> Chemicals & Drugs > Amino Acid > Protein-Serine-Threonine Kinases

Protein-Serine-Threonine Kinases

Protein-Serine-Threonine Kinases are a class of enzymes that play a critical role in cellular signaling pathways.
They catalyze the phosphorylation of serine and threonine residues in target proteins, regulating a wide range of biological processes such as cell growth, differentiation, metabolism, and apoptosis.
These kinases are involved in diverse physiological and pathological conditions, making them an important focus of biomedical research.
Discover the most reproducible and acccurate protocols for studying Protein-Serine-Threonine Kinases with PubCompare.ai's AI-driven platform, which leverages literature, preprints, and patents to optimize your experimental approches and enhance your research outcomes.

Most cited protocols related to «Protein-Serine-Threonine Kinases»

Affinity Purification-Mass Spectrometry of Bait Proteins

Cited 15 times

The analytical pipeline is illustrated using two biological replicates of each of the following four baits. RAF1 is a serine/threonine kinase that binds to Ras, several chaperones, and 14-3-3 proteins^{47 (link), 48 (link)}. EIF4A2 is a translation initiation factor that is part of the EIF4F complex, which bridges the mRNA cap structure to the ribosome via the EIF3 complex^{49 (link)}. WASL (also known as N-WASP) belongs to the Wiskott-Aldrich syndrome (WAS) family of proteins, involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton^{50 (link)}. Finally, MEPCE, the 7SK snRNA methylphosphate capping enzyme, interacts with numerous transcriptional and RNA processing proteins^{51 (link)}.
Cloning and expression of eIF4A2, RAF1 and MEPCE has been previously described^{15 (link)}. WASL and ORC2L were amplified by PCR from Mammalian Gene Collection constructs BC052955 and BC014834 respectively, and cloned into pcDNA5-FRT-FLAG (using EcoRI/NotI for WASL, and AscI/NotI for ORC2L), and the junctions sequenced. Primers used were: WASL_5′EcoRI, GATCGAATTCATGAGCTCCGTCCAGCAGC; WASL_3′NotI, GATCGCGGCCGCTCAGTCTTCCCACTCATCATCATC; ORC2L_5′AscI, GATCGGCGCGCCAATGAGTAAACCAGAATTAAAGGAAGAC; ORC2L_3′NotI, GATCGCGGCCGCTCAAGCCTCCTCTTCTTCC. The resulting vectors were stably co-transfected with the Flp-recombinase expressing vector pOG44 into Flp-In T-REx 293 cells (Invitrogen). Selection of stable transformants (single clones), clonal expansion, induction of protein expression and AP-MS were performed essentially as described in^{15 (link)}, using FLAG M2 agarose beads (Sigma). Two biological replicate analyses of each bait were performed, alongside six negative controls (cells expressing the tag alone). All samples were analyzed on an LTQ mass spectrometer coupled to an online C18 reversed phase column. The detailed protocol is #48 in the CRAPome. The mass spectrometry data was searched using the X! Tandem/TPP/ABACUS pipeline and settings as described in Global analysis and reduced gene counts. The filtered ABACUS file was formatted for CRAPome as described in Data formats using an in-house tool. Data were uploaded to the CRAPome (workflow 3). Two sets of additional controls (Set 1 and Set 2, see main text for detail) were selected and used alongside the user controls. SAINT and FC scores were generated using different settings (see main text and below). The ORC2L bait was processed in a similar way and uploaded for analysis to the CRAPome separately (it was not used for comparison between SAINT and FC scores shown in Fig. 3). The resulting input data matrices for eIF4A2, RAF1, MEPCE, and WASL baits and the six user controls, as well as for ORC2L and the same user controls, can be downloaded from the CRAPome website.

Mellacheruvu D., Wright Z., Couzens A.L., Lambert J.P., St-Denis N., Li T., Miteva Y.V., Hauri S., Sardiu M.E., Low T.Y., Halim V.A., Bagshaw R.D., Hubner N.C., al-Hakim A., Bouchard A., Faubert D., Fermin D., Dunham W.H., Goudreault M., Lin Z.Y., Badillo B.G., Pawson T., Durocher D., Coulombe B., Aebersold R., Superti-Furga G., Colinge J., Heck A.J., Choi H., Gstaiger M., Mohammed S., Cristea I.M., Bennett K.L., Washburn M.P., Raught B., Ewing R.M., Gingras A.C, & Nesvizhskii A.I. (2013). The CRAPome: a Contaminant Repository for Affinity Purification Mass Spectrometry Data. Nature methods, 10(8), 730-736.

