Total RNA of either three whole embryos or 10 animal caps per sample was extracted using the Absolutely RNA Microprep kit (Stratagene), and cDNA synthesis was carried out using random hexamer priming and the StrataScript Reverse Transcriptase. Quantitative RT–PCR was performed on the Mx3000P (Stratagene) using the Brilliant SYBR Green QPCR Master Mix (Stratagene). Measurements were performed in quadruplicates and normalized to the expression levels of ODC (Ornithine decarboxylase). Fold change values (x) were calculated using the following formula: x=2−ΔΔCt. Bars indicate standard deviations. The primer sequences were: α-Actin, fwd: TCCCTGTACGCTTCTGGTCGTA, rev: TCTCAAAGTCCAAAGCCACATA; Admp, fwd: GATGATGGAAGGAGAGGA, rev: TCATGTTCTGACCCAAAG; Chd, fwd: GTTGTACATTTGGTGGGAA, rev: ACTCAGATAAGAGCGATCA; Gsc, fwd: GCTGAT-TCCACCAGTGCCTCACCAG, rev: GGTCCTGTGCCTCCTCTTCCTCCTG; MyoD, fwd: AGGTCCAACTGCTCCGACGGCATGAA, rev: AGGAGAGAATCCAGTTGATGGAAACA; ODC, fwd: CAGCTAGCTGTGGTGTGG, rev: CAACATGGAAACTCACACC; Otx2, fwd: GGATGGATTTGTTACATCCGTC, rev: CACTCTCCGAGCTCACTTCCC; Rx2a, fwd: AGACTGGTGGCTATGGAG, rev: ATACCTGCACCCTGACTT; Szl, fwd: GTCTTCCTGC-TCCTCTGC, rev: AACAGGGAGCACAGGAAG; Vent1, fwd: TTCCCTTCAGCATGGT-TCAAC, rev: GCATCTCCTTGGCATATTTGG; Wnt8, fwd: TATCTGGAAGTTGCAGCA-TACA, rev: GCAGGCACTCTCGTCCCTCTGT. The PCR cycling conditions for 40 cycles were: denaturation at 95°C for 30 s, annealing at 55°C for 60 s, and extension at 72°C for 30 s.
>
Chemicals & Drugs
>
Amino Acid
>
Ornithine Decarboxylase
Ornithine Decarboxylase
Ornithine Decarboxylase is an enzyme that plays a key role in the synthesis of polyamines, which are essential for cell growth and proliferation.
This enzyme catalyzes the conversion of ornithine to putrescine, the precursor for other polyamines such as spermidine and spermine.
Ornithine Decarboxylase is closely linked to cellular proliferation and differentiation, making it an important target for research in areas such as cancer, immune function, and neurological disorders.
Understanding the regulation and activity of this enzyme can provide valuable insights into a variety of biological processes and disease states.
This enzyme catalyzes the conversion of ornithine to putrescine, the precursor for other polyamines such as spermidine and spermine.
Ornithine Decarboxylase is closely linked to cellular proliferation and differentiation, making it an important target for research in areas such as cancer, immune function, and neurological disorders.
Understanding the regulation and activity of this enzyme can provide valuable insights into a variety of biological processes and disease states.
