> Chemicals & Drugs > Amino Acid > Opioid Receptor

Opioid Receptor

Q: What are some common challenges in opioid receptor research?

One of the key challenges in opioid receptor research is ensuring the reproducibility and accuracy of experimental protocols. Researchers often have to sift through a vast amount of literature, pre-prints, and patents to identify the most effective protocols for their specific research goals, which can be time-consuming and error-prone.

Opioid receptors are a class of G protein-coupled receptors that bind endogenous and exogenous opioid ligands.
These receptors play a crucial role in pain perception, mood regulation, and addiction processes.
There are several subtypes of opioid receptors, including mu, delta, and kappa receptors, each with distinct physiological and pharmacological properties.
Opioid receptor research is crucial for understanding the mechanisms underlying opioid-related disorders and developing effective treatments.
PubCompare.ai can enhance your opioid receptor research by helping you locate the best protocls from literature, pre-prents, and patents, optimizing your experiments for improved reproducibility and accuracy.

Most cited protocols related to «Opioid Receptor»

Paclitaxel-induced Neuropathic Pain in Mice

Cited 19 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2014

Allodynia AM 630 AM 1710 Animals antagonists Cardiac Arrest CCL2 protein, human Chemokine Common Cold cremophor Cytokine Endocannabinoids fatty acid amide hydrolase Genotype Inflammation Interleukin-1 beta Mice, Inbred C57BL Monoacylglycerol Lipases Mus Opioid Receptor Paclitaxel Receptor, Cannabinoid, CB1 Receptor, Cannabinoid, CB2 Rectum Rimonabant RNA, Messenger Tumor Necrosis Factor-alpha Withdrawal Symptoms

Plasmid Encoding G Protein Signaling

Cited 12 times

pcDNA3.1+ plasmids encoding the M3 muscarinic acetylcholine receptor, the β2AR, the bradykinin B2 receptor, the δ-opioid receptor (DOR), and the κ-opioid receptor (KOR) were purchased from the Missouri S&T cDNA Resource Center. cDNA encoding the M1 muscarinic acetylcholine receptor was purchased from OriGene. Plasmid encoding the Flag-tagged, long isoform of the D2 dopamine receptor was a gift from Dr. Abraham Kovoor (University of Rhode Island). Plasmids encoding GABA_B R1 and GABA_B R2 were provided by Dr. Kevin Wickman (University of Minnesota). Plasmid encoding the Flag-tagged µ-opioid receptor (MOR) was a gift from Dr. Pin-Yee Law (University of Minnesota). pcDNA3.1+ plasmids encoding GαoB, Gαz, Gα11, Gα14, Gα15, Gαs long isoform (GαsL), Gαolf, and Gα13 were purchased from the Missouri S&T cDNA Resource Center. pCMV5 plasmids encoding GαoA, Gαi1, Gαi2, Gαi3, Gαq, and Gαs short isoform (GαsS) were gifts from Dr. Hiroshi Itoh (Nara Institute of Science and Technology, Japan). Plasmids encoding masGRK3ct-Rluc8, Venus 156-239-Gβ1, and Venus 1–155-Gγ2 were gifts from Dr. Nevin Lambert (Georgia Regents University) (36 (link)). Flag-tagged Ric-8A in pcDNA3 and Flag-tagged Ric-8B in pcDNA3.1 were gifts from Dr. Jean-Pierre Montmayeur (CNRS, France) (76 (link)) and Dr. Bettina Malnic (Universidade de São Paulo, Brazil) (77 (link)), respectively. pcDNA3.1+ plasmids encoding AGS1 and triple HA-tagged RGS8 were purchased from the Missouri S&T cDNA resource Center. The masGRK3ct-Nluc construct contained cDNA encoding amino acid residues 495 to 688 of bovine GRK3 (NP_776925), which was preceded by a myristic acid attachment peptide (mas; MGSSKSKTSNS). The stop codon of GRK3 was replaced with a GGGS linker (78 (link)), which was followed by the NanoLuc (Nluc). Nluc-Epac-VV constructs were generated by replacing mTurquoise of the FRET-based cAMP sensor (78 (link)) with Nluc.

