Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Phosphoric Monoester Hydrolases

Phosphoric Monoester Hydrolases

Phosphoric Monoester Hydrolases are a class of enzymes that catalyze the hydrolysis of phosphoric monoesters.
These enzymes play crucial roles in various biological processes, including cell signaling, metabolic regulation, and phosphate homeostasis.
Explore the world of Phosphoric Monoester Hydrolases with PubCompare.ai's AI-driven comparison platform.
Easily locate the best protocols and products from literature, pre-prints, and patents.
Our intelligenct tools help you optimize your research workflows and make informed decisions.
Discover the power of AI-driven analysis at PubCompare.ai.

Most cited protocols related to «Phosphoric Monoester Hydrolases»

1
Quantitative Proteomics of Yeast Metabolism
We showcased our method using a TMT10-plex of yeast (S. cerevisiae wild-type strain BY4716) grown in synthetic complete media supplemented with 2% glucose (n=5) or 2% pyruvate (n=5) as the carbon source. We harvested the cells at OD600nm=0.8. Cells were lysed by bead-beating in 8 M urea 200mM EPPS (4-(2-Hydroxyethyl)-1-piperazinepropanesulfonic acid), pH 8.5 and with protease and phosphatase inhibitors. Protein concentration was determined with the BCA assay. The BCA assay was performed according to manufacturer’s instructions with samples that were diluted at least 1:20, to ensure that the 8M urea has been diluted far below its compatibility limit. Samples were reduced with 5mM TCEP, alkylated with 10 mM iodoacetamide that was quenched with 10 mM DTT. A total of 100 μg of protein were chloroform-methanol precipitated. Protein was reconstituted in 200 mM EPPS pH 8.5 and digested by Lys-C overnight and trypsin for 6 h, both at a 1:100 protease-to-peptide ratio. Directly to the digest, we added a final volume of 30% acetonitrile and labelled 100 μg of peptide with 200 μg of TMT. To check mixing ratios, 2 μg of each sample were pooled, desalted, and analyzed by mass spectrometry. Using normalization factors calculated from this “label check,” samples were mixed 1:1 across all channels and desalted using a 100 mg Sep-Pak solid phase extraction column. The Pierce High-Select Fe-NTA Phosphopeptide Enrichment Kit was used to enrich phosphopeptides from the pooled TMT-labeled mixture. The unbound fraction and washes from this enrichment were combined and fractionated with basic pH reversed-phase (BPRP) HPLC, collected in a 96-well plate and combined down to 12 fractions prior to desalting and subsequent LC-MS/MS processing (14 (link), 15 ).
Navarrete-Perea J., Yu Q., Gygi S.P, & Paulo J.A. (2018). SL-TMT: A Streamlined Protocol for Quantitative (Phospho)proteome Profiling using TMT-SPS-MS3. Journal of proteome research, 17(6), 2226-2236.
Publication 2018
acetonitrile Acids Biological Assay Carbon Cells Chloroform ferric nitrilotriacetate Glucose High-Performance Liquid Chromatographies inhibitors Iodoacetamide Mass Spectrometry Methanol Peptide Hydrolases Peptides Phosphopeptides Phosphoric Monoester Hydrolases Proteins Pyruvate Saccharomyces cerevisiae Solid Phase Extraction Staphylococcal Protein A Strains Tandem Mass Spectrometry tris(2-carboxyethyl)phosphine Trypsin Urea Yeast, Dried
2
Production and Purification of SARS-CoV Spike Protein