Most cited protocols related to «Ornithine Decarboxylase»
5-amino-5-deoxymannopyranoside
Actins
ADRB2 protein, human
Anabolism
Animals
brilliant green
DNA, Complementary
Embryo
Oligonucleotide Primers
Ornithine Decarboxylase
Reverse Transcriptase Polymerase Chain Reaction
RNA-Directed DNA Polymerase
Binding Sites
Cloning Vectors
Codon, Terminator
HPSE protein, human
K-ras Genes
Mutagenesis, Site-Directed
Ornithine Decarboxylase
Plasmids
Vertebral Column
The tetracycline regulated bi-directional pBI-G vector (Clontech, Mountain View CA) was modified by removing the lacZ coding region, and replacing it with enhanced cyan fluorescent protein (CFP: subcloned from the pCX-ECFP vector). To shorten the half-live of CFP, and thus allow for a more dynamic read-out of transgene expression, the mouse ornithine decarboxylase PEST sequence was subcloned, in frame, to the 5′ end of CFP. The premiR132 sequence from the pCAG-miR132 vector [10] (link) was subcloned into the multiple cloning site of the pBI-CFP vector to generate the final TET-response element-controlled miR132-CFP vector. Dr. Hai-Ying M. Cheng performed the subcloning procedures: pronuclear injection of FVB/N oocytes with the linearized construct was performed Dr. Xin-An Pu, at the Ohio State University Transgenic Facility. Five lines were generated and analyzed for transgene expression by crossing to the CaMKII tTA driver line [22] . The line with the broadest neuroanatomical expression pattern was retained and backcrossed to the C57BL/6J mouse strain a minimum of 6 times. Of note, at no point were the animals administered with doxycycline. Thus the miR132 transgene was constitutively expressed. Thy-1 GFP mice [23] (link) were generously provided by Gouping Feng (Duke University).
Full text: Click here
Animals
Animals, Transgenic
Calmodulin-Dependent Protein Kinase II
Cloning Vectors
Doxycycline
enhanced cyan fluorescent protein
LacZ Genes
Mice, Inbred C57BL
Mice, Laboratory
Ornithine Decarboxylase
Ovum
Plague
Reading Frames
Response Elements
Strains
Tetracycline
Transgenes
To construct expression plasmids carrying Flag-tagged wild-type luciferase and ELuc, cDNA sequences in which the start codon was replaced by an EcoRV site were amplified by polymerase chain reaction (PCR) using pB1py311[5] (link) and pBlue-ELuc, respectively, as the templates. The amplified products were ligated into the EcoRV/KpnI (for wild-type luciferase) and EcoRV/XhoI (for ELuc) sites of pCMV-Tag2B (Stratagene) downstream of the immediate CMV promoter, which resulted in the pCMV-Flag::PTLuc and pCMV-Flag::ELuc constructs. pSV40-ELuc was generated by replacing the NcoI and XbaI fragment of the FLuc expression vector pGVC2 (Toyo Ink, Tokyo, Japan) with ELuc excised from the pBlue-ELuc plasmid. To generate destabilized luciferases in which the PEST element of the mouse ornithine decarboxylase was fused in-frame to the C-terminus of ELuc (dELuc) and FLuc (dFLuc), the PEST sequence (in which the NcoI site was deleted without changing the deduced amino acid sequence) was PCR-amplified using pd1EGFP-N1 (Clontech, Palo Alto, CA) as a template. To generate pGEM-PEST, the amplified fragment was subcloned into pGEM-TEasy (Promega, Madison, WI). ELuc and FLuc in which the stop codon was replaced by an EcoRV site were PCR-amplified using pBlue-ELuc and the pGVC2 as templates, respectively. The amplified fragments were ligated into the NcoI/EcoRV site of pGEM–PEST. To generate the pSV40–dELuc and pSV40–dFLuc constructs, PEST-fused ELuc (dELuc) and FLuc (dFLuc) were excised using NcoI and XbaI and ligated into the NcoI/XbaI site of pGVC2, in which the FLuc was removed.
To construct reporter vectors carrying the mPer2 promoter, the mPer2 promoter fragment (−279 to +112 bp, where +1 indicates the putative transcription start site) was PCR-amplified from C57BL/6J mouse genomic, and cloned into the NheI/XhoI site of pGL3–Basic (Promega). The FLuc was replaced with the NcoI and XbaI fragments of pSV40–dELuc and pSV40–dFLuc, resulting in mPer2-dELuc and mPer2-dFLuc, respectively.