Masuho I., Ostrovskaya O., Kramer G.M., Jones C.D., Xie K, & Martemyanov K.A. (2015). Distinct profiles of functional discrimination among G proteins determine the actions of G protein–coupled receptors. Science signaling, 8(405), ra123.

Publication 2015

Amino Acids Bos taurus Bradykinin B2 Receptor Codon, Terminator DNA, Complementary DRD2 protein, human erythromycin propionate-N-acetylcysteinate Fluorescence Resonance Energy Transfer Gifts GRK3 protein, human Muscarinic Acetylcholine Receptor Myristic Acid nanoluc Opioid Receptor Peptides Plasmids Protein Isoforms

Microinjection and Electroporation in Rat Brainstem

Cited 8 times

As previously described (Guo et al., 2006 (link)), rats were anesthetized with 2–3% isoflurane in a gas mixture of 30% O₂ balanced with nitrogen and placed in a Kopf stereotaxic instrument (Kopf Instruments, Tujunga, CA, USA). A midline incision was made after infiltration of lidocaine (2%) into the skin. A midline opening was made in the skull with a dental drill to insert a microinjection needle into the target site. The RVM is termed for collective structures that consist of the midline nucleus raphe magnus (NRM) and the adjacent gigantocellular reticular nucleus alpha part (NGCα). The coordinates for the NRM were as follows:10.5 mm caudal to bregma, midline and 9.0 mm ventral to the surface of the cerebellum (Paxinos and Watson, 2005 ). To avoidpenetration of the transverse sinus, the incisor bar was setat 4.7 mm below the horizontal plane passing through the interaural line. Animals were subsequently maintained at ~1% halothane. Microinjections were performed by delivering drug solutions slowly over a 10 min period using a 0.5 μl Hamilton syringewith a 32 gauge needle. For gene transfer, Suresilencing^TM shRNA plasmids for Rat Tph-2 were used to design the enclosed shRNA (Tph-2: TCAACATGCTCCATATTGAAT) or scrambled control (negative control Tph-2: ggaatctcattcgatgcatac) and contained the GFP gene (SuperArray, Frederick, MD, USA). Each vector (0.5 μg/0.5 μl) was injected into the RVM. The injection needle was left in placefor at least 15 min before being slowly withdrawn. A pair of Teflon coated silver positive and negative electrodes were placed around the microinjection sites rostrocaudally. For transfer of negatively charged plasmid into RVM neurons, seven square wave electric pulses (50 ms, 40 V, 1 Hz; model 2100; A-M Systems, Carlsborg, WA, USA) were delivered. The wound was closed and animals returned to their cages after they recovered from anesthesia. In some experiments, control or Tph-2 shRNA plasmids was injected to the RVM and then followed by placing electrodes without electroporation. In addition, some groups of animals at 3 d after gene transfer were subjected to injection of the human recombinant brain-derived neurotrophic factor (BDNF, 100 fmol, Amgen, Thousand Oaks, CA) (Guo et al., 2006 (link)), the μ-opioid receptor agonist [D-Ala², NMePhe⁴, Gly-ol⁵] enkephalin (DAMGO, 40 or 100 pmol/0.5μl), Sigma, St Louis, MO, USA) (Hurley et al., 2003 ), or the κ-opioid receptor (KOR) agonist trans-(±)-3,4-Dichloro-N-methyl-N-[2-(1-pyrrolidinylcyclohexyl] benzeneacetamide hydrochloride (U50488, 5 or 20 nmol/0.5 μl, Sigma, St Louis, MO, USA) (Hirata et al., 2000 (link)) or N-methyl-N-((5R,7S,8S)-7-(1-pyrrolidinyl)-1-oxaspiro(4.5)dec-8-yl)benzeneacetamide (U69593, 0.1, 0.5 or 3 nmol/0.5 μl) (Pan et al., 1997 (link); Ackley et al., 2001 (link)). BDNF, DAMO and U50488 were dissolved in ACFS. U69593 was dissolved in 10% (w/v) 2-hydroxy-b-cyclodextrin, Sigma, St Louis, MO, USA). The control rats underwent identicalprocedures with injection of the same volume (0.5 μl) of the vehicles. All wound margins were covered with a local anestheticointment (Nupercainal; Rugby Laboratories), the wound was closed, and animals returned to their cages after they recovered from anesthesia.