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2020
A-130A Buffers Cells Cloning Vectors Cobalt Freezing Hexosaminidase A His-His-His-His-His-His Histidine Phosphoric Monoester Hydrolases Proteins SARS-CoV-2 SDS-PAGE Severe acute respiratory syndrome-related coronavirus Signal Peptides Sodium Chloride Transfection Tromethamine
3
Labeling and Purification of Oligonucleotide Substrates
Oligonucleotides C80, G80, and G95 were purchased from Integrated DNA Technologies (Coralville, IA) and their sequences, in 5' to 3' orientation, are as follows: C80 = GCTGATCAACCCTACATGTGTAGGTAACCCTAACCCTAACCCTAAGGACAACCCTAGTGAAGCTTGTAACCCTAGGAGCT, G80 = AGCTCCTAGGGTTACAAGCTTCACTAGGGTTGTCCTTAGGGTTAGGGTTAGGGTTACCTACACATGTAGGGTTGATCAGC, G95 = AGCTCCTAGGGTTACAAGCTTCACTAGGGTTGTCCTTAGGGTTAGGGTTAGGGTTACCTACACATGTAGGGTTGATCAGCTACGTCATGCTCAGA, and NC77 = AGCTGAGCATGTCCAGACATGTCCGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTGAG. The C80 oligomer was radiolabeled at its 5' end with 32P-γ-ATP (3000 Ci/mmol) and polynucleotide kinase, 3' phosphatase-free (Roche Biochemicals) and unincorporated nucleotides were removed using standard procedures. For construction of the blunt-ended or 15 nt 3' tail 80 bp substrates, labeled C80 was annealed to a twofold excess of unlabeled G80 or G95, respectively. After separation by non-denaturing polyacrylamide (12%) gel electrophoresis (PAGE), labeled oligomers and annealed duplex substrates were then purified using a gel extraction kit (Qiagen). The concentration of labeled, purified C80 was determined from the amount of unlabeled complementary G80 required to completely convert this oligomer to duplex over a 24 h period; concentrations of duplex substrates were then calculated using the specific activity of the isotope.
Machwe A., Lozada E.M., Xiao L, & Orren D.K. (2006). Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins. BMC Molecular Biology, 7, 1.
Full text: Click here
Publication 2006
Electrophoresis Isotopes Nucleotides Oligonucleotides Phosphoric Monoester Hydrolases polyacrylamide Polynucleotide 5'-Hydroxyl-Kinase Tail
4
Western Blot Quantification of Cellular Signaling Proteins
The MCF-7 cell line was maintained under standard conditions in Dulbecco's modified Eagle's medium supplemented with 10% foetal bovine serum. Cells were washed with ice cold phosphate buffered Saline and lysed in RIPA buffer (1% NP-40, 0.1% SDS, 0.5% Sodium deoxycholate, 50 mM Tris pH 7.5, 150 mM NaCl) supplemented with protease and phosphatase inhibitor cocktails (Sigma Aldrich) and protein concentration was quantitated by BCA protein assay (Invitrogen). Purified BSA (Applichem) was dissolved in RIPA buffer. Cell lysates and a BSA sample were serially diluted 1∶2 and run on SDS-PAGE using a standard protocol. Proteins were transferred to the PVDF (for ECL based detection) or