To generate the cytosol-targeting ELuc expression vector pCMV-Flag::ELuc (cyto), the ELuc cDNA in which the peroxisome-targeting signal (PTS; Ser-Lys-Lue) at the extreme C-terminus was deleted by PCR using pBlue-ELuc as the template, and the product was ligated to the EcoRV/XhoI site of pCMV-Tag2B. To construct the peroxisome-targeting FLuc expression vector pCMV-Flag::FLuc (pox), the FLuc cDNA in which a PTS was introduced at the extreme C-terminus was PCR-amplified using pGVC2 as the template, and the product was ligated to the EcoRV/XhoI site of pCMV-Tag2B. To construct expression plasmids carrying nucleus-targeting ELuc and FLuc, the cDNA sequences in which the PTS of ELuc and the STOP codons of both luciferases were replaced by a NotI site, and were PCR-amplified using pBlue-ELuc and pGVC2 as templates, respectively. To obtain the pCMV-Myc::ELuc (nuc) and pCMV-Myc::FLuc (nuc) constructs, the amplified fragments were ligated into the NocI/NotI site of pCMV/myc/nuc (Invitrogen, Carlsbad, CA) in which a triple nuclear localization signal (NLS) from SV40 large T antigen was introduced downstream of the multiple cloning site, for C-terminal fusion to the luciferases.
For confocal fluorescence imaging analysis, we generated a peroxisome-targeting EGFP in which a PTS was introduced at the extreme C-terminus of EGFP. The EGFP cDNA was PCR-amplified using EGFP-N1 (Clontech) as a template, and the product was cloned into pcDNA3.1/V5-His TOPO (Invitrogen) to yield pCMV- EGFP (pox).
To construct an expression plasmid carrying ELuc::importin α, the ELuc cDNA in which the PTS and the STOP codon were replaced by an EcoRV site was PCR-amplified using pBlue-ELuc as a template, and the product was ligated into the HindIII/EcoRV site of pcDNA3 (Invitrogen). The importin α-coding sequence (mRch1, GeneBank accession number D55720) in which the start codon was replaced by an EcoRV site was PCR-amplified using pGEX-2T-PTAC58 [25] (link) (kind gift from Dr. Y. Yoneda of Osaka University) as a template, and the product was ligated to the EcoRV and XhoI sites downstream of ELuc to yield pCMV-ELuc:: importin α. All constructs were verified by sequencing.
To construct reporter vectors carrying the mPer2 promoter, the mPer2 promoter fragment (−279 to +112 bp, where +1 indicates the putative transcription start site) was PCR-amplified from C57BL/6J mouse genomic, and cloned into the NheI/XhoI site of pGL3–Basic (Promega). The FLuc was replaced with the NcoI and XbaI fragments of pSV40–dELuc and pSV40–dFLuc, resulting in mPer2-dELuc and mPer2-dFLuc, respectively.
To generate the cytosol-targeting ELuc expression vector pCMV-Flag::ELuc (cyto), the ELuc cDNA in which the peroxisome-targeting signal (PTS; Ser-Lys-Lue) at the extreme C-terminus was deleted by PCR using pBlue-ELuc as the template, and the product was ligated to the EcoRV/XhoI site of pCMV-Tag2B. To construct the peroxisome-targeting FLuc expression vector pCMV-Flag::FLuc (pox), the FLuc cDNA in which a PTS was introduced at the extreme C-terminus was PCR-amplified using pGVC2 as the template, and the product was ligated to the EcoRV/XhoI site of pCMV-Tag2B. To construct expression plasmids carrying nucleus-targeting ELuc and FLuc, the cDNA sequences in which the PTS of ELuc and the STOP codons of both luciferases were replaced by a NotI site, and were PCR-amplified using pBlue-ELuc and pGVC2 as templates, respectively. To obtain the pCMV-Myc::ELuc (nuc) and pCMV-Myc::FLuc (nuc) constructs, the amplified fragments were ligated into the NocI/NotI site of pCMV/myc/nuc (Invitrogen, Carlsbad, CA) in which a triple nuclear localization signal (NLS) from SV40 large T antigen was introduced downstream of the multiple cloning site, for C-terminal fusion to the luciferases.
