> Chemicals & Drugs > Amino Acid > Pronase

Pronase

Q: What are some common challenges in using Pronase for research?

One of the key challenges in using Pronase is ensuring reproducibility and accuracy of the experimental results. Researchers may struggle to find the most effective protocols from the vast literature, preprints, and patents available, which can impact the reliability of their Pronase-based experiments.

Q: What are some specific applications of Pronase in research?

Pronase is widely used in a variety of research applications, including tissue dissociation, cell culture preparation, and the study of protein structure and function. It can also be employed in the analysis of peptides and proteins, as well as in the preparation of samples for downstream experiements, such as mass spectormetry or chromatography.

Pronase, a versatile enzyme mixture derived from the bacterium Streptomyces griseus, is widely used in biochemical and molecular biology research.
This enzyme cocktail exhibits broad proteolytic activity, capable of hydrolyzing a wide range of peptide bonds in various proteins and peptides.
Pronase is commonly employed for tissue dissociation, cell culture applications, and the preparation of samples for analysis, such as in the study of protein structure and function.
Researchers can leverage PubComapre.ai's cutting-edge technology to enhance the reproducibility and accuracy of their Pronase-based experiments, locating the best protocols from literature, preprints, and patents using AI-driven comparisons.
This tool optimizes the Pronase experetnce, empowering scientists to conduct more reliable and efficient research.

Most cited protocols related to «Pronase»

Cell Isolation of Transgenic Worms

Day 1 adult neuronally GFP-labeled worms (Punc119::GFP or Pmec-4::GFP) were prepared for cell isolation as previously described^{15 (link)} with modifications (Extended Data Fig. 2). Synchronized adult worms were washed with M9 buffer to remove excess bacteria. The pellet (~250 µl) was washed with 500 µl lysis buffer (200 mM DTT, 0.25% SDS, 20 mM Hepes pH 8.0, 3% sucrose) and resuspended in 1000 µl lysis buffer. Worms were incubated in lysis buffer with gentle rocking for 6.5 minutes at room temperature. The pellet was washed 6× with M9 and resuspended in 20 mg/ml pronase from Streptomyces griseus (Sigma-Aldrich). Worms were incubated at room temperature (<20 minutes) with periodic mechanical disruption by pipetting every 2 min. When most worm bodies were dissociated, leaving only small debris and eggs, ice-cold PBS buffer containing 2% fetal bovine serum (Gibco) was added. RNA from FACS-sorted neurons was prepared for RNA-seq and subsequent analysis (see Extended Data for details).

Kaletsky R., Lakhina V., Arey R., Williams A., Landis J., Ashraf J, & Murphy C.T. (2015). The C. elegans adult neuronal IIS/FOXO transcriptome reveals adult phenotype regulators. Nature, 529(7584), 92-96.

Publication 2015

Adult Bacteria Buffers Cell Separation Cold Temperature Eggs Fetal Bovine Serum Helminths HEPES Human Body Neurons Pronase RNA-Seq Streptomyces griseus Sucrose

Virus-Cell Fusion Kinetics Quantification

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2009

Cells Cold Temperature Fluorescence Fusions, Cell HIV-1 inhibitors Peptides Place Cells Pronase Virus

Proteome Analysis of Kaempferol Treatment

Cell lysates were obtained from 3T3-L1 or HepG2 cells. Cells were scraped and lysed with M-PER lysis buffer. After centrifugation for 15 min at 16,000×g, the supernatant was obtained, and protein content was quantified using Bradford reagent. Before drug treatment, the samples were diluted to achieve a protein concentration of 1 mg/mL. Samples were treated with the Kaem or DMSO for 2 h at 25 °C and then incubated with pronase (5, 10, and 20 µg/mL) or distilled water for 10 min at 25 °C. After the reaction, SDS was added to the sample and the samples were heated at 100 °C. A portion of each sample was used for LC–MS/MS analysis. Sample preparation and proteome analysis were conducted as indicated in the previous publication⁶⁹. For western blot analysis, VDAC1 or Na⁺K⁺ ATPase was used as an internal control. For the structure–activity-relationship (SAR) analysis, kaempferol (Sigma-Aldrich, 60010), Acacetin (Sigma-Aldrich, 00017), isosakuranetin (Sigma-Aldrich, PHL82569), Biochanin A (Sigma-Aldrich, D2016), (−)Epicatechin (Sigma-Aldrich, E4018), Genistein (Sigma-Aldrich, G6649) were used.