Nitrocellulose (for LI-COR based proteins detection) membranes. Membranes were blocked with blocking solution (11500694001, Roche) for BSA detection or 5% skimmed milk for rest of the membranes. For Western blotting ERK (M-5670, Sigma Aldrich), mTOR (2972, Cell Signaling Technology), RSK1 (sc-231, Santa Cruz) and BSA (sc-50528, Santa Cruz) antibodies were used. Anti-rabbit HRP-conjugated (Cell Signaling Technology) or anti-Rabbit IR 800 (LI-COR) secondary antibodies were used for ECL or LI-COR protein detection systems, respectively. Signal was detected by standard X-ray films (Fuji), CCD camera (Advanced Molecular Vision) or LI-COR scanner.
Degasperi A., Birtwistle M.R., Volinsky N., Rauch J., Kolch W, & Kholodenko B.N. (2014). Evaluating Strategies to Normalise Biological Replicates of Western Blot Data. PLoS ONE, 9(1), e87293.
Full text: Click here
Publication 2014
Antibodies Biological Assay Buffers Cells Cold Temperature Deoxycholic Acid, Monosodium Salt Fetal Bovine Serum FRAP1 protein, human MCF-7 Cells Milk, Cow's Nitrocellulose Nonidet P-40 Peptide Hydrolases Phosphates Phosphoric Monoester Hydrolases polyvinylidene fluoride Proteins Rabbits Radioimmunoprecipitation Assay RPS6KA1 protein, human Saline Solution SDS-PAGE Sodium Chloride Tissue, Membrane Tromethamine Vision X-Ray Film
5
CRISPR-Cas9 Gene Editing in Fungi
Plasmids for CaCas9 Duet and Solo systems are listed in the Supplementary Materials. The CaCas9 DNA was synthesized by BioBasic, with codons optimized for expression in both C. albicans and Saccharomyces cerevisiae. All key components were verified by sequencing and restriction analysis, and vector sequences will be provided upon request. Solo and/or Duet vectors (5 to 10 μg) were linearized by digesting with Kpn1 and Sac1 before transformation for efficient targeting to the ENO1 and/or the RP10 locus. Purified repair templates (3 μg) were transformed along with the guide expression plasmids for the Solo or Duet systems. Repair templates were generated with 60-bp oligonucleotide primers containing 20-bp overlap at their 3′ ends centered on the desired mutation point. Primers were extended by thermocycling with ExTaq. Most guides were either immediately adjacent to or within 15 bp of the desired mutagenesis point. Phosphorylated and annealed guide sequence–containing primers were ligated into CIP (calf intestinal phosphatase)–treated BsmBI-digested parent vectors as depicted in Fig. 1C. Correct clones were identified by sequencing.
Vyas V.K., Barrasa M.I, & Fink G.R. (2015). A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances, 1(3), e1500248.
Publication 2015
Candida albicans Clone Cells Cloning Vectors Codon Intestines Mutagenesis Oligonucleotide Primers Parent Phosphoric Monoester Hydrolases Plasmids Point Mutation Retinitis Pigmentosa 10 Saccharomyces cerevisiae