For confocal fluorescence imaging analysis, we generated a peroxisome-targeting EGFP in which a PTS was introduced at the extreme C-terminus of EGFP. The EGFP cDNA was PCR-amplified using EGFP-N1 (Clontech) as a template, and the product was cloned into pcDNA3.1/V5-His TOPO (Invitrogen) to yield pCMV- EGFP (pox).
To construct an expression plasmid carrying ELuc::importin α, the ELuc cDNA in which the PTS and the STOP codon were replaced by an EcoRV site was PCR-amplified using pBlue-ELuc as a template, and the product was ligated into the HindIII/EcoRV site of pcDNA3 (Invitrogen). The importin α-coding sequence (mRch1, GeneBank accession number D55720) in which the start codon was replaced by an EcoRV site was PCR-amplified using pGEX-2T-PTAC58 [25] (link) (kind gift from Dr. Y. Yoneda of Osaka University) as a template, and the product was ligated to the EcoRV and XhoI sites downstream of ELuc to yield pCMV-ELuc:: importin α. All constructs were verified by sequencing.
Full text: Click here
Amino Acid Sequence
Cell Nucleus
Cloning Vectors
Codon, Initiator
Codon, Terminator
Cytosol
DNA, Complementary
Genome
Importins
Large T-Antigen
Luciferases
Mice, Inbred C57BL
Mus
Nuclear Localization Signals
Open Reading Frames
Ornithine Decarboxylase
Paragangliomas 3
Peroxisomal Targeting Signals
Peroxisome
Plague
Plasmids
Polymerase Chain Reaction
Promega
prostaglandin M
Reading Frames
Simian virus 40
Topotecan
Transcription Initiation Site
For the genome data set, we included all of the type strains for Aeromonas with the exception A. cavernicola (50 (link)), as well as all other Aeromonas genomes deposited into public databases as of 17 July 2013. For the type strains, 2 were publically available and 27 were sequenced in-house. For additional strains, 21 were available publically and 6 were sequenced in-house. The bacteria were grown at the optimal growth temperature for the strain in LB broth or on LB agar (1.5%) plates for 16 to 18 h (60 ). For biochemical tests, API 20NE strips (bioMérieux, Marcy l’Etoile, France) were used in accordance with the manufacturer’s instructions. Separate tests for ornithine decarboxylase (ODC) activity and esculin hydrolysis were assessed using ODC broth and bile esculin agar (Sigma-Aldrich, St. Louis, MO). Tests were performed in triplicate.
Aeromonas
Agar
Bacteria
Bile
Esculin
Genome
Hydrolysis
Ornithine Decarboxylase
Strains
Most recents protocols related to «Ornithine Decarboxylase»
A DNA fragment containing SV40 nuclear localization signal (nls) and a protein destabilization PEST signal from mouse ornithine decarboxylase (NP_038642.2; corresponding to aa 423–461) was synthesized (Integrated DNA Technologies, Inc.) and cloned into pAPLO (Poe et al. 2017 (link)). The superfolder GFP (sfGFP) coding sequence was PCR amplified from pIHEU-AV-sfGFP (Sapar et al. 2018 (link)), with syn21 (a translation enhancer), start codon, and SV40 nls in the forward primer, and cloned in-frame before SV40nls and PEST in pAPLO.
Full text: Click here
a protein, mouse
Codon, Initiator
DNA, A-Form
Nuclear Localization Signals
Oligonucleotide Primers
Open Reading Frames
Ornithine Decarboxylase
Plague
Reading Frames
Simian virus 40
The demographic characteristics including age, sex, body mass index (BMI), habits (smoking and alcohol consumption), blood type (ABO and Rh), operative parameters including the type of liver graft resected, graft weight, remnant liver volume, postoperative complications requiring relaparotomy (such as bleeding and biliary peritonitis) and clinical variables including the routine laboratory parameters on preoperative and postoperative days (PODs) 1, 3, 5, 7, 10 and 21 were collected. Specific laboratory values including alfa-fetoprotein (AFP), des carboxy prothrombin (DCP), ornithine decarboxylase (ODC), retinol binding protein 4 (RBP4), and angiotensin converting enzyme isotype II (ACEII) levels were measured in the same time intervals.