Kim D., Hwang H.Y., Ji E.S., Kim J.Y., Yoo J.S, & Kwon H.J. (2021). Activation of mitochondrial TUFM ameliorates metabolic dysregulation through coordinating autophagy induction. Communications Biology, 4, 1.

Full text: Click here

Publication 2021

3T3-L1 Cells acacetin ATP8A2 protein, human biochanin A Buffers Cells Centrifugation Epicatechin Genistein Hep G2 Cells isosakuranetin kaempferol Na(+)-K(+)-Exchanging ATPase Pharmaceutical Preparations Pronase Proteins Proteome Sulfoxide, Dimethyl Tandem Mass Spectrometry VDAC1 protein, human Western Blot

Automated Zebrafish Photomotor Response Assay

Adult wild-type zebrafish (Tropical 5D) were raised in the Sinnhuber Aquatic Research Laboratory at Oregon State University, Corvallis, Oregon. Groups of 1000 adult zebrafish were housed in 100 gallon tanks kept at standard laboratory conditions of 28 °C on a 14-h light/10-h dark photoperiod in fish water (reverse osmosis water supplemented with Instant Ocean™, a commercially available salt). Zebrafish were spawned, and embryos were collected and staged according to Kimmel et al. (Kimmel et al. 1995 (link)). At 4 hpf, embryos were dechorionated using pronase (63.6 mg/ml, >3.5 U/mg, Sigma-Aldrich: P5147) by a custom automated dechorionator (Mandrell et al. 2012 (link)).
Using the automated embryo placement systems (AEPS) previously described (Mandrell et al. 2012 (link)), 6 hpf dechorionated embryos were individually placed into a 96-well plate (1 embryo per well) prefilled with 90 μL of EM. Ten microliters of chemical from dilution plate 2 was added to each row of two 96-well plates. A final DMSO concentration was maintained throughout the experiment of 0.64 % (v/v). For each concentration, a total of 32 embryos were exposed. All exposure plates were sealed using parafilm to prevent evaporation and wrapped in aluminum foil to prevent light exposure. During this development period, zebrafish embryos are able to adapt to the dark and develop normally (Kokel et al. 2013 (link)). Exposed plates were stored in 28 °C incubator, and embryos were statically exposed until 120 hpf (5 dpf). At 24 hpf, embryos were assessed for PMR (as described below) and evaluated for mortality (MO24 = mortality at 24 hpf) (Truong et al. 2011 (link)). At 5 dpf, embryos were assessed for 17 morphological endpoints and collected in Zebrafish Acquisition and Analysis Program (ZAAP) (Truong et al. 2014 (link)).
Embryos were assessed for PMR using the custom-built Photomotor Response Analysis Tool (PRAT). The system uses a Prosilica GX3300 (Allied Vision, Stadtroda, Germany) with near infrared (NIR) band-pass filter to remove any influence of stimulus light. The lens is double telecentric (Navitar, Rochester, New York), mounted in an inverted manner beneath the plate holder to allow for imaging with minimum distortion and perspective interference. Imaging illumination is accomplished with a NIR (850 nm) Back-light (Smart Vision Lights, Muskegon, MI). PMR stimulus light is from two white L300 Linear Lights (Smart Vision Lights, Muskegon, MI). The system is controlled by custom hardware for timing the high-intensity light stimuli and system backlight. Video recording began immediately prior to light cycle initiation and captures 850 frames of digital video, recorded at 17 frames s-1. The light cycle consists of 30 s (sec) of background (prior to the first light pulse), a short pulse of light, 9 s before the next pulse, a second pulse of light, and then 10 s of dark.
To analyze the videos, a custom MATLAB program (Mathworks, Natick, MA) was used to compute a movement index for each frame stamp (the pixel differences between frames). The program output was processed using custom R scripts (R Core Team 2014 ) to discard the lag time that occurs between when the video recording was initiated and the light cycle begins/ends. A time stamp was created from the frame stamp by taking the first stamp after the recording started, setting that as 0 s, and then taking the floor of the sequential frame stamps.