Publication 2013

14-3-3 Proteins Actins Biopharmaceuticals Cells Clone Cells Cloning Vectors Deoxyribonuclease EcoRI DNA Replication Enzymes Eukaryotic Initiation Factor-3 Eukaryotic Initiation Factor-4F FLP recombinase Genes Mammals Mass Spectrometry methylphosphate Molecular Chaperones Oligonucleotide Primers ORC2L protein, human Peptide Initiation Factors Protein-Serine-Threonine Kinases Proteins Raf1 protein, human Receptors, Cell Surface Ribosomes RNA, Messenger Sepharose Signal Transduction Small Nuclear RNA T-Lymphocyte Transcription, Genetic WAS protein, human Wiskott-Aldrich Syndrome Protein Family

Identification of MAPK and MAPKK Genes in Brachypodium distachyon

Cited 11 times

The B. distachyon genome assembly version 1.2 was downloaded from the website ftp://ftp.brachypodium.org/to construct a local protein database. Method used to identify the MAPK and MAPKK genes in B. distachyon was similar to that described in rice and poplar [19] (link). For the MAPKK gene family, the predicted proteins derived from B. distachyon pseudo-molecules were queried using a profile Hidden Markov Model-based search (HMMER: http://hmmer.wustl.edu/) with an HMM built from the ten Arabidopsis MAPKKs [32] (link). MAPKK gene models were only accepted if they displayed the consensus sequences for dual-specificity protein kinases, including the conserved aspartate and lysine residues within the active site motif (–D(L/I/V)K-), and the plant-specific phosphorylation target site motif (–S/TxxxxxS/T-) within the activation loop. Similarly, the predicted B. distachyon proteins were queried using a profile Hidden Markov Model-based search with an HMM built from the twenty Arabidopsis MAPKs for the MAPK gene family. MAPK gene models were only accepted if they contained the canonical consensus sequences for serine/threonine protein kinases, as well as an appropriately positioned activation loop (-TXY-motif). And then the predictions of MAPK and MAPKK coding sequences were verified with available EST. Finally, multiple alignments of the identified B. distachyon amino acid sequences of these two gene families with that of Arabidopsis and rice were performed by Clustal W [33] (link) with default options and the phylogenetic trees were constructed based on the bootstrap neighbor-joining (NJ) method with a Kimura two-parameter model by MEGA [34] (link).

Chen L., Hu W., Tan S., Wang M., Ma Z., Zhou S., Deng X., Zhang Y., Huang C., Yang G, & He G. (2012). Genome-Wide Identification and Analysis of MAPK and MAPKK Gene Families in Brachypodium distachyon. PLoS ONE, 7(10), e46744.

Full text: Click here

Publication 2012

Amino Acids Arabidopsis Aspartate Brachypodium Consensus Sequence Exons Genes Genome Lysine Mitogen-Activated Protein Kinase Kinases Oryza sativa Phosphorylation Plants Populus Protein-Serine-Threonine Kinases Protein Kinases Proteins Sequence Alignment

Affinity Purification-Mass Spectrometry of Bait Proteins

Cited 9 times

Publication 2013

Identification and Characterization of MAPK Genes in Plants

Cited 8 times

Mitogen activated protein kinase (MAPK) gene families from the model plant Arabidopsis thaliana were downloaded from The Arabidopsis Information Resources (TAIR: http://www.arabidopsis.org/) database [88 (link)]. The MAPK gene families from rice were downloaded from the TIGR rice Genome Annotation Resources (http://rice.plantbiology.msu.edu/) database [89 (link)]. The protein sequences of MAPKs from Arabidopsis thaliana and rice were used as search queries in the publicly available phytozome database (http://www.phytozome.net/) to identify MAPK genes in other plant species [90 (link)]. Overall, 40 species were included in this study and reported in Table 1. To identify MAPK gene families of unknown species, BLASTP searches was conducted using orthologous protein sequences Arabidopsis thaliana and Oryza sativa MAPK genes as the query search [91 (link)]. The genes identified through BLAST searches were used for further analysis. First, the top 100 genes were kept for systemic evaluation and indexing. The genes with serine/threonine protein kinase domains and the activation loop T-E-Y or T-D-Y motifs were considered as probable MAPK genes, which were subsequently confirmed by scanning in scan prosite and smart software for the presence of MAPK domain [92 (link),93 (link)]. All datas were checked for redundancy and no any alternative splice variants were considered. Identified MAPK gene families from each species were again confirmed by running BLASTP searches against TAIR using the default parameters [92 (link),93 (link)]. The genes were considered MAPK genes when BLASTP search matches with Arabidopsis MAPKs.