Wei F., Dubner R., Zou S., Ren K., Bai G., Wei D, & Guo W. (2010). Molecular Depletion of Descending Serotonin Unmasks Its Novel Facilitatory Role in the Development of Persistent Pain. The Journal of Neuroscience, 30(25), 8624-8636.

Publication 2010

Anesthesia Animals brain-derived neurotrophic factor, human Cell Nucleus Cerebellum Cleft Palate, Cardiac Defect, Genital Anomalies, and Ectrodactyly Cloning Vectors Cranium Cyclodextrins Dental Health Services Drill Electricity Electroporation Therapy Enkephalin, Ala(2)-MePhe(4)-Gly(5)- Enkephalins Genes Gene Transfer, Horizontal Halothane Incisor Isoflurane Lidocaine Microinjections Needles Neurons Nitrogen Nucleus Raphe Magnus Nupercainal Opioid Receptor Pharmaceutical Solutions Plasmids Pulses Quercus Rattus Receptors, Opioid, mu Short Hairpin RNA Silver Skin Teflon Transverse Sinuses U-50488 Wounds

Opioid Receptor Selectivity Binding Assay

Cited 8 times

Details of the binding assay was conducted to study the selectivity of the ligands by using monocloned opioid receptor expressed in Chinese hamster ovarian (CHO) cell lines as described previously.44 (link),45 (link) [³H]naloxone, [³H]NTI, and [³H]norBNI were used to label the μ, δ, and κ opioid receptors, respectively. Aliquots of a membrane preparation were incubated with the radioligands in the presence of different concentrations of the drug under investigation at 30 °C for 1 h. Specific (i.e., opioid receptor related) binding was determined as the difference in binding obtained in the absence and presence of 10 μM naltrexone. The potency of the drugs in displacing the specific binding of the radioligand was determined from data using linear regression analysis of Hill plots. The IC₅₀ values will then be determined and corrected to K_i values using the Cheng–Prusoff equation. Functional assays, including ³⁵S-GTP[γS]-binding assay, were conducted in the same cell membranes used for the receptor binding assays. Three μM of DAMGO was included in the assay for a maximally effective concentration of a full agonist for the μ opioid receptor.

Li G., Aschenbach L.C., Chen J., Cassidy M.P., Stevens D.L., Gabra B.H., Selley D.E., Dewey W.L., Westkaemper R.B, & Zhang Y. (2009). Design, Synthesis, and Biological Evaluation of 6α- and 6β-N-Heterocyclic Substituted Naltrexamine Derivatives as μ Opioid Receptor Selective Antagonists. Journal of medicinal chemistry, 52(5), 1416-1427.