Most recents protocols related to «Phosphoric Monoester Hydrolases»

1
Quantitative BTK Phosphorylation Inhibition Assay
Not available on PMC !

Example 156

Human heparinized venous blood was purchased from Bioreclamation, Inc. or SeraCare Life Sciences and shipped overnight. Whole blood was aliquoted into 96-well plate and “spiked” with serial dilutions of test compound in DMSO or with DMSO without drug. The final concentration of DMSO in all wells was 0.1%. The plate was incubated at 37° C. for 30 min. Lysis buffer containing protease and phosphatase inhibitors was added to the drug-containing samples and one of the DMSO-only samples (+PPi, high control), while lysis buffer containing protease inhibitors was added to the other DMSO-only samples (−PPi, low control). All of the lysed whole blood samples were subjected to the total BTK capture and phosphotyrosine detection method described in US20160311802, incorporated herein by reference. ECL values were graphed in Prism and a best-fit curve with restrictions on the maximum and minimum defined by the +PPi high and −PPi low controls was used to estimate the test compound concentration that results in 50% inhibition of ECL signal by interpolation.

Table 2 shows the activity of selected compounds of this invention in the pBTK assay, wherein each compound number corresponds to the compound numbering set forth in Examples 1-154 described herein. “†” represents an IC50 of equal to or less than 10,000 nM but greater than 500 nM, “††” represents an IC50 of equal to or less than 500 nM but greater than 100 nM; and “†††” represents an IC50 of equal to or less than 100 nM.

TABLE 2
IC50 (nM)Compound No.
†††2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14a, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24a, 25, 26a, 26b, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36a, 37, 39, 40, 41, 42a,
44, 56, 58, 60, 62, 63, 64, 65, 67, 68, 71, 72, 73, 75, 76, 77, 78, 79, 80, 81,
82, 83, 84, 86, 87, 88, 89a, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
104, 105, 106, 107, 110, 111, 112, 113, 114, 119a, 120, 121, 122, 123, 124,
125, 126, 152,
††38, 42b, 45, 46, 47, 48, 49, 51, 52, 53, 57, 59, 61, 66, 69, 70, 74, 102, 103,
115, 117, 118a, 118b, 127, 128, 129, 130, 131, 132
†14b, 24b, 36b, 43, 50, 85, 89b, 108, 109, 116, 133, 134, 135, 136, 137, 138,
139, 140, 141, 153,