Mohanta T.K., Arora P.K., Mohanta N., Parida P, & Bae H. (2015). Identification of new members of the MAPK gene family in plants shows diverse conserved domains and novel activation loop variants. BMC Genomics, 16(1), 58.

Full text: Click here

Publication 2015

Amino Acid Sequence Arabidopsis Arabidopsis thalianas Genes Genes, Plant Genome Mitogen-Activated Protein Kinases Oryza sativa Protein-Serine-Threonine Kinases Radionuclide Imaging

Quantitative RT-PCR Validation of Transcriptomic Data

Cited 6 times

Total RNA was isolated from leave and stem of plants subjected to the various treatments described above. Contaminating DNA was removed by treating with RNase-free DNase I and the first cDNA strand was synthesized from 1 μg total RNA using PrimeScript® Reverse Transcriptase (Takara, Dalian, China) and an oligo (dT) primer, according to the manufacturer’s instructions. qPCRs were performed in an Eppendorf Real Time PCR System (Mastercycler®ep realplex, Germany) using a SYBR Premix Ex Taq™ Kit (Takara), according to the manufacturer’s protocol. Gene-specific primers were designed using Primer5 software (sequences given in Table 7). Each 20 μL qPCR contained 5 μL diluted cDNA, 100 nM of each primer, and 10 μl SYBR Green PCR master mix, and was exposed to an initial denaturation (95°C/2 min), followed by 40 cycles of 95°C/15 s, 60°C/15 s, 72°C/15 s. After amplication, all results were screened to verify a single peak melting curve for the specificity of the amplifications. Three biological replicates were performed for each sample. Relative transcript abundance was obtained by including the C. nankingense EF1α gene as the reference, and was based on the 2^-ΔΔCT method [73 (link)].Table 7

Primers of quantitative reverse transcription-polymerase chain reaction for validation of RNA-Seq data

GeneID	Primer F (5′-3′)	Primer R (5′-3′)	Blast nr
CL695.Contig1_S2_3	GTGACGAGTTGGTGATGGTG	GTTACCACCTACGAAGGCCA	WRKY transcription factor 4
Unigene75748_S2_1	CGGGTGAAATGCTCTCAAAT	TGCCAAATGGTTCTAAAGGG	WRKY transcription factor 1
Unigene83309_S2_1	ATTTAAACACGCGGATCGAC	CCAGAGTGTGGCTTGGTACA	DREBa
Unigene73473_S2_1	TAAAGGTGGGCCAGAAAATG	ATCATACGCCAGAGCAGCTT	DREB2 transcription factor
Unigene27271_S2_3	ACAACATCCCCTTGGATGAA	GGGTGACAGCATTTGAAGGT	AP2 transcription factor
Unigene93511_S2_3	TGTGCCGCTGTTATCCATTA	CCACACTATCACAGCCCCTT	Ethylene-responsive transcription factor
Unigene37079_S2_1	TCTTCTTTCCCTTTCTGCGA	TGGATCTCCCTCATGACTCC	bHLH128-like
Unigene56969_S2_3	GCATTTGCAGCTGATTCTGA	GCTATCACCGTTGACCCACT	DOF domain class transcription factor
Unigene13900_S2_3	ATCGTGTCGCCGGTATTTAG	GTTGTAGACAAAGCGTCGCA	LEA protein 1
CL2985.Contig1_S2_1	CATCCCCATATTGGTTCCAG	GAACACGAAGCAAGAGGGTC	dehydrin
CL4257.Contig4_S2_1	CTTCTTGCACACTGGTCGAA	GGGGCTTGCTAGGGATAAAG	DEAD-box ATP-dependent RNA helicase 56-like
Unigene6176_S2_3	TGTTTGGCTTGTCAAACTGG	TCCGTGTTATTCCTTTTGCC	DEAD-box ATP-dependent RNA helicase 32-like
Unigene84542_S2_3	CCAGGTTTCGTTTTCGTCAT	GCCTTGAATGCTTTCCACAT	Gibberellin-regulated protein
Unigene85549_S2_3	ACCTCTGTCGGTCCATCAAC	TCGGAACGAGCTCATCTTTT	jasmonate ZIM-domain protein 2
Unigene48078_S2_3	TTTCAGCCGATGGTGATGTA	GTCGTGCCCCACAAGATACT	Serine/threonine-protein kinase