Publication 2009

Biological Assay CHO Cells Enkephalin, Ala(2)-MePhe(4)-Gly(5)- Genetic Selection Ligands Naloxone Naltrexone norbinaltorphimine Opioid Receptor Pharmaceutical Preparations Plasma Membrane Receptors, Opioid, mu Tissue, Membrane

Characterization of Opioid Receptor Activation

Cited 6 times

[35 ]GTPγS binding was performed on membranes prepared from stably opioid receptor transfected cells in the presence and absence of the indicated compound for 60 min at 30 °C in the assay bufier (50 mM Tris-HCl, pH 7.4, 3 mM MgCl₂, 0.2 mM EGTA, and 10 mM NaCl) containing 0.05 nM [³⁵S]GTPγS, 2 μg/mL each leupeptin, pepstatin, aprotinin, and bestatin, and 30 μM GDP, as previously described.⁴⁰ After the incubation, the reaction was filtered through glass-fiber filters (Whatman Schleicher & Schuell, Keene, NH) and washed three times with 3 mL of ice-cold bufier (50 mM Tris-HCl, pH 7.4) on a semiautomatic cell harvester. Filters were transferred into vials with 3 mL of Liquiscent (National Diagnostics, Atlanta, GA), and the radioactivity in vials was determined by scintillation spectroscopy in a Tri-Carb 2900TR counter (PerkinElmer Life and Analytical Sciences). Basal binding was determined in the presence of GDP and the absence of drug. Data was normalized to 100 nM DAMGO, DPDPE, and U50,488 for MOR-1, DOR-1, and KOR-1 binding, respectively. EC₅₀ and %E_max values were calculated by nonlinear regression analysis (GraphPad Prism, San Diego, CA).

Váradi A., Marrone G.F., Eans S.O., Ganno M.L., Subrath J.J., Rouzic V.L., Hunkele A., Pasternak G.W., McLaughlin J.P, & Majumdar S. (2015). Synthesis and Characterization of a Dual Kappa-Delta Opioid Receptor Agonist Analgesic Blocking Cocaine Reward Behavior. ACS chemical neuroscience, 6(11), 1813-1824.

Publication 2015

Aprotinin Biological Assay Cells Cold Temperature Diagnosis Egtazic Acid Enkephalin, Ala(2)-MePhe(4)-Gly(5)- Enkephalin, D-Penicillamine (2,5)- leupeptin Magnesium Chloride Opioid Receptor OPRM1 protein, human pepstatin Pharmaceutical Preparations prisma Radioactivity Sodium Chloride Spectrum Analysis Tissue, Membrane Tromethamine ubenimex

Most recents protocols related to «Opioid Receptor»

Pharmacological Modulation of Reward-Induced Analgesia

Each participant performed three testing sessions on separate days. Each session comprised a pharmacological intervention and a wheel of fortune game to assess modulation of reward-induced endogenous pain modulation by the interventions. Participants received in one session levodopa to transiently increase the availability of dopamine, in one session the opioid receptor antagonist naltrexone to block opioid receptors, and in one session a placebo for control. To ensure complete washout of the drugs, the testing sessions were separated by at least 2 days (plasma half-life for levodopa: 1.4 hrs Nyholm et al., 2012 (link); plasma half-life for naltrexone: 8 hrs [Wall et al., 1981 (link)]). After obtaining written consent in the first testing session, participants were familiarized with the thermal stimuli, the rating scale, and the wheel of fortune game to decrease unspecific effects of novelty and saliency. In each testing session, the thresholding and scaling procedures for individual adjustments of the stimulation intensities started approximately 60 min after drug intake and were performed immediately prior to playing the wheel of fortune game.

Desch S., Schweinhardt P., Seymour B., Flor H, & Becker S. (2023). Evidence for dopaminergic involvement in endogenous modulation of pain relief. eLife, 12, e81436.