US11858926B2. Inhibiting agents for bruton's tyrosine kinase (2024-01-02). BIOGEN MA INC. [US]. Inventors: Brian T. Hopkins [US], Bin Ma [US], Robin Prince [US], Isaac Marx [US], Joseph P. Lyssikatos [US], Fengmei Zheng [US], Matthew Peterson [US], Daniel B. Patience [US].
Full text: Click here
Patent 2024
Biological Assay BLOOD Buffers Homo sapiens inhibitors Peptide Hydrolases Pharmaceutical Preparations Phosphoric Monoester Hydrolases Phosphotyrosine prisma Protease Inhibitors Psychological Inhibition Sulfoxide, Dimethyl Technique, Dilution Veins
2
EV Protein Isolation and Western Blot
Total protein was isolated from EVs using Pierce RIPA lysis buffer with Halt protease and phosphatase inhibitor cocktail (Thermo Fisher, Waltham, MA), and protein concentration was determined using the Pierce BCA protein assay kit (Thermo Fisher). For Western blotting, samples were prepared in Laemmli buffer, boiled at 95 °C for 5 min, and 5 μg protein was loaded. Proteins were separated by SDS-PAGE using 4–15% TGX Gels (Criterion, Bio-Rad, Hercules, CA) by running at 200 V at room temperature. Proteins were transferred for 60 min at 100 V on ice onto a nitrocellulose membrane in 20% methanol Tris-glycine buffer. The Revert Total Protein Stain Kit (Li-Cor Biosciences, Lincoln, NE) or Ponceau S solution (Thermo Fisher) was used to stain total protein, and the membranes were imaged to verify transfer efficiency and loading. The membranes were subsequently blocked in 5% nonfat dry milk in Tris-buffered saline-Tween (TBS-T, 0.1% Tween-20) for 1 h at room temperature, then incubated overnight at 4 °C in primary antibody (anti-CD63, EXOAB-CD63A-1; System Biosciences, Palo Alto, CA and anti-Apolipoprotein A1 (ApoA1, 701239; Thermo Fisher) at a 1:1000 dilution in 5% nonfat dry milk in TBS-T. The membranes were then washed before incubation in goat anti-rabbit secondary antibodies (EXOAB-CD63A-1; System Biosciences) (1:10,000 dilution) for 1 h at room temperature. Blots were developed with enhanced chemiluminescence (Clarity Western ECL Substrate, Bio-Rad), imaged, and quantified with ImageJ (National Institutes of Health).
Ismaeel A., Van Pelt D.W., Hettinger Z.R., Fu X., Richards C.I., Butterfield T.A., Petrocelli J.J., Vechetti I.J., Confides A.L., Drummond M.J, & Dupont-Versteegden E.E. (2023). Extracellular vesicle distribution and localization in skeletal muscle at rest and following disuse atrophy. Skeletal Muscle, 13, 6.
Full text: Click here
Publication 2023
Anti-Antibodies APOA1 protein, human Biological Assay Buffers Chemiluminescence Gels Glycine Goat Immunoglobulins Laemmli buffer Methanol Milk, Cow's Nitrocellulose Peptide Hydrolases Phosphoric Monoester Hydrolases ponceau S Proteins Rabbits Radioimmunoprecipitation Assay Saline Solution SDS-PAGE Stains Technique, Dilution Tissue, Membrane Tween 20 Tweens
3
Molecular Profiling of Liver and Hippocampus in Experimental Model
At 6 months, 4–5 animals of each group were sacrificed by cervical dislocation and the liver and hippocampus were dissected and kept at − 80 °C until use. To perform hippocampi and liver extractions, tissues were homogenized in lysis buffer (Tris HCl 1 M pH 7.4, NaCl 5 M, EDTA 0.5 M pH 8, Triton, distilled H20) containing protease and phosphatase inhibitor cocktails (Complete Mini, EDTA-free; Protease Inhibitor cocktail tablets). Total protein concentration was determined using the Pierce™ BCA Protein Assay Kit (Thermo ScientificTM). Samples containing 10 µg of protein were analyzed by Western Blot as previously described [41 (link)]. Measurements were expressed in arbitrary units and all results were normalized with the corresponding loading control (Glyceraldehyde-3-phosphate dehydrogenase; GAPDH). The used antibodies are detailed in Table 1.

