal/subclonal or heterogenous negativities of > 10 to < 90% of tumor cells) in the background of positive stromal cells. In case of weaker tumor cell staining compared to normal cells or negative stromal cell nuclear staining, the case reported to be equivocal [27 (link)–29 (link)].
MSI-PCR. The specimen was processed to review its morphology on H&E stained slides and tumour and non-tumour areas were dissected separately from unstained sections for DNA extraction (High Pure PCR Template Preparation Kit–Roche). DNA was then amplified by PCR for five mononucleotide microsatellite markers (BAT-25, BAT-26, MONO-27, NR-21 and NR-24) and two pentanucleotide markers (Penta C and Penta D as internal technical controls for PCR) using Promega MSI Analysis System Version 1.2, followed by fragment analysis of the PCR products using ABI 3730 Genetic Analyzer. Genotype patterns of the MSS K562 human cell line and tumour samples were compared for each marker. Samples are defined as MSI-high if two or more of the five markers are unstable, MSI-indeterminate (MSI-low) if one marker is unstable and MS-stable if there is no detectable alterations of the 5 markers. The sensitivity of the test is 10% according to the manufacturer.
Statistics. During the comparison of MMR-immunohistochemistry to the MSI-PCR results, specificity, sensitivity, positive- and negative predictive values have been calculated. Furthermore, Kappa correlation coefficients were also calculated according to Cohen’s method with the cut-off value > 0.7 [30 (link)].

Nádorvári M.L., Kenessey I., Kiss A., Barbai T., Kulka J., Rásó E, & Tímár J. (2024). Comparison of standard mismatch repair deficiency and microsatellite instability tests in a large cancer series. Journal of Translational Medicine, 22, 150.

Publication 2024

Optimized CRISPR-PE System for Grape Genome Editing

We made our version of PEmax with the rice codon‐optimized PE (pYPQ166‐OsPE2, Addgene 141 080). We introduced two mutations (R221K and N394K) by synthesis of the fragment with these two codon changes between SgrDI and NheI sites (~840 bp) and replaced the corresponding fragment in pYPQ166‐OsPE2 to create pYY166‐OsPEmax. Our PEmax differs from the published PEmax in lacking the linker and the extra NLSs at the C‐terminal (Chen et al., 2021 (link)).
For the design of pegRNAs, we used the web app developed by Lin et al., 2021 (link) (http://www. plantgenomeediting.net/) to determine desirable paired pegRNA options, spacer sequence choices, length of PBS, and the RT template. To assist downstream characterization of transgenic callus and vines, we introduced an AclI restriction site into the engineered muscat allele (VvDXS1^e) (GCCAAGgttagta to GCCAACgttagta). For the design of a small guide RNA scaffold, we used the “flip and extension” sgRNA scaffold with improved Cas9 binding and editing efficiencies (Chen et al., 2013 (link)). Furthermore, we added a tevopreQ1 sequence (CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA) to the end of each pegRNA to prevent degradation and improve editing efficiency (Nelson et al., 2022 (link)). To express multiple pegRNAs under one promoter, we adopted the polycistronic tRNA‐gRNA system (Xie et al., 2015 (link)). The tRNA‐epegRNA1‐tRNA‐epegRNA2 sequences were synthesized by GenScript with cloning sites (BamHI/KpnI) at their ends so that the fragments could be cloned into the gateway entry vector pYPQ141B‐RZ‐Lb. To further optimize pegRNA expression, we replaced the AtU3 promoter with the grape U6.2 promoter (Ren et al., 2021 (link)).
To further improve the PE system in grapes, we introduced a dominant negative form of a DNA mismatch repair enzyme (MLH1dn) into our construct design (Chen et al., 2021 (link)). A blast search of the human MLH1 sequence in the grape genome retrieved a gene with a coded protein sequence of 40% similarity (LOC100854779). We deleted the last three conserved amino acids, which are catalytically important and highly conserved for MLH1 across species, synthesized the corresponding DNA fragment, and placed it under a 35S promoter (35S:VvMLHdn) with flanking sequences complimentary to the pMDC32‐SpeI site. This 35S:VvMLHdn was cloned into the gateway binary vector pMDC32, cut by SpeI via HiFi assembly, to create pMDC32‐35S:MLMdn (pMMdn). Meanwhile, we also replaced the 35S promoter in pMMdn with the grape Ubi2 promoter to improve PE expression (Ren et al., 2021 (link)) (pUMdn). To assist visualization of transformation efficiency in callus and plants, we had a 35S:eGFP cassette inserted in the pMDC32 binary vector (pMGF) (Figure 1). The final constructs were built by gateway assembly with a binary vector (pMGF or pUMdn), an entry vector with PEmax (pYY166‐PEmax), and an entry vector for the polycistronic tRNA‐pegRNAs (141BU6‐epegRNAs) to form PE constructs PD1 and PD2 (Figure 1, Data S1).