Full text: Click here

Publication 2023

Cardiac Arrest Dopamine Levodopa Naltrexone Narcotic Antagonists Opioid Receptor Pain Pharmaceutical Preparations Placebos Plasma

Double-blind Crossover Evaluation of Levodopa and Naltrexone

Participants ingested in one testing session levodopa, in another naltrexone, and in another a placebo (microcrystalline cellulose), following a double-blind, cross-over design with counterbalanced order. Levodopa is an amino acid precursor of dopamine leading to a transient systemic increase of dopamine availability. To inhibit peripheral synthesis of dopamine from levodopa, the single dose of 150 mg levodopa (p.o.) was combined with 62.5 mg of a benserazide to prevent peripheral side effects such as nausea (Rinne et al., 1975 (link)). Naltrexone is an opioid receptor antagonist with predominant receptor binding affinity at µ-opioid receptors together with a lower binding affinity at κ-opioid receptors and a much lower affinity at δ-opioid receptors (Raynor et al., 1994 (link)). Participants received a single dose of 50 mg naltrexone (p.o.) that has been shown to induce more than 90% receptor blockade (Weerts et al., 2013 (link)).
After drug intake, a waiting period of one hour started. This waiting time was chosen based on peak plasma concentrations of levodopa and naltrexone at approximately 1 hr to 1.5 hr after ingestion (Nyholm et al., 2012 (link); Wall et al., 1981 (link)). At the end of each testing session, participants indicated whether they thought that they had received the placebo or one of the drugs (response alternatives: ‘placebo’, ‘levodopa’, ‘naltrexone’, or ‘don’t know’) to test for potential unblinding.

Desch S., Schweinhardt P., Seymour B., Flor H, & Becker S. (2023). Evidence for dopaminergic involvement in endogenous modulation of pain relief. eLife, 12, e81436.

Full text: Click here

Publication 2023

Amino Acids Anabolism Benserazide Cardiac Arrest Dopamine Levodopa microcrystalline cellulose Naltrexone Narcotic Antagonists Nausea Opioid Receptor Pharmaceutical Preparations Placebos Plasma Receptors, Opioid, delta Transients

Targeted Immobilization of Membrane Proteins

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023

AC-73 ACE2 protein, human Adrenergic Agonists Adsorption BSG protein, human Cell Membrane Proteins Cholinergic Receptors Chromatography Epidermal Growth Factor Receptor Genetic Heterogeneity Immobilization Membrane Proteins Metoprolol Opioid Receptor Physical Examination Plasma Membrane Rocuronium Bromide Silicon Dioxide sinomenine Terbutaline TEST mixture Tissue, Membrane

Investigating the Mechanisms of iROE Analgesia

The effects of iROE on mechanical hyperalgesia caused by plantar incision were further investigated to ascertain whether they were involved in α₁ and α₂ adrenergic, cholinergic (nicotinic and muscarinic), and opioid receptors. Forty-two rats were randomly allocated to seven groups (n = six rats per group), including one iROE group that served as a control and the other six groups that included rats that were given iROE and study drugs (yohimbine 2 mg/kg, dexmedetomidine 50 μg/kg, prazosin 1 mg/kg, atropine 5 mg/kg, mecamylamine 1 mg/kg, and naloxone 5 mg/kg). Two hours after the plantar incisions, normal saline or study drugs were administered intraperitoneally. After 10 min, 300 mg/kg iROE was administered intraperitoneally. Previous study suggested the application of drugs to investigate the possible involvement of the aforementioned receptor systems [9 (link),15 (link),16 (link),17 (link),18 (link)]. All study drugs were provided by Sigma-Aldrich.

Choi G.J., Kang H., Lee O.H, & Kwon J.W. (2023). Effect of Immature Rubus occidentalis on Postoperative Pain in a Rat Model. Medicina, 59(2), 264.

Full text: Click here

Publication 2023

Adrenergic Agents Atropine Cholinergic Agents Dexmedetomidine Mecamylamine Mechanical Allodynia Muscarinic Agents Naloxone Nicotine Normal Saline Opioid Receptor Pharmaceutical Preparations Prazosin Rattus norvegicus Yohimbine