Reif D.M., Truong L., Mandrell D., Marvel S., Zhang G, & Tanguay R.L. (2015). High-throughput characterization of chemical-associated embryonic behavioral changes predicts teratogenic outcomes. Archives of Toxicology, 90, 1459-1470.

Publication 2015

Adult Aluminum Embryo Fingers Fishes Lens, Crystalline Light Lighting Movement Osmosis Pronase Pulse Rate Reading Frames Sodium Chloride Sulfoxide, Dimethyl Technique, Dilution Vision Zebrafish

Single-cell Isolation of Mouse Tracheal Cells

HBECs were harvested at 15d ALI using 0.05% Trypsin-EDTA (ThermoFisher, 25300054). Cells were then pelleted at 300g for 5 min, resuspended in PBS and filtered through a 20 μm strainer (PluriSelect, 43–50020–03). Cells were counted on a hemocytometer and Optiprep (Sigma-Aldrich, D1556) was added to achieve a final concentration of 15% and 75,000 cells/mL.
C57/BL6 mice from the Jackson Laboratory aged 6–8 wk were used for all studies. Animals were handled in accordance with Novartis Institutes for Biomedical Research Animal Care and Use Committee protocols and regulations. Mice were housed in a temperature- and humidity-controlled animal facility with ad libitum access to food and water and acclimated for at least 3 d before experimental manipulation. For single-cell isolation for scRNA-seq, tracheas were dissected and opened longitudinally in Ham’s F12 (Life Technologies, 11765–054) plus 1% Pen-Strep on ice. Each trachea was individually placed in a 15 mL conical tube with 5 mL of 1.5 mg/mL Pronase (Roche, 10165921001) in Ham’s F12 plus 1% Pen-Strep and incubated for 18h at 4°C. 500 mL FBS was added to inactivate pronase and conical tubes were vigorously inverted to dislodge cells. Each trachea was transferred twice to a 15 mL conical tube containing Ham’s F12 plus 1% Pen-Strep plus 10% FBS and then inverted. Media from each of the three tubes was pooled and cells were pelleted at 400g for 10 min at 4°C. Cells were resuspended in 500 µL DNase (Sigma-Aldrich, DN25), incubated on ice for 5 min and then pelleted at 400g for 10 min at 4°C. Cells were then washed twice in Hams F12 1% Pen-Strep 10% FBS and then resuspended in PBS + 0.02% BSA. Cells were diluted to 90,000 cells/mL in 15% Optiprep + 0.02% BSA in PBS for scRNA-seq.

Plasschaert L.W., Žilionis R., Choo-Wing R., Savova V., Knehr J., Roma G., Klein A.M, & Jaffe A.B. (2018). A single cell atlas of the tracheal epithelium reveals the CFTR-rich pulmonary ionocyte. Nature, 560(7718), 377-381.

Publication 2018

Animals ATF7IP protein, human Cells Cell Separation Deoxyribonucleases Edetic Acid Food Humidity Mice, Laboratory Mus Pronase Single-Cell RNA-Seq Strains Streptococcal Infections Trachea Trypsin

Most recents protocols related to «Pronase»

Investigating Virus Infectivity's Role in Plaque Size

Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5

PCR primer sequences.