Yang Y., Wheatley M., Meakem V., Galarneau E., Gutierrez B, & Zhong G. (2024). Editing VvDXS1 for the creation of muscat flavour in Vitis vinifera cv. Scarlet Royal. Plant Biotechnology Journal, 22(6), 1610-1621.

Publication 2024

Top products related to «Mismatch repair protein 1, human»

Dako autostainer link 48 platform by Agilent Technologies

Sourced in United States

The Dako Autostainer Link 48 platform is a fully automated slide staining system designed for immunohistochemistry (IHC) and in situ hybridization (ISH) applications. It is capable of processing up to 48 slides simultaneously, providing consistent and standardized staining results.

Normal goat serum (ngs) by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Canada, China, Italy

Normal goat serum is a biological material derived from the blood of healthy goats. It is used as a protein supplement and blocking agent in various immunological and cell culture applications.

Bond 3 by Leica

Sourced in Germany, United States, United Kingdom, Australia, Italy, Switzerland, Japan, Denmark, Israel, Azerbaijan

The Bond III is a laboratory instrument designed for biomolecular interaction analysis. It is capable of measuring and analyzing the binding interactions between various molecules, such as proteins, peptides, small molecules, and nucleic acids. The Bond III provides real-time kinetic data and quantitative information about the strength and specifics of these interactions.

Collagenase type 4 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, France, Belgium, Japan, Italy, China

Collagenase type IV is a proteolytic enzyme used to dissociate, isolate, and culture cells from a variety of tissues. It selectively cleaves type IV collagen, a major component of basement membranes.

Recombinant human dnase by Roche

Sourced in United States

Recombinant human DNase is a laboratory enzyme used to degrade DNA. It is produced using recombinant DNA technology.

Mouse anti human mlh 1 cloneg168 728 by Cell Marque

Mouse anti-human MLH-1 (clone G168-728) is a laboratory reagent used for the detection of the MLH1 protein in human tissues. MLH1 is a key component of the DNA mismatch repair system and its expression is often altered in certain types of cancer. This antibody can be utilized in various immunohistochemical techniques to assess the presence and distribution of the MLH1 protein in research or diagnostic applications.

Pd l1 ihc 22c3 pharmdx assay by Agilent Technologies

Sourced in United States, Japan, China

The PD-L1 IHC 22C3 pharmDx assay is a semi-quantitative immunohistochemical assay used to detect the programmed death-ligand 1 (PD-L1) protein in formalin-fixed, paraffin-embedded (FFPE) tissue specimens. The assay utilizes the 22C3 anti-PD-L1 antibody and is intended for in vitro diagnostic use.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Rpmi medium by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, France, Japan, Spain, Canada, Switzerland, Australia, Italy, China, Ireland, Belgium, Israel

RPMI medium is a commonly used cell culture medium formulation developed at the Roswell Park Memorial Institute. It provides a balanced salt solution and essential nutrients to support the growth and maintenance of a variety of cell types, including mammalian cells, in in vitro cell culture applications.

Ab221703 by Abcam

Sourced in United Kingdom

Ab221703 is a laboratory reagent used for research purposes. It serves a core function in scientific experiments, but its specific intended use is not provided in this factual and unbiased description.

What are the different variations or types of Mismatch Repair Protein 1, human?

Mismatch Repair Protein 1, human is a single protein that plays a crucial role in the DNA mismatch repair system. However, there are different isoforms or splice variants of this protein that can exhibit slightly different functional properties or localization within the cell. Researchers may need to consider these variations when studying the specific role of Mismatch Repair Protein 1 in various cellular processes and pathways.

How does Mismatch Repair Protein 1, human contribute to genome stability and cancer prevention?

Mismatch Repair Protein 1 is a key component of the DNA mismatch repair system, which is responsible for identifying and correcting base-pairing errors that occur during DNA replication. By maintaining genomic integrety, Mismatch Repair Protein 1 helps prevent the accumulation of mutations that can lead to cancer development. Dysfunction or deficiency of this protein has been strongly linked to various types of cancer, making it an important target for research and potential therapeutic interventions.