Cannabinoid and Opioid Receptor Binding Assays

Cannabinoid and opioid competitive radioligand binding assays were performed as previously described [5 (link),36 (link),37 (link),38 (link)]. Saturation experiments were performed for all the receptors to determine receptor concentration and radioligand dissociation constant (K_d) for the membrane. Percent displacements were evaluated for all the cannabinoid and opioid subtypes with a triplicate of a fixed concentration (10 µg/mL for extracts and fractions, 10 μM for purified compounds). The samples competed with a tritium-labeled ligand with a known affinity of the receptor of interest-{[³H]-CP55,940 for CB1R and CB2R, [³H]-U-69,593 for κ, [³H]-DAMGO for μ, or [³H]-enkephalin (DPDPE) for δ}, with the radioligand concentration equal to its K_d. Control/test compounds were dissolved in DMSO at 10 μg/mL for extracts and fractions and 10 μM for purified compounds. Dilutions of the membrane, radioligand, and control/test compounds were made in a Tris-EDTA buffer (50 mM Tris-HCl (pH 7.4), 20 mM EDTA, 154 mM NaCl, and 0.2% fatty-acid free BSA), with pH = 7.4 for cannabinoids and 50 mM Tris-HCl (pH 7.4) for opioids. The competitive binding assays were performed using 12 serial dilutions of each compound ranging from 0.002–300 μM (control compounds were serially diluted from 10 μM to 0.06 nM). The cannabinoid assays were incubated for 90 min at 37 °C with gentle agitation. The opioid assays were incubated for 60 min at room temperature. Bound radioligand was collected on GF/C (cannabinoid) or GF/B plates (opioid), washed 10 times with ice-cold 50 mM Tris-HCl (pH 7.4)/0.1% BSA (cannabinoid) or ice-cold 50 mM Tris-HCl (pH 7.4) (opioid). Radiodetection was measured with 50 µL (cannabinoid) or 25 µL (opioid) MicroScint^TM-20 on a TopCount NXT HTS Microplate Scintillation Counter (PerkinElmer, Waltham, MA, USA). The IC₅₀ and K_i values were calculated by a non-linear curve fit model using GraphPad Prizm 5.0 software (GraphPad Software Inc., San Diego, CA, USA). Each compound was tested in triplicate unless stated otherwise.
Percent displacement [5 (link)] was calculated to represent the ability of the samples to displace the radioligand binding for a given cannabinoid or opioid receptor subtype.
% displacement was calculated as follows:

100 - \frac{binding of compound - nonspecific binding}{specific binding} \times 100

Pandey P., Kumarihamy M., Chaturvedi K., Ibrahim M.A., Lambert J.A., Godfrey M., Doerksen R.J, & Muhammad I. (2023). In Vitro and In Silico Studies of Neolignans from Magnolia grandiflora L. Seeds against Human Cannabinoids and Opioid Receptors. Molecules, 28(3), 1253.

Full text: Click here

Publication 2023

Biological Assay Cannabinoids Cold Temperature Edetic Acid Enkephalin, Ala(2)-MePhe(4)-Gly(5)- Enkephalin, D-Penicillamine (2,5)- Enkephalins Fatty Acids Ligands Opioid Receptor Opioids Radioligand Assay Scintillation Counters Sodium Chloride Sulfoxide, Dimethyl Technique, Dilution Tissue, Membrane Tritium Tromethamine

Top products related to «Opioid Receptor»

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Geneticin by Mirus Bio

Sourced in United States

Geneticin is a broad-spectrum antibiotic used as a selection agent in cell culture. It inhibits protein synthesis in both prokaryotic and eukaryotic cells, making it effective for selecting cells that have been successfully transfected or transformed.

Penicillin streptomycin l glutamine by Thermo Fisher Scientific

Sourced in United States, Canada

Penicillin/streptomycin/L-glutamine is a sterile solution used as a supplement in cell culture media. It provides antimicrobial properties and supports cellular growth and proliferation.

Tri carb 2900tr counter by PerkinElmer

The Tri-Carb 2900TR counter is a liquid scintillation counter designed for the detection and measurement of radioactivity in liquid samples. It features a compact design and advanced electronics to provide reliable and accurate results.