Gene TargetPrimer Sequence

DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA

TGCC (SEQ ID NO: 24)

Reverse: GAGACAGCAGGATCTCTGGTCTY

TC (SEQ ID NO: 25)

GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT

(SEQ ID NO: 26)

Reverse: TTGATTTTGGAGGGATCTCG

(SEQ ID NO: 27)

CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC

(SEQ ID NO: 28)

Reverse: GTCCATCCTTGGAAGCACTGCA

(SEQ ID NO: 29)

ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT

(SEQ ID NO: 30)

Reverse: ATCTTCCACCGAGCTGTGTCCA

(SEQ ID NO: 31)

IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG

(SEQ ID NO: 32)

Reverse: CATTTTAGTTGCCGTAGG

(SEQ ID NO: 33)

IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA

(SEQ ID NO: 34)

Reverse: AAGACCTTCTGGGTCATCACG

(SEQ ID NO: 35)

IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG

(SEQ ID NO: 36)

Reverse: ACGTCCTCCAGGATTATCTCCA

(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].

Full text: Click here

Patent 2024

Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication

Purification and Characterization of Heparan Sulfate

1 g (wet weight) C57/Bl6 embryonic day 18 mouse embryos or D. melanogaster 1^st–3^rd instar embryos were homogenized and digested overnight in 320 mM NaCl and 100 mM sodium acetate (pH 5.5) containing 1 mg/mL pronase at 40°C. The digested samples were diluted 1:3 in water and 2.5-mL aliquots were applied to DEAE Sephacel columns. HS was eluted and applied to PD-10 (Sephadex G25) columns (GE Healthcare), lyophilized, redissolved in 20 μL water, digested with chondroitinase ABC overnight as indicated, and again purified by DEAE chromatography. Samples were diluted and again applied to PD-10 columns prior to lyophilization. β-elimination of peptides was omitted from this purification protocol to allow for HS coupling to NHS-activated Sepharose via the attached peptides. We confirmed efficient HS coupling to NHS-activated Hi-Trap FPLC columns by using soluble alkaline phosphatase-coupled Fgf8 and VEGF as previously described (Farshi et al., 2011 (link)). HS binding of Shh/Hh was then determined by FPLC (Äkta protein purifier). Samples were applied to the columns in the absence of salt, and bound material was eluted with a linear 0–1 M NaCl gradient in 0.1 M phosphate buffer (pH 7.0). Eluted fractions were quantified as described above. Shh and Hh binding to heparin columns (GE Healthcare) was carried out with the same protocol, except for elution in a linear 0–1.5 M NaCl gradient in 0.1 M sodium phosphate buffer (pH 7.0).

Manikowski D., Steffes G., Froese J., Exner S., Ehring K., Gude F., Di Iorio D., Wegner S.V, & Grobe K. (2023). Drosophila hedgehog signaling range and robustness depend on direct and sustained heparan sulfate interactions. Frontiers in Molecular Biosciences, 10, 1130064.

Full text: Click here

Publication 2023

2-diethylaminoethanol Alkaline Phosphatase Buffers Chondroitin ABC Lyase Chromatography Drosophila melanogaster Embryo FGF8 protein, human Freeze Drying Heparin Mice, House Peptides Phosphates Pronase Proteins sephadex Sepharose Sodium Acetate Sodium Chloride sodium phosphate Vascular Endothelial Growth Factors

Derivation of Human Embryonic Stem Cells

Zona pellucidae from blastocysts were removed with 0.5% pronase (Sigma P8811) and embryos were plated onto confluent feeder layers of mouse embryonic fibroblasts (mEF) and cultured for 6 days at 37 °C, 3% CO₂, 5% O₂ and 92% N₂ in ESC derivation medium. The medium consisted of DMEM/F12 (Gibco 11320-033) with 0.1 mM nonessential amino acids (Gibco 11140-050), 1mM L-glutamine (Gibco 21051-024), 0.1 mM β-mercaptoethanol (Sigma M6250), 5 ng/ml basic fibroblast growth factor (bFGF, Sigma F-0291), 10 µM ROCK inhibitor (Sigma SCM075), 10% fetal bovine serum (FBS, Hyclone Thermo Scientific SH30071.03) and 10% knockout serum replacement (KSR, Gibco 10828-028). ESC colonies were manually dissociated and replated onto fresh mEFs for further propagation and analyses. FBS and ROCK inhibitor were omitted after the first passage of ESCs and KSR was increased to 20%. All ESC lines have been authenticated by short tandem repeat (STR) genotyping, confirming their origin from the gamete donors from this study. ESC lines are available to researchers upon OHSU IRB approval and signed OHSU MTA.