Ren L., Sun J., Chen S., Gao J., Dong B., Liu Y., Xia X., Wang Y., Liao Y., Teng N., Fang W., Guan Z., Chen F, & Jiang J. (2014). A transcriptomic analysis of Chrysanthemum nankingense provides insights into the basis of low temperature tolerance. BMC Genomics, 15(1), 844.

Full text: Click here

Publication 2014

ATP-Dependent DNA Helicases Biopharmaceuticals Deoxyribonuclease I DNA, Complementary Endoribonucleases Genes Oligonucleotide Primers Oligonucleotides Protein-Serine-Threonine Kinases Reverse Transcriptase Polymerase Chain Reaction RNA-Directed DNA Polymerase RNA-Seq Stem, Plant SYBR Green I Transcription, Genetic

Most recents protocols related to «Protein-Serine-Threonine Kinases»

Candidate Gene Screening for Tobacco Mutants

Not available on PMC !

Example 5

Three tobacco lines, FC401 wild type (Wt); FC40-M207 mutant line fourth generation (M4) and FC401-M544 mutant line fourth generation (M4) were used for candidate gene screening. Low anatabine traits were confirmed for the two tobacco mutant lines (M207 and M544) in root and leaf before screening (see FIG. 3).

RNA was extracted from root tissues of wild type (Wt) FC401, M207 and M544 with RNeasy Plus Mini kit from Quiagen Inc. following the manufacturer's protocol. cDNA libraries were prepared from the RNAs using In-Fusion® SMARTer® Directional cDNA Library Construction Kit from Clontech Inc. cDNA libraries were diluted to 100 ng/μl and used as the template for candidate gene PCR screening.

PCR amplifications were performed in 50 μl final volumes that contained 50-100 ng of template DNA (i.e., the cDNA library) and 0.2 μM of primers (Fisher Scientific) using the Platinum® Taq DNA Polymerase High Fidelity kit (Life Technology Inc.). Thermocycling conditions included a 5 min incubation at 94° C.; followed by 34 cycles of 30 seconds at 94° C., 30 seconds at 58° C., 1 min 30 seconds at 68° C.; with a final reaction step of 68° C. for 7 mins. The PCR products were evaluated by agarose gel electrophoresis, and desired bands were gel purified and sequenced using an ABI 3730 DNA Analyzer (ABI).

51 candidate genes (listed in Table 4) were cloned from F401, Wt, M207 and M544 lines, and sequenced for single nucleotide polymorphism (SNP) detection.

TABLE 4

Listing of Candidate Genes for Screening

Quinolinate Synthase A-1Pathogenesis related protein 1

Allene oxide synthaseAllene oxide cyclase

ET861088.1 Methyl esteraseFH733463.1 TGACG-sequence specific transcription factor

FH129193.1 Aquaporin-TransportFH297656.1 Universal stress protein

Universal stress protein Tabacum sequenceFH077657.1 Scarecrow-like protein

FH864888.1 EIN3-binding F-box proteinFH029529.1 4,5 DOPA dioxygenase

FI010668.1 Ethylene-responsive transcription EB430189 Carboxylesterase

factor

DW001704 Glutathione S transferaseEB683763 Bifunctional inhibitor/lipid transfer protein/seed

storage 2S albumin

DW002318 Serine/threonine protein kinaseDW004086 Superoxide dismutase

DW001733 Lipid transfer protein DIRIDW001944 Protein phosphatase 2C

DW002033EB683763 Bifunctional inhibitor/lipid transfer protein/seed

storage 2S albumin

DW002318 Serine/threonine protein kinaseDW002576 Glycosyl hydrolase of unknown function DUF1680

EB683279EB683763

EB683951FG141784 (FAD Oxidoreductase)

BBLa-Tabacum sequencesBBLb

BBLeBBLd

PdrlPdr2

Pdr3Pdr5a

Pdr5bNtMATEl

NtMATE2NtMATE3

WRKY8EIG-I24

WRKY3WRKY9

EIG-E17AJ748263.1 QPT2 quinolinate phosphoribosyltransferase

AJ748262.1 QPT1

US11873500B2. Genetic locus imparting a low anatabine trait in tobacco and methods of using (2024-01-16). ALTRIA CLIENT SERVICES LLC [US]. Inventors: Chengalrayan Kudithipudi [US], Alec J. Hayes [US], Robert Frank Hart [US], Yanxin Shen [US], Jesse Frederick [US], Dongmei Xu [US].