Primary and secondary antibodies for Western Blotting

ProteinAntibody
ADAM10ab124695 (abcam)
AppSIG-39152 (Convance)
App C terminal fragmentSIG-39152 (Convance)
DBN1ABN 207 (Merck Millipore)
GAPDHMAB374 (Merck Millipore)
GSK3β#9315 (Cell Signaling Technology)
P-GSK3β (TYR216)ab75745 (abcam)
IDEab32216 (abcam)
IRS24502S (Cell Signaling)
Neurexinab34245 (abcam)
PTP1BGTX55767 (Genetex)
sAPPβSIG-39138-0 (Covance)
SynaptophisinM0776 (Dako)
TauGTX112981 (Genetex)
P-Tau(ser396)44752G (Invitrogen)
P-Tau(ser404)44-758G(Invitrogen)
TLR4Sc-293072 (Santa Cruz Biotechnology)
Β-actinA5441 (Sigma)
2nd-ary Goat anti-Rabbit31460 (Invitrogen)
2nd-ary Goat anti-Mouse31430 (Invitrogen)
Espinosa-Jiménez T., Cano A., Sánchez-López E., Olloquequi J., Folch J., Bulló M., Verdaguer E., Auladell C., Pont C., Muñoz-Torrero D., Parcerisas A., Camins A, & Ettcheto M. (2023). A novel rhein-huprine hybrid ameliorates disease-modifying properties in preclinical mice model of Alzheimer’s disease exacerbated with high fat diet. Cell & Bioscience, 13, 52.
Full text: Click here
Publication 2023
Animals Antibodies Biological Assay Buffers Edetic Acid GAPDH protein, human Glyceraldehyde-3-Phosphate Dehydrogenases Goat GSK3B protein, human Joint Dislocations Liver Neck Peptide Hydrolases Phosphoric Monoester Hydrolases Protease Inhibitors Proteins Seahorses Sodium Chloride Tissues Tromethamine Western Blotting
4
Pancreatic Cancer Cell Culture Protocols
Pancreatic cancer cell lines (AsPC-1 and BxPC-3) were cultured in RPMI-1640 (Corning, NY, USA) with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin. Two additional pancreatic cancer cell lines (PANC-1, MIA Paca-2) were cultured in DMEM (Dulbecco’ modified eagle medium) (Gibco, Grand Island, NY, USA) supplemented with 10% FBS and 1% penicillin–streptomycin. Human pancreatic ductal epithelium (hTERT-HPNE) cells were cultured in Medium D with mixtures of M3 and DMEM medium containing one volume of medium M3TM Base F culture media (InCell Corp., San Antonio, TX, USA), three volumes of glucose-free DMEM, 5% FBS, 5.5 mM glucose, 10 ng/ml EGF, and 50 µg/ml gentamycin [26 (link)]. All these cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2. RNA was extracted from tissues using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed into cDNA using the PrimeScript RT Master Mix (Takara, Otsu, Shiga, Japan). RT-qPCR analyses were quantified with PowerUp™ SYBR® Green Master Mix (Applied Biosystems, Austin, TX, USA), and expression levels were normalized to GAPDH levels. Proteins were extracted in RIPA buffer supplemented with a complete, EDTA-free protease and phosphatase inhibitor single-use cocktail (Thermo Scientific). Proteins were separated by SDS-PAGE and blotted onto a PVDF membrane. Anti-TSC22D2 (1:1000 dilution, #25,418–1-AP, Proteintech) was used as primary antibodies for immunoblotting. Reacted antibodies were detected using an enhanced chemiluminescence detection system.
Liu Q., Li R., Wu H, & Liang Z. (2023). A novel cuproptosis-related gene model predicts outcomes and treatment responses in pancreatic adenocarcinoma. BMC Cancer, 23, 226.
Full text: Click here
Publication 2023
Antibodies Atmosphere austin Buffers Cell Lines Cells Chemiluminescence Culture Media DNA, Complementary Eagle Edetic Acid Epithelium Fetal Bovine Serum GAPDH protein, human Gentamicin Glucose Homo sapiens Pancreatic Cancer Pancreatic Duct Penicillins Peptide Hydrolases Phosphoric Monoester Hydrolases polyvinylidene fluoride Proteins Radioimmunoprecipitation Assay SDS-PAGE Streptomycin SYBR Green I Technique, Dilution Tissue, Membrane Tissues trizol
5
Recombinant Protein Analysis by Mass Spectrometry
Purified recombinant proteins were lyophilized and re-dissolved in 150 mM aqueous ammonium acetate (pH 7.5) with ultrafiltration by a 10 kDa cut-off filter (Sartorius Stedim Biotech, Germany). Some aliquots of samples were treated with 0.02 U of neuraminidase (Roche, IN, United States), either by itself or in combination with phosphatase (Sigma), and incubated at room temperature overnight. Samples were analyzed on a modified Exactive Plus Orbitrap instrument with ultra-high mass range, as described (Čaval et al., 2018 (link)). Briefly, spray voltage was set to 1.2–1.3 V, source fragmentation and collision energy were set in the range of 15%–25% to achieve optimal desolvation. The resolution was set to 25,000 at m/z 200.
Chen Y.H., Tian W., Yasuda M., Ye Z., Song M., Mandel U., Kristensen C., Povolo L., Marques A.R., Čaval T., Heck A.J., Sampaio J.L., Johannes L., Tsukimura T., Desnick R., Vakhrushev S.Y., Yang Z, & Clausen H. (2023). A universal GlycoDesign for lysosomal replacement enzymes to improve circulation time and biodistribution. Frontiers in Bioengineering and Biotechnology, 11, 1128371.
Full text: Click here
Publication 2023
ammonium acetate M-200 Neuraminidase Phosphoric Monoester Hydrolases Recombinant Proteins Ultrafiltration