Liang D., Mikhalchenko A., Ma H., Marti Gutierrez N., Chen T., Lee Y., Park S.W., Tippner-Hedges R., Koski A., Darby H., Li Y., Van Dyken C., Zhao H., Wu K., Zhang J., Hou Z., So S., Han J., Park J., Kim C.J., Zong K., Gong J., Yuan Y., Gu Y., Shen Y., Olson S.B., Yang H., Battaglia D., O’Leary T., Krieg S.A., Lee D.M., Wu D.H., Duell P.B., Kaul S., Kim J.S., Heitner S.B., Kang E., Chen Z.J., Amato P, & Mitalipov S. (2023). Limitations of gene editing assessments in human preimplantation embryos. Nature Communications, 14, 1219.

Full text: Click here

Publication 2023

2-Mercaptoethanol Amino Acids Blastocyst Donors Embryo Enhanced S-Cone Syndrome Feeder Cell Layers Fibroblast Growth Factor 2 Fibroblasts Gametes Glutamine Herpes Zoster Mus Pronase Serum Short Tandem Repeat

Yeast Cell Cycle Arrest and DNA Extraction

A 50mL yeast culture in YPD was grown to OD600 of 0.6 and then arrested in G1-phase by addition of alpha factor (50 ng/mL) for 2h. As indicated, cells were treated with auxin at a concentration of 1mM for 30 min at 30°C to degrade AID-tagged Ask1or with nocodazole at a concentration of 15 μg/mL together with 1%DMSO for 2h at 30°C to destabilize microtubules. To release the cells from the arrest, 125U of Pronase (Sigma- Aldrich, 53702-25KU) and potassium phosphate buffer to a final concentration of 20mM was added. If necessary, 200mM HU was added in the release to induce S phase checkpoint activation. Samples for genomic DNA extraction were taken before the release and every 8min after releasing the cells from the arrest by adding 4.5mL of the culture to 500μL of 1% sodium azide solution (w/v) in 0.2M EDTA. The cells were washed once with water (4.000g, 3 min at 4°C) and the resulting yeast pellets were snapfrozen in liquid nitrogen.
For DNA extraction, the cell pellets were resuspended in buffer RINB (50mM Tris-HCl pH8, 0.1M EDTA, 0.1% (v/v) beta mercaptoethanol). Zymolyase was added to a final concentration of 2% (w/v). After incubating for 1h at 37°C, the solution was supplemented with 1% SDS (w/v), 0.2M NaCl, 0.1 mg/mL RNAse A, and 0.2 mg/mL proteinase K. After incubation for 1h at 55°C, DNA was isolated by phenol-chloroform extraction followed by ethanol precipitation. DNA pellets were suspended in 50μL of H₂O. 5–10μg of DNA was then digested with EcoRI. The reactions were diluted 1:10 in H₂O and analyzed by quantitative PCR using primers 0463/0466 (ARS305), 0552/0553 (ARS313), 0970/0971 (ARS315), 0837/0838 (ARS316), and 0834/0835 (ChrVI).

Weiβ M., Chanou A., Schauer T., Tvardovskiy A., Meiser S., König A.C., Schmidt T., Kruse E., Ummethum H., Trauner M., Werner M., Lalonde M., Hauck S.M., Scialdone A, & Hamperl S. (2023). Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control. Cell Reports, 42(2), 112045.