Full text: Click here

Patent 2024

Albumins allene oxide cyclase allene oxide synthase Amino Acid Sequence anatabine Carboxylesterase cDNA Library Dioxygenases Dopa Electrophoresis, Agar Gel Esterases Ethylenes Genes Glutathione S-Transferase Heat Shock Proteins Histocompatibility Testing Hydrolase lipid transfer protein Neoplasm Metastasis Nicotiana Nicotinate-nucleotide pyrophosphorylase (carboxylating) NOS1 protein, human Oligonucleotide Primers Oxidoreductase pathogenesis Plant Leaves Plant Roots Platinum Protein-Serine-Threonine Kinases Protein-Threonine Phosphatase Protein Kinases protein methylesterase Protein Phosphatase Protein Phosphatase 2C Proteins Quinolinate RNA Single Nucleotide Polymorphism Superoxide Dismutase Synapsin I Taq Polymerase Transcription, Genetic Transcription Factor Transfer Factor Water Channel

Quantitative Real-Time PCR Analysis of Shrimp Gene Expression

Total RNA was extracted from the shrimp muscle using total RNA isolation kit (Sangon Biotech (Shanghai) Co., Ltd., China). The integrity and concentration of RNA were detected by 1% agarose gel electrophoresis and GeneQuant pro (GE Pharmacia, USA), respectively. The isolated RNA was then reversely transcribed to cDNA by reverse transcription kit (Vazyme Biotech Co., Ltd., China).
The amplification reactions for quantitative real-time polymerase chain reaction (qRT-PCR) were performed in 96-well plates using a total volume of 20 μL, containing 0.4 μL of each primer, 4 μL of cDNA template, 10 μL of 2 × ChamQ SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., China), 0.4 μL of ROX Reference Dye (Vazyme Biotech Co., Ltd., China), and 4.8 μL of sterilized double-distilled water. The qRT-PCR was performed with an ABI StepOnePlus Real-Time PCR System using the following cycle conditions: 95°C for 30 s, followed by 40 cycles of 95°C for10 s, and 60°C for 30 s [34 (link)]. Melting curve analysis was carried out to validate that only one PCR product was obtained in these reactions. The expression levels of genes were quantified relative to the expression of β-actin using the comparative CT method (2^−△△CT method) [35 (link)]. The expression of β-actin was stable among the treatments. The gene expression was normalized with the LP group as control. The primer sequences of target genes (target of rapamycin (tor), ribosomal protein S6 kinase (s6k), eukaryotic translation initiation factor 4E (eIF4E)-binding protein 1 (4e-bp1), phosphatidylinositol 3-kinase (pi3k),and serine/threonine-protein kinase (akt)) were designed based on our transcriptome unigenes of kuruma shrimp (Table 3).

Mu H., Yang C., Zhang Y., Chen S., Wang P., Yan B., Zhang Q., Wei C, & Gao H. (2023). Dietary β-Hydroxy-β-Methylbutyrate Supplementation Affects Growth Performance, Digestion, TOR Pathway, and Muscle Quality in Kuruma Shrimp (Marsupenaeus japonicas) Fed a Low Protein Diet. Aquaculture Nutrition, 2023, 9889533.

Full text: Click here

Publication 2023

1-Phosphatidylinositol 3-Kinase Actins DNA, Complementary EIF4EBP1 protein, human Electrophoresis, Agar Gel Gene Expression Genes Muscle Tissue Oligonucleotide Primers Protein-Serine-Threonine Kinases Real-Time Polymerase Chain Reaction Reverse Transcription Ribosomal Protein S6 Kinase Sirolimus Transcriptome