All routine laboratory evaluations including liver function tests, complete blood count, and coagulation studies were obtained from the hospital database. The demographic and operative parameters were obtained from the electronic patient registry. Five milliliters of extra blood was drawn from the subjects and transferred to Inonu University Liver Transplant Institute Hepatology Research Laboratories and all the samples were centrifuged at 2000 rpm at 4 °C for 10 min and serum obtained from the blood samples were divided into four aliquots and stored at −80 °C until the experiments were performed. The comparison of these variables was performed according to different study subgroups; (i) the routine and specific laboratory variables were compared according to sex (male versus females); (ii) according to LDH type (right-lobe LDH versus left-lobe LDH (including left-lobe lateral segment)); and (iii) according to the presence or absence of complications requiring relaparotomy.
All routine laboratory evaluations including liver function tests, complete blood count, and coagulation studies were obtained from the hospital database. The demographic and operative parameters were obtained from the electronic patient registry. Five milliliters of extra blood was drawn from the subjects and transferred to Inonu University Liver Transplant Institute Hepatology Research Laboratories and all the samples were centrifuged at 2000 rpm at 4 °C for 10 min and serum obtained from the blood samples were divided into four aliquots and stored at −80 °C until the experiments were performed. The comparison of these variables was performed according to different study subgroups; (i) the routine and specific laboratory variables were compared according to sex (male versus females); (ii) according to LDH type (right-lobe LDH versus left-lobe LDH (including left-lobe lateral segment)); and (iii) according to the presence or absence of complications requiring relaparotomy.
Full text: Click here
alpha-Fetoproteins
Angiotensins
Bile
BLOOD
Complete Blood Count
Females
Grafts
Immunoglobulin Isotypes
Index, Body Mass
Liver
Liver Function Tests
Liver Transplantations
Males
Ornithine Decarboxylase
Patients
Peritonitis
Postoperative Complications
Prothrombin
RBP4 protein, human
Serum
Test, Clinical Enzyme
Tests, Blood Coagulation
The animal trial comprised 20 animals, with 10 animals being vaccinated twice with the recombinant Haemonchus vaccine at the 4-week interval and 10 animals serving as the control and receiving no treatment (Figure 1 B and Table S1 ). The recombinant Haemonchus vaccine consisted of recombinant enolase, arginine kinase, ornithine decarboxylase, malate dehydrogenase, serly tRNA synthetase, macrophage inhibition factor-2, glutamyl tRNA synthetase, aspartyl tRNA synthetase, fatty acid synthetase thioesterase domain, transcriptional co-activator (the histone acetyltransferase-HAT-domain), and vacuolar ATPase, B subunit. All antigens were expressed in a bacterial expression system (data unpublished). The eleven recombinant proteins were combined and dialysed overnight at 4 °C. As described previously [41 (link)], the antigens were formulated in the QuilA and chitin-based slow-release formulation. Each lamb was subcutaneously vaccinated with 75 µg of the vaccine on each vaccination.
Two weeks after the second vaccination, all animals were infected with 5000 L3 H. contortus. Fecal egg counts were monitored twice weekly from day 16 post-infection until the end of the trial. Animals were bled and weighed weekly throughout the course of the trial. One control animal died because of an unrelated cause and was therefore not included in the sample collection or analysis. All 19 animals were killed 8 weeks post challenge, and abomasa were collected for the adult worm counts. Each abomasum was cut open, washed, and had 1/10 worms collected for worm counts. The remaining worms were collected as previously described [9 (link)]. Briefly, the abomasal contents were mixed 2:1 with 3% agar, and the solidified agar blocks incubated at 37 °C in a saline bath. Adult male H. contortus worms were collected from the saline soon after emergence and stored in cryovials in liquid N2 for subsequent DNA and RNA isolation.