Full text: Click here

Publication 2023

2-Mercaptoethanol Auxins Buffers Cells Chloroform Deoxyribonuclease EcoRI Edetic Acid Endopeptidase K Endoribonucleases Ethanol G1 Phase Genome Microtubules Nitrogen Nocodazole Oligonucleotide Primers Pellets, Drug Phenol potassium phosphate Pronase Sodium Azide Sodium Chloride S Phase Cell Cycle Checkpoints Sulfoxide, Dimethyl Tromethamine Yeast, Dried zymolyase

Isolation of GFP-Positive Cells from Zebrafish Embryos

Embryos from required stock were grown up to the desired stage (from 14 to 72 hpf) in standard embryo media at 29 °C. To prevent melanisation in embryo melanocytes, PTU (N-Phenylthiourea, Sigma-Aldrich, Cat. No. P7629) was added at a final concentration of 0.003% at 24 hpf. To stimulate eGFP expression, embryos were heat-shocked by placing them in 42 °C embryo media followed by 1 h incubation at 37 °C and at least 1 h incubation at 29 °C. If required, the embryos were dechorionated using pronase (Pronase from Streptomyces griseus, Sigma-Aldrich, Cat. No. 000000010165921001) at a final concentration of 1 mg/ml⁸⁰. The heads were cut from all the embryos at stage 30 hpf or older to decrease the number of sox10-positive cells of craniofacial skeletal and otic fates. Embryos were then digested as previously described with small modifications^{81 (link)}. In brief, embryos were rinsed with Ca-, Mg- DPBS (Sigma-Aldrich, D8537), placed in a flask containing TrypLE™ Express Enzyme (ThermoFisher Scientific, Cat. No. 12605036) in ratio of 10 ml per 100 embryos, containing 0.003% Tricaine (Sigma-Aldrich, Cat. No. E10521); incubated for 30–90 min at 100 rpm, 37 °C in the shaker incubator with constant monitoring until the embryos were digested to a mixture of single cells and small fragments of tissue; then digestion mixture was triturated 10–15 times, using a Pasteur pipette; passed through 100-micron strainer (MACS SmartStrainers, Miltenyi Biotech., Cat. No. 130-098-463,) into 50 ml Falcon tube and centrifuged for 5 min, 500 x g, 4 °C. The cell pellet was re-suspended in DPBS and the cell suspension was passed through 30-micron strainer (MACS SmartStrainers, Miltenyi Biotech. Cat. No. 130-110-915) into 50 ml Falcon tube and centrifuged again for 5 min, 500 x g, 4 °C following by re-suspending the cells in 0.5–1 ml cell isolation media (2% FCS, DPBS:HBSS = 1:1 and 1 mM SYTOX Blue Dead Cell stain (ThermoFisher Scientific, S34857)). Cells were imaged before FACS and after FACS to confirm successful purification of GFP+cells.

Subkhankulova T., Camargo Sosa K., Uroshlev L.A., Nikaido M., Shriever N., Kasianov A.S., Yang X., Rodrigues F.S., Carney T.J., Bavister G., Schwetlick H., Dawes J.H., Rocco A., Makeev V.J, & Kelsh R.N. (2023). Zebrafish pigment cells develop directly from persistent highly multipotent progenitors. Nature Communications, 14, 1258.

Full text: Click here

Publication 2023

Cells Cell Separation Digestion Ear Embryo Enzymes Head Hemoglobin, Sickle Melanocyte Phenylthiourea Pronase Skeleton SOX10 Transcription Factor Stains Streptomyces griseus Tissues tricaine

Top products related to «Pronase»

Pronase by Merck Group

Sourced in United States, Germany, France, Sao Tome and Principe, Japan, Canada, Switzerland, Italy

Pronase is a proteolytic enzyme complex derived from the bacterium Streptomyces griseus. It is a non-specific enzyme that hydrolyzes and degrades a wide range of protein substrates.

Pronase by Roche

Sourced in United States, Germany, Switzerland, United Kingdom

Pronase is a broad-spectrum proteolytic enzyme derived from the bacterium Streptomyces griseus. It is commonly used in laboratory settings to digest and break down proteins in various applications.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Protease type xiv by Merck Group

Sourced in United States, Germany, Switzerland, United Kingdom, Belgium

Protease type XIV is an enzyme used in laboratory settings. It is a non-specific protease that can cleave peptide bonds in a variety of proteins. The core function of Protease type XIV is to facilitate the breakdown and analysis of protein samples.