What are some common challenges or considerations when working with Mismatch Repair Protein 1, human?

One key challenge when working with Mismatch Repair Protein 1 is ensuring that you are using the most effective and reproducible protocols for your specific research goals. Different experimental methods and reagents can impact the activity and function of this protein, so it's important to carefilly optimize your approaches. PubCompare.ai can help by using AI-driven analysis to identify the most effective protocols from the literature, pre-prints, and patents, allowing you to choose the best option and achive more reliable results.

How can PubCompare.ai assist in the optimal use and comparison of Mismatch Repair Protein 1, human?

PubCompare.ai's AI-driven platform can help streamline your research on Mismatch Repair Protein 1, human in several ways: 1. Efficient protocol screening: PubCompare.ai allows you to rapidly screen through the vast literature on Mismatch Repair Protein 1 protocols to identify the most relevant and effective ones for your needs. 2. AI-driven insight generation: The platform's intelligent algorithms can analyze the protocol details and highlight key differences in effectiveness, enabling you to make more informed decisions about the best approaches to use. 3. Improved reproducibility: By identifying the most robust and reproducible protocols, PubCompare.ai helps you achive better, more reliable results when working with Mismatch Repair Protein 1. 4. Comparative analysis: PubCompare.ai makes it easy to compare multiple protocols side-by-side, so you can thoroughly evaluate the tradeoffs and choose the optimal method for your specific research goals.

More about "Mismatch repair protein 1, human"

Mismatch Repair Protein 1, also known as MLH1, is a critical component of the DNA mismatch repair (MMR) system in humans.
This protein plays a vital role in recognizing and correcting base-pairing errors that occur during DNA replication, thereby maintaining genomic stability and preventing the accumulation of mutations.
Dysfunction of MLH1 has been associated with various types of cancer, making it an important target for research and therapeutic development.
The MMR system, of which MLH1 is a key member, is responsible for detecting and repairing mismatched base pairs that arise due to DNA replication errors.
MLH1 works in conjunction with other MMR proteins, such as MSH2, MSH6, and PMS2, to identify and correct these errors.
This process is crucial for maintaining the fidelity of the genetic code and preventing the development of genetic disorders and cancer.
In addition to its role in DNA repair, MLH1 is also involved in several other cellular processes, including DNA damage response, cell cycle regulation, and apoptosis.
Disruptions in these pathways can lead to genomic instability and the development of cancer.
Researchers have utilized various experimental techniques and platforms to study the function and regulation of MLH1.
For example, the Dako Autostainer Link 48 platform is commonly used for immunohistochemical (IHC) analysis of MLH1 expression in tissue samples.
Additionally, normal goat serum and the Bond III system have been employed in IHC protocols to detect MLH1 in fixed and paraffin-embedded tissues.
Furthermore, enzymes like Collagenase type IV and Recombinant human DNase have been used in sample preparation and cell culture experiments to investigate the role of MLH1 in cellular processes.
The availability of specific antibodies, such as the Mouse anti-human MLH-1 (clone G168-728) antibody, has also facilitated the study of MLH1 expression and localization.
The PD-L1 IHC 22C3 pharmDx assay, which measures the expression of the Programmed Death-Ligand 1 (PD-L1) protein, has emerged as a valuable tool in cancer research and treatment, as it can provide insights into the immune landscape of tumors and guide the selection of appropriate immunotherapies.
In this context, the interplay between MLH1 and PD-L1 has become an area of active investigation, as they may collectively influence the tumor microenvironment and treatment responses.
In cell culture experiments, the use of FBS (Fetal Bovine Serum) and RPMI medium has been instrumental in providing a suitable environment for the study of MLH1 and its associated cellular pathways.
Additionally, the availability of recombinant proteins, such as the Ab221703 antibody, has enabled researchers to further dissect the structure, function, and interactions of MLH1 in various experimental settings.
By leveraging the insights gained from the study of Mismatch Repair Protein 1 (MLH1) and its associated technologies, researchers and clinicians can advance our understanding of the role of this key player in DNA repair, cancer development, and potential therapeutic interventions.
The continued exploration of MLH1 and its interrelated pathways holds promise for improving cancer diagnosis, prognosis, and personalized treatment strategies.