Two weeks after the second vaccination, all animals were infected with 5000 L3 H. contortus. Fecal egg counts were monitored twice weekly from day 16 post-infection until the end of the trial. Animals were bled and weighed weekly throughout the course of the trial. One control animal died because of an unrelated cause and was therefore not included in the sample collection or analysis. All 19 animals were killed 8 weeks post challenge, and abomasa were collected for the adult worm counts. Each abomasum was cut open, washed, and had 1/10 worms collected for worm counts. The remaining worms were collected as previously described [9 (link)]. Briefly, the abomasal contents were mixed 2:1 with 3% agar, and the solidified agar blocks incubated at 37 °C in a saline bath. Adult male H. contortus worms were collected from the saline soon after emergence and stored in cryovials in liquid N2 for subsequent DNA and RNA isolation.
Full text: Click here
Abomasum
Acetyltransferase, Histone
Adult
Agar
Amino Acyl-tRNA Synthetases
Animals
Antigens
Arginine Kinase
Aspartate-tRNA Ligase
Bacteria
Bath
Chitin
Enolase
Fatty Acids
Feces
Glutamate-tRNA Ligase
Haemonchus
Helminths
Infection
isolation
Ligase
liposomal amphotericin B
Macrophage Migration Inhibitory Factor
Malate Dehydrogenase
Males
Ornithine Decarboxylase
Protein Subunits
Recombinant Proteins
Saline Solution
Secondary Immunization
Specimen Collection
Sustained-Release Preparations
Transcription, Genetic
Vaccines
Vaccines, Recombinant
Vacuolar H+-ATPase
Currently, phylogenetic tree analysis has become an important strategy for mining new functional enzymes. In order to enrich the ornithine decarboxylase in the putrescine synthesis pathway, we preliminarily screened the ornithine decarboxylase via phylogenetic tree and molecular docking. This method requires a protein sequence with a known function as a probe. Then, the candidate sequences were screened from the huge sequence information by analyzing the affinity of phylogenetic evolution. Finally, the screening range was further narrowed by molecular docking. Li et al., compared seven ODCs from different sources and found that the ODC from Enterobacter cloacae (SpeFECL) had the highest specific ODC activity in C. glutamicum [9 (link)]. Therefore, the amino acid sequence of SpeFECL was chosen as the probe sequence to mine more ODCs from the National Center for Biotechnology Information (NCBI) database. BlastP results with a candidate ODC sequence revealed similarities ranging from 50% to 90%. One ODC with a similarity of more than 90% was also kept. Some repeated or truncated sequences were removed, leaving 8245 candidate sequences for phylogenetic tree construction. A comparison file spec.fasta was generated by sequence matching of ODCs using MAFFT, and the final spec.tree file was generated by the FastTree construction of a maximum-likelihood phylogenetic tree. The crystal structure of Lactobacillus 30a ODC dimer (PDB:1ord) was used as a template by the modeling module function of SWISS-MODEL to obtain the model structure of the candidate sequences, and the pdb file was downloaded. The candidate protein model was docked onto the ornithine molecule with a radius of 12 using the semi-flexible docking software program CDOCKER in Discovery Studio 3.0. The A-chain active sites N153 (N161) and T387 (T395) were chosen, while the B-chain active sites H216 (H224) and Y652 (Y660) were chosen. To assess the reliability of the ligand-protein docking and binding stability, the total energies of the receptor and ligand -CE (-CDOCKER ENERGY) and the receptor–ligand interaction energy -CIE (-CDOCKER INTERACTION ENERGY) were used. The lower the CE value, the less total energy consumed during the docking process and the more stable the docking system. The lower the CIE value, the better the ligand–receptor interaction binding. ODCs with -CE or -CIE significantly higher than that of the probe enzyme were selected from the candidate sequences based on the energy ranking.