Protease xiv by Merck Group

Sourced in United States, United Kingdom, Germany

Protease XIV is a laboratory reagent manufactured by Merck Group. It is a proteolytic enzyme that can be used for the digestion and breakdown of protein samples during various biological and biochemical analyses. The core function of Protease XIV is to catalyze the hydrolysis of peptide bonds in proteins.

Collagenase type 2 by Worthington

Sourced in United States, United Kingdom, Jersey, Germany, Japan, Switzerland, Canada, Australia, France

Collagenase type II is an enzyme used in cell and tissue culture applications. It is responsible for the breakdown of collagen, a structural protein found in the extracellular matrix. This enzyme is commonly used to facilitate the dissociation of cells from tissues during cell isolation and harvesting procedures.

Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica

DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

Collagenase p by Roche

Sourced in Germany, Switzerland, United States, Japan, Sweden, France, China, United Kingdom, Spain

Collagenase P is a laboratory reagent used for the enzymatic digestion of collagen, a structural protein found in the extracellular matrix of various tissues. It is commonly used in cell isolation and tissue dissociation protocols.

Collagenase by Merck Group

Sourced in United States, Germany, United Kingdom, Italy, Japan, France, Macao, Switzerland, China, Canada, Australia, Spain, Austria, Sao Tome and Principe, Israel, Belgium, Sweden, Ireland, Jersey, India

Collagenase is an enzyme that breaks down collagen, the primary structural protein found in the extracellular matrix of various tissues. It is commonly used in cell isolation and tissue dissociation procedures.

Streptomycin by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama

Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.

What is Pronase and how is it used in research?

Pronase is a versatile enzyme mixture derived from the bacterium Streptomyces griseus. It exhibits broad proteolytic activity, capable of hydrolyzing a wide range of peptide bonds in various proteins and peptides. Pronase is commonly employed for tissue dissociation, cell culture applications, and the preparation of samples for analysis, such as in the study of protein structure and function.

What are some common challenges in using Pronase for research?

How can PubCompare.ai help with Pronase research?

PubCompare.ai allows researchers to screen protocol literature more efficiently and leverage AI to pinpont critical insights. The platform's AI-driven analysis can help researchers identify the most effective protocols related to Pronase for their specific research goals, highlighting key differences in protocol effectiveness and enabling them to choose the best option for reproducibility and accuracy.

Are there different variations or types of Pronase available?

Yes, there are several variations of Pronase available, each with slightly different properties and applications. Researchers may need to expeiment with different Pronase types to find the optimal one for their specific research needs. PubCompare.ai can assist in comparing the effectiveness of different Pronase variations to help researchers make an informed decision.

What are some specific applications of Pronase in research?

More about "Pronase"

Pronase, a versatile enzyme mixture derived from the bacterium Streptomyces griseus, is a powerful tool in biochemical and molecular biology research.
This proteolytic enzyme cocktail exhibits broad activity, capable of hydrolyzing a wide range of peptide bonds in various proteins and peptides.
Researchers commonly employ Pronase for tissue dissociation, cell culture applications, and sample preparation, such as in the study of protein structure and function.
Pronase is often used in conjunction with other enzymes like Protease type XIV, Collagenase type II, and Collagenase P to achieve desired tissue and cell dissociation.
The addition of FBS (Fetal Bovine Serum) and DMEM (Dulbecco's Modified Eagle Medium) can also be beneficial in cell culture applications involving Pronase.
Leveraging PubComapre.ai's cutting-edge technology, scientists can enhance the reproducibility and accuracy of their Pronase-based experiments by locating the best protocols from literature, preprints, and patents using AI-driven comparisons.
This tool optimizes the Pronase experetnce, empowering researchers to conduct more reliable and efficient investigations.