Protein Extraction and Western Blotting

The total protein content was obtained from the colon tissues of the C57BL/6 mice by applying Pro-Prep Protein Extraction Solution (Intron Biotechnology Inc., Seongnam, Republic of Korea) in accordance with the manufacturer’s protocol. After centrifugation at 13,000 rpm/min for 5 min, the protein concentrations were determined using a SMART™ Bicinchoninic Acid Protein Assay Kit (Thermo Fisher Scientific Inc.). Proteins were separated by 4–20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for 2 h and then transferred to nitrocellulose membranes at 40 V for 2 h. Membranes were then incubated at 4 °C with the following primary antibodies overnight: anti-p38 (Cell Signaling Technology Inc., Cambridge, MA, USA), anti-p-p38 (Cell Signaling Technology Inc.), anti-Protein kinase C (PKC) (Cell Signaling Technology Inc.), anti-phospho-PKC (p-PKC) (Cell Signaling Technology Inc.), anti- Akt serine/threonine kinase (AKT) (Cell Signaling Technology), anti-p-AKT (Cell Signaling Technology), anti-Extracellular signal-regulated kinase (ERK) (Cell Signaling Technology Inc.), anti-p-ERK (Cell Signaling Technology Inc.), anti-PI3K (Cell Signaling Technology), anti-p-PI3K (Cell Signaling Technology), anti- c-Jun N-terminal kinases (JNK) (Cell Signaling Technology Inc.), anti-p-JNK (Cell Signaling Technology Inc.), or anti- Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody (Cell Signaling Technology Inc.). The membranes were then washed with washing buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, and 0.05% Tween 20) and incubated with 1:2000 diluted horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Invitrogen) at room temperature for 1 h. Blots were developed using Amersham ECL Select Western Blotting detection reagent (GE Healthcare, Little Chalfont, UK). Chemiluminescence signals from specific bands were detected using FluorChemi^®FC2 (Alpha Innotech Co., San Leandro, CA, USA).

Kweon D.Y., Song H.J., Kim J.E., Jin Y.J., Roh Y.J., Seol A., Park J.M., Lee E.S., Choi W.S, & Hwang D.Y. (2023). Therapeutic Effects of Aloe saponaria against Ulcerative Colitis Induced by Dextran Sulfate Sodium. Current Issues in Molecular Biology, 45(2), 1483-1499.

Full text: Click here

Publication 2023

anti-IgG Antibodies Antibodies, Anti-Idiotypic bicinchoninic acid Biological Assay Buffers Centrifugation Chemiluminescence Colon Extracellular Signal Regulated Kinases Glyceraldehyde-3-Phosphate Dehydrogenases Goat Horseradish Peroxidase Introns JNK Mitogen-Activated Protein Kinases Mice, Inbred C57BL Nitrocellulose OCA2 protein, human Phosphatidylinositol 3-Kinases pros protein, Drosophila Protein-Serine-Threonine Kinases Protein Kinase C protein kinase C kinase Proteins Rabbits SDS-PAGE Sodium Chloride Tissue, Membrane Tissues Tween 20 Western Blot

Tracking Migratory and Invasive Behavior of Pancreatic Cancer Cell Lines

The migratory/invasive activities of LuPanc-1 and LuPanc-2 were determined with xCELLigence^® technology (ACEA Biosciences, San Diego, supplied by OLS, Bremen, Germany), as outlined in detail in previous publications [19 (link),20 (link)]. The lower side of the CIM plate-16 porous membrane was coated with a 1:1 mixture (v/v) of collagen I and collagen IV (30 μL) to facilitate the adherence of the cells and thus enhance the duration of the signal recording. Each well was loaded with 60,000 (LuPanc-1) or 80,000 (LuPanc-2) cells in standard growth medium (see above). Cells were allowed to settle in the laminar flow hood for 30 min at RT, after which the assay was started and run for 24 or 48 h. Some assays were performed in the absence or presence of recombinant human (rh) TGF-β1 (RELIATech GmbH, Wolfenbüttel, Germany) or the TGF-β type I receptor/ALK5 serine/threonine kinase inhibitor SB431542 (Merck, Darmstadt, Germany). Data acquisition (with signal recording every 15 min) and analysis were performed with the RTCA software (version 1.2, ACEA Biosciences).

Braun R., Lapshyna O., Watzelt J., Drenckhan M., Künstner A., Färber B., Hael A.A., Bolm L., Honselmann K.C., Konukiewitz B., Castven D., Spielmann M., Gorantla S.P., Busch H., Marquardt J.U., Keck T., Wellner U.F, & Ungefroren H. (2023). Establishment and Molecular Characterization of Two Patient-Derived Pancreatic Ductal Adenocarcinoma Cell Lines as Preclinical Models for Treatment Response. Cells, 12(4), 587.