Full text: Click here
Amino Acid Sequence
Biological Evolution
Biosynthetic Pathways
Enterobacter cloacae
Enzymes
Lactobacillus
Ligands
ODC1 protein, human
Ornithine
Ornithine Decarboxylase
Proteins
Putrescine
Radius
Trees
Schneider’s insect medium, lipopolysaccharide (LPS), IFN-γ, resazurin sodium salt, the ornithine decarboxylase (ODC) antibody and BHT (butylated hydroxytoluene) were all obtained from SIGMA-Aldrich (St Louis, MO, United States). Lactate Dehydrogenase (LDH) Cytotoxicity Detection Kit and Nutridoma™-SP supplement were obtained from Roche Diagnostics GmbH (Sandhofer Strasse, Mannheim, Germany). Inactive fetal bovine serum (FBS), RPMI 1640 medium and RPMI 1640 medium without phenol red and penicillin were purchased from GIBCO (Carlsbad, CA, United States). Streptomycin, L-glutamine and PBS 10x were obtained from Invitrogen (Carlsbad, CA, United States). The superoxide dismutase activity assay, NS398 COX-2 inhibitor and PGE2 Elisa kits were purchased from Cayman Chemical Company (Ann Arbor, Michigan, United States). The MILLIPLEX® kit based on Luminex® xMAP® technology was obtained from Merck (Darmstadt, Germany). A protease and phosphatase inhibitor cocktail, T-PERTM Tissue Protein Extraction Reagent and SuperSignal™ West Atto Ultimate Sensitivity Substrate Kit were purchased from ThermoFisher Scientific (Waltham, MA United States). Primary β-actin, pERK and ERK antibodies were obtained from Cell Signaling (Danvers, MA, United States), while Cox-2 and iNOS antibodies were purchased from Calbiochem (San Diego, CA, United States). The HO-1 antibody was purchased from Enzo Life Science (Farmingdale, NY, United States). Arginase antibody was obtained from R&D Systems (Minneapolis, MN, United States). Nrf2 antibody was obtained from Abcam (Cambridge, United Kingdom). Propylene glycol was purchased from Rudnik Comércio de Produtos Químicos Ltda. (Cotia, SP, BR). Carbomer 940 (Carbopol®) and sodium metabisulphite were obtained from Henrifarma Produtos Químicos (São Paulo, SP, BR). Potassium sorbate was purchased from Cosmoquímica Indl. E Coml. Ltda. (São Paulo, SP, BR). Disodium EDTA was obtained from Zílquimica Produtos para Laboratórios Ltda. (Ribeirão Preto, SP, BR). Castor oil was purchased from Volp Indústria e Comércio Ltda. (Osasco, SP, BR). Triethanolamine was obtained from Química Moderna Indústria e Comércio Eireli (Barueri, SP, BR).
Full text: Click here
Actins
Aminomethyltransferase
Antibodies
Arginase
Biological Assay
Caimans
carbomer 940
Carbopol
Castor oil
Cyclooxygenase 2 Inhibitors
Cytotoxin
Diagnosis
Dietary Supplements
Dinoprostone
EDTA, Disodium
Endopeptidases
Enzyme-Linked Immunosorbent Assay
Fetal Bovine Serum
Glutamine
Hydroxytoluene, Butylated
Hypersensitivity
Immunoglobulins
Insecta
Interferon Type II
Lactate Dehydrogenase
Lipopolysaccharides
NFE2L2 protein, human
NOS2A protein, human
NS398
Ornithine Decarboxylase
Penicillins
Phosphoric Monoester Hydrolases
Propylene Glycol
PTGS2 protein, human
resazurin
Sodium
Sodium Chloride
sodium metabisulfite
Sorbate, Potassium
Streptomycin
Superoxide Dismutase
Tissues
triethanolamine
Top products related to «Ornithine Decarboxylase»
Sourced in France, United States, United Kingdom, Germany, Japan, Macao, Denmark, Italy
The API 20E is a standardized identification system for Enterobacteriaceae and other non-fastidious Gram-negative rods. It consists of 20 miniaturized biochemical tests, which allow the identification of the most frequently encountered members of the Enterobacteriaceae family as well as certain other Gram-negative bacteria.