Liquiscint by National Diagnostics

Liquiscint is a laboratory instrument used for liquid scintillation counting. It is designed to measure the radioactivity of samples by detecting the light emissions produced when radioactive particles interact with a scintillation cocktail. The core function of Liquiscint is to accurately quantify the radioactivity levels in liquid samples.

Ls6500 by Beckman Coulter

Sourced in United States, Germany, United Kingdom, Canada, China

The LS6500 is a fully automated, multi-purpose flow cytometer designed for a wide range of applications in clinical diagnostics and research laboratories. It features advanced technology for precise cell analysis and sorting, delivering accurate and reliable results.

Prism 8 by GraphPad

Sourced in United States, Austria, Canada, Belgium, United Kingdom, Germany, China, Japan, Poland, Israel, Switzerland, New Zealand, Australia, Spain, Sweden

Prism 8 is a data analysis and graphing software developed by GraphPad. It is designed for researchers to visualize, analyze, and present scientific data.

Wallac 1450 microbeta by PerkinElmer

Sourced in United States

The Wallac 1450 MicroBeta is a versatile liquid scintillation counter designed for high-throughput radioactivity detection. It offers automated sample handling and provides precise quantification of radioactive samples.

Naloxone by Bio-Techne

Sourced in United States, United Kingdom

Naloxone is a laboratory reagent used for the detection and quantification of opioids in biological samples. It is a synthetic compound that acts as an opioid antagonist, effectively reversing the effects of opioid overdose. Naloxone is commonly used in research and analytical settings to assess the pharmacological properties and physiological responses associated with opioid compounds.

Gf b glass fiber strips by Cytiva

Sourced in United Kingdom

GF/B glass fiber strips are a type of lab equipment used for filtration purposes. They are made of glass fibers and designed to efficiently separate and retain particulates from liquid samples.

What are the different types of opioid receptors?

How can opioid receptor research help in understanding and treating opioid-related disorders?

What are some common challenges in opioid receptor research?

How can PubCompare.ai assist with opioid receptor research?

PubCompare.ai can enhance your opioid receptor research by helping you locate the best protocols from literature, pre-prints, and patents. The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy. This can save you time and improve the quality of your experiments, leading to more reliable and impactful findings.

What are the specific benefits of using PubCompare.ai for opioid receptor research?

By using PubCompare.ai, you can screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform can help you identify the most effective protocols related to opioid receptors for your specific research goals, ensuring that you choose the best option for reproducibility and accuracy. This can ultimately lead to more reliable results and advanc* your understanding of opioid receptor function and its implications for opioid-related disorders.

More about "Opioid Receptor"

Opioid receptors, a class of G protein-coupled receptors, play a crucial role in pain perception, mood regulation, and addiction processes.
These receptors, including mu, delta, and kappa subtypes, bind endogenous and exogenous opioid ligands, each with distinct physiological and pharmacological properties.
Understanding the mechanisms underlying opioid-related disorders is essential for developing effective treatments.
Researchers can leverage PubCompare.ai to enhance their opioid receptor studies.
This AI-driven platform helps locate the best protocols from literature, pre-prints, and patents, optimizing experiments for improved reproducibility and accuracy.
The intelligent comparisons provided by PubCompare.ai can seamlessly integrate with your research workflow, utilizing tools like FBS, Geneticin, Penicillin/streptomycin/L-glutamine, Tri-Carb 2900TR counter, Liquiscint, LS6500, Prism 8, and Wallac 1450 MicroBeta to streamline your opioid receptor experiments.
Furthremore, the use of naloxone, a opioid receptor antagonist, can provide valuable insights into the mechanisms of opioid-related disorders.
By combining the power of PubCompare.ai with a comprehensive understanding of opioid receptor subtypes and their associated pharmacology, researchers can unlock new frontiers in the field of opioid receptor research, paving the way for more effective treatments and interventions.