Full text: Click here

Publication 2023

4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide Biological Assay Cell Migration Assays Cells Collagen Type I Collagen Type IV Culture Media Homo sapiens Protein-Serine-Threonine Kinases Receptor, Transforming Growth Factor-beta Type I Ribavirin TGF-beta1 TGFBR1 protein, human Tissue, Membrane

Kinase Activity Profiling using PamChip Arrays

Kinase activity was measured using protein tyrosine kinase (PTK) or serine-threonine kinases (STK) PamChip4 porous 3D microarrays and measured using the PamStation12 (PamGene International, ’s-Hertogenbosch, The Netherlands). Substrates contained in each array are included in the project GitHub repository listed above. Mouse livers were pooled and measured in triplicate across three chips simultaneously for PTK and STK, as previously described in [50 (link)]. This approach effectively deals with large batch effects across samples. It allows for the characterization of kinase activity only in the context of analytical variance. The pooled samples were lysed using M-PER Mammalian Extraction Buffer (Thermo Fischer Scientific, CAT#78503), Halt Phosphatase Inhibitor (Thermo Fischer Scientific, CAT#78428), and Protease Inhibitor Cocktail (Sigma, CAT#P2714). The samples were homogenized using TissueLyser LT (Qiagen). The protein concentration was measured in triplicate using Pierce BCA Protein assay (Thermo Fischer Scientific, CAT#23225). Samples were diluted to a final protein concentration of 2.5 μg/μL. Each array contained 1 μg of protein per sample for STK chips and 5 μg for PTK chips. In the presence of adenosine triphosphate (ATP), kinase phosphorylation activity is quantified using fluorescently labeled antibodies to detect differential phosphorylation of 196 (PTK) or 144 (STK) reporter peptides between experimental and control conditions, as previously described [50 (link)]. Evolve (PamGene) software uses a charge-coupled device (CCD) camera and light-emitting diode (LED) imaging system to record relative phosphorylation levels of each unique consensus phosphopeptide sequence every 5 min for 60 min as measured by peptide signal intensities recorded across 10, 20, 50, and 100 millisecond exposure times. Raw imaging data were exported for further data analysis and kinase mapping.

Bates E.A., Kipp Z.A., Martinez G.J., Badmus O.O., Soundarapandian M.M., Foster D., Xu M., Creeden J.F., Greer J.R., Morris A.J., Stec D.E, & Hinds TD J.r. (2023). Suppressing Hepatic UGT1A1 Increases Plasma Bilirubin, Lowers Plasma Urobilin, Reorganizes Kinase Signaling Pathways and Lipid Species and Improves Fatty Liver Disease. Biomolecules, 13(2), 252.

Full text: Click here

Publication 2023

Adenosine Triphosphate Antibodies Biological Assay Buffers DNA Chips Enzyme Multiplied Immunoassay Technique FRK protein, human Liver Mammals Medical Devices Microarray Analysis Mus Peptides Phosphopeptides Phosphoric Monoester Hydrolases Phosphorylation Phosphotransferases Protease Inhibitors Protein-Serine-Threonine Kinases Proteins Protein Tyrosine Kinase Signal Peptides Staphylococcal Protein A

Top products related to «Protein-Serine-Threonine Kinases»

Coulter counter stks by Beckman Coulter

Sourced in United States

The Coulter Counter STKS is a laboratory equipment designed for automated cell counting and sizing. It utilizes the Coulter principle to measure the volume and number of particles suspended in an electrolyte solution. The device provides accurate and reproducible results for a wide range of cell types and sizes.

Pvdf membrane by Merck Group

Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria

PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.

P akt by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Germany, Canada, Japan, Netherlands, France, Sao Tome and Principe, Hong Kong, Italy, Australia

P-AKT is a phosphorylated form of the AKT protein, a key signaling molecule involved in various cellular processes. The product is used for the detection and quantification of phosphorylated AKT in biological samples.

Vitros 950 by Johnson & Johnson

Sourced in United States

The VITROS 950 is a clinical chemistry analyzer designed for in vitro diagnostic testing in medical laboratories. It is capable of performing a variety of biochemical tests on patient samples to aid in the diagnosis and monitoring of various health conditions.