Top products related to «Phosphoric Monoester Hydrolases»

1
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
2
Pierce bca protein assay kit by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, Australia, Switzerland, France, Canada, Spain, Italy, Japan, Belgium, Sweden, Lithuania, Austria, Denmark, Poland, Ireland, Portugal, Finland, Czechia, Norway, Macao, India, Singapore
The Pierce BCA Protein Assay Kit is a colorimetric-based method for the quantification of total protein in a sample. It utilizes the bicinchoninic acid (BCA) reaction, where proteins reduce Cu2+ to Cu+ in an alkaline environment, and the resulting purple-colored reaction is measured spectrophotometrically.
3
Bca protein assay kit by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Japan, Belgium, France, Switzerland, Italy, Canada, Australia, Sweden, Spain, Israel, Lithuania, Netherlands, Denmark, Finland, India, Singapore
The BCA Protein Assay Kit is a colorimetric detection and quantification method for total protein concentration. It utilizes bicinchoninic acid (BCA) for the colorimetric detection and quantification of total protein. The assay is based on the reduction of Cu2+ to Cu1+ by protein in an alkaline medium, with the chelation of BCA with the Cu1+ ion resulting in a purple-colored reaction product that exhibits a strong absorbance at 562 nm, which is proportional to the amount of protein present in the sample.
4
Protease inhibitor cocktail by Roche
Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel
Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.
5
Ripa buffer by Merck Group
Sourced in United States, Germany, United Kingdom, Switzerland, Italy, Sao Tome and Principe, China, Canada, Macao, France, Japan, Spain, Ireland, Australia, Sweden, Belgium, Denmark, Morocco, Austria, Poland
RIPA buffer is a widely used lysis buffer for extracting proteins from cells and tissues. It is a detergent-based buffer that helps solubilize proteins, disrupt cell membranes, and maintain the integrity of protein structures during the extraction process. The buffer contains a combination of ionic and non-ionic detergents, as well as other components that help stabilize and preserve the extracted proteins.
6
Protease inhibitor cocktail by Merck Group
Sourced in United States, Germany, China, United Kingdom, Italy, Japan, Sao Tome and Principe, France, Canada, Macao, Switzerland, Spain, Australia, Israel, Hungary, Ireland, Denmark, Brazil, Poland, India, Mexico, Senegal, Netherlands, Singapore
The Protease Inhibitor Cocktail is a laboratory product designed to inhibit the activity of proteases, which are enzymes that can degrade proteins. It is a combination of various chemical compounds that work to prevent the breakdown of proteins in biological samples, allowing for more accurate analysis and preservation of protein integrity.
7
Protease and phosphatase inhibitor by Roche
Sourced in United States, Switzerland, Germany, China, United Kingdom, Canada, France, Japan, Belgium, Spain, Australia
Protease and phosphatase inhibitors are a class of lab equipment used to prevent the degradation of proteins and protein modifications during sample preparation and analysis. They work by inhibiting the activity of enzymes that can cleave or alter proteins, helping to preserve the integrity of the samples for further study.
8
Ripa buffer by Thermo Fisher Scientific
Sourced in United States, Germany, China, Switzerland, Japan, United Kingdom, Italy, Australia, Sweden, Belgium, Canada, Denmark, France, Sao Tome and Principe, Macao, Austria, Morocco, Norway, Israel
RIPA buffer is a commonly used lysis buffer for the extraction and solubilization of proteins from cells and tissues. It contains a mixture of ionic and non-ionic detergents that help disrupt cell membranes and release cellular contents, including proteins. The buffer also includes salts and buffers to maintain the pH and ionic strength of the solution.
9
Phosphatase inhibitor cocktail by Merck Group
Sourced in United States, Germany, Switzerland, China, Japan, Italy, Canada, Macao, Denmark, Hungary, India, Sao Tome and Principe, Spain, Ireland, United Kingdom
The Phosphatase inhibitor cocktail is a laboratory product designed to inhibit the activity of phosphatase enzymes. Phosphatases play a crucial role in various cellular processes, and their inhibition can be valuable in biological research and analysis.
10
Halt protease and phosphatase inhibitor cocktail by Thermo Fisher Scientific
Sourced in United States, Germany, China, Australia, France, United Kingdom, Canada
Halt Protease and Phosphatase Inhibitor Cocktail is a ready-to-use solution designed to inhibit a broad spectrum of proteases and phosphatases during protein extraction and purification. It is formulated to prevent degradation of proteins by proteolytic enzymes and dephosphorylation by phosphatases.

More about "Phosphoric Monoester Hydrolases"

Phosphoric Monoester Hydrolases, also known as phosphatases, are a diverse group of enzymes that catalyze the hydrolysis of phosphoric monoesters.
These crucial enzymes play pivotal roles in numerous biological processes, including cell signaling, metabolic regulation, and phosphate homeostasis.
Closely related to phosphatases are the Protein Tyrosine Phosphatases (PTPs), which specifically dephosphorylate tyrosine residues on proteins.
PTPs work in tandem with Protein Tyrosine Kinases (PTKs) to regulate signal transduction pathways, cell growth, and differentiation.
Researchers studying phosphatases often utilize a variety of essential laboratory tools and reagents, such as PVDF membranes for Western blotting, the Pierce BCA Protein Assay Kit for quantifying protein concentrations, and protease and phosphatase inhibitor cocktails to preserve enzymatic activity during sample preparation.
RIPA buffer is a commonly used lysis buffer that help extract cellular proteins, including phosphatases, for downstream analysis.
Discover the power of AI-driven analysis at PubComparte.ai to optimise your phosphatase research workflows and make informed decisions.
Our intelligent tools can help you easily locate the best protocols and products from literature, pre-prints, and patents, empowering you to explore the fascinating world of Phosphoric Monoester Hydrolases.