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Lithuania, Hong Kong, Argentina, Ireland, Austria, Israel, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Spain, Australia, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, Sweden, Netherlands, Switzerland, Italy, Belgium, Australia, France, India, Ireland
β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is an important component of the microfilament system and is involved in various cellular processes such as cell motility, structure, and integrity.
Sourced in Switzerland, Germany, United States, China, Japan, United Kingdom, France, Belgium, Canada, Australia, Sweden, Austria, Denmark, Italy, Norway, Estonia, Spain, Morocco, New Zealand, Netherlands, Czechia
The LightCycler 480 is a real-time PCR instrument designed for quantitative nucleic acid analysis. It features a 96-well format and uses high-performance optics and detection technology to provide accurate and reliable results. The core function of the LightCycler 480 is to facilitate real-time PCR experiments through thermal cycling, fluorescence detection, and data analysis.
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
Sourced in United States
G418 solution is a lab reagent commonly used in cell culture applications. It is a broad-spectrum antibiotic that inhibits protein synthesis, resulting in the death of cells that do not express a resistance gene. The solution is sterile-filtered and ready to use for selection and maintenance of transformed cells.
Sourced in Germany, United States, United Kingdom, Spain, France, Canada, Poland, Italy, Switzerland, Saudi Arabia
Tryptic soy broth is a general-purpose, nutrient-rich culture medium used for the growth and maintenance of a wide variety of microorganisms, including bacteria, fungi, and yeasts. It provides a balanced source of amino acids, carbohydrates, and other essential nutrients to support microbial growth and proliferation.
Sourced in United States, Germany, Spain, United Kingdom
The mMessage mMachine kit is a laboratory equipment product designed for in vitro transcription and capping of mRNA. The kit provides the necessary reagents and protocols to synthesize capped mRNA from DNA templates.
More about "Ornithine Decarboxylase"
Ornithine decarboxylase (ODC) is a critical enzyme involved in the synthesis of polyamines, which are essential for cell growth and proliferation.
This enzyme catalyzes the conversion of the amino acid ornithine into putrescine, the precursor for other important polyamines like spermidine and spermine.
ODC is closely linked to cellular processes like proliferation and differentiation, making it a key target for research in various fields.
Understanding the regulation and activity of this enzyme can provide valuable insights into a range of biological processes and disease states, including cancer, immune function, and neurological disorders.
ODC is often studied using techniques like API 20E, Lipofectamine 2000, and TRIzol reagent for cell culture and gene expression analysis. β-actin is commonly used as a reference gene, and instruments like the LightCycler 480 and RNeasy Mini Kit are employed for quantitative PCR and RNA extraction, respectively.
G418 solution and Tryptic soy broth may also be utilized in ODC-related experiments.
By exploring the role of ODC and its associated pathways, researchers can gain a deeper understanding of fundamental cellular mechanisms and develop potential therapeutic interventions for conditions where ODC dysregulation is implicated, such as in the MeSsage mMachine kit for in vitro transcription.
This enzyme catalyzes the conversion of the amino acid ornithine into putrescine, the precursor for other important polyamines like spermidine and spermine.
ODC is closely linked to cellular processes like proliferation and differentiation, making it a key target for research in various fields.
Understanding the regulation and activity of this enzyme can provide valuable insights into a range of biological processes and disease states, including cancer, immune function, and neurological disorders.
ODC is often studied using techniques like API 20E, Lipofectamine 2000, and TRIzol reagent for cell culture and gene expression analysis. β-actin is commonly used as a reference gene, and instruments like the LightCycler 480 and RNeasy Mini Kit are employed for quantitative PCR and RNA extraction, respectively.
G418 solution and Tryptic soy broth may also be utilized in ODC-related experiments.
By exploring the role of ODC and its associated pathways, researchers can gain a deeper understanding of fundamental cellular mechanisms and develop potential therapeutic interventions for conditions where ODC dysregulation is implicated, such as in the MeSsage mMachine kit for in vitro transcription.