Coulter stks by Beckman Coulter

Sourced in United States

The Coulter STKS is a hematology analyzer that measures various blood cell parameters. It performs complete blood count (CBC) analysis, providing information on red blood cells, white blood cells, and platelets.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

β actin by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, Sweden, Netherlands, Switzerland, Italy, Belgium, Australia, France, India, Ireland

β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is an important component of the microfilament system and is involved in various cellular processes such as cell motility, structure, and integrity.

Ripa lysis buffer by Santa Cruz Biotechnology

Sourced in United States, Germany, France

RIPA lysis buffer is a detergent-based buffer used for the extraction and solubilization of proteins from cells and tissues. It contains a combination of ionic and non-ionic detergents, as well as other reagents, to facilitate the effective lysis and extraction of proteins from a wide range of sample types.

Ly294002 by Merck Group

Sourced in United States, Germany, United Kingdom, China, Sao Tome and Principe, Macao, Italy, Canada, Switzerland, Japan, France, Israel, Spain, Morocco

LY294002 is a chemical compound that functions as a specific inhibitor of phosphoinositide 3-kinase (PI3K). It is commonly used in laboratory research settings to investigate the role of PI3K signaling pathways.

Phospho akt by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Canada, Germany, France

Phospho-Akt is a lab equipment product that detects and quantifies phosphorylated Akt protein. It is used to study the activation status of the Akt signaling pathway.

What are Protein-Serine-Threonine Kinases and what is their role in cellular signaling?

How can PubCompare.ai assist in optimizing Protein-Serine-Threonine Kinase research?

PubCompare.ai allows you to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy when studying Protein-Serine-Threonine Kinases. This helps researchers identify the most effective protocols related to Protein-Serine-Threonine Kinases for their specific research goals.

What are some common usage challenges associated with Protein-Serine-Threonine Kinases?

One of the main challenges in working with Protein-Serine-Threonine Kinases is ensuring reproducibility and accuracy of experimental protocols. There are many variations in experimental approaches, reagents, and conditions that can impact the results. PubCompare.ai can assist by identifying the most optimized and reliable protocols from the literature, preprints, and patents, helping researchers overcome these usage challenges.

How can different types or variations of Protein-Serine-Threonine Kinases be studied effectively?

Protein-Serine-Threonine Kinases encompass a diverse family of enzymes with different substrates, regulatory mechanisms, and cellular functions. Studying these variations requires a thorough understanding of the specific kinase of interest and its role in cellular signaling. PubCompare.ai can help researchers navigate the literature and identify the most relevant and effective protocols for investigating different types or isoforms of Protein-Serine-Threonine Kinases.

What are some key applications of Protein-Serine-Threonine Kinases in biomedical research?

Protein-Serine-Threonine Kinases are involved in a wide range of biological processes and are implicated in various physiological and pathological conditions. They are of great interest in areas such as cancer biology, neuroscience, immunology, and metabolic disorders. Understanding the role of these kinases in signaling pathways can lead to the development of targeted therapies and improved disease management strategies. PubCompare.ai can assist researchers in optimizing their experimental approaches to elucidate the specific applications of Protein-Serine-Threonine Kinases in their fields of study.

More about "Protein-Serine-Threonine Kinases"

Protein-Serine-Threonine Kinases, also known as PSTK or ser/thr kinases, are a crucial class of enzymes that play a pivotal role in cellular signaling pathways.
These kinases catalyze the phosphorylation of serine and threonine residues in target proteins, regulating a wide array of biological processes such as cell growth, differentiation, metabolism, and apoptosis.
Studying PSTK is an important focus of biomedical research, as these kinases are involved in diverse physiological and pathological conditions.
Techniques like Coulter Counter STKS, PVDF membranes, and VITROS 950 analyzers can be leveraged to investigate PSTK activity and expression.
Additionally, related proteins like P-AKT, β-actin, and phospho-Akt can provide valuable insights into PSTK-mediated signaling cascades.
To optimize your PSTK research, PubCompare.ai's AI-driven platform can help you discover the most reproducible and accurate protocols from the literature, preprints, and patents.
Utilizing this tool, you can identify the optimal products and procedures, such as RIPA lysis buffer and LY294002 inhibitor, to enhance your experimental approaches and improve your research outcomes.
Elevate your PSTK studies with PubCompare.ai - the ultimate resource for protocol optimization and enhanced research productivity.