Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Protein TDP-43, human

Protein TDP-43, human

Protein TDP-43 is a DNA/RNA-binding protein involved in the regulation of gene expression, RNA processing, and neurodegeneration.
It is a key component of the pathology seen in amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), where it undergoes mislocalization and aggregation.
Studying the role of TDP-43 in these neurodegenerative disorders is crucial for understanding disease mechanisms and developing effective therapies.
This MeSH term provides a concise overview of the protein's functions and its association with major neurodegenerative conditions.

Most cited protocols related to «Protein TDP-43, human»

1
Alzheimer's Disease Neuropathology Analysis
Cited 17 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2011
2
Plasmid Construction and Mutagenesis of TDP-43
Cited 13 times
All TDP-43-bearing plasmids consisted of human TDP-43 fused at the C-terminus to EGFP (Fig. 1A). A linker region of 14 amino acids separates the C-terminus of TDP-43 from the N-terminus of EGFP, and six histidine residues were added to the C-terminus of EGFP to facilitate purification of the translated protein. The A315T mutation was created by site-directed mutagenesis of the adenine base at position 943 to guanine. The nuclear localization signal (NLS) was mutated by PCR as described (Winton et al., 2008 (link)) with the following primers: 5′– CAACTATCCAAAAGATAACGCAGCAGCAATGGATGAGACAGATGC–3′ and 5′– GCATCTGTCTCATCCATTGCTGCTGCGTTATCTTTTGGATAGTTG–3′. The nuclear export signal (NES) was disrupted similarly with the following primers: 5′–GCAGTCTCTTT GTGGAGAGGACGGAGGGGGAAAAGGAATCAGCGTTCATATATC–3′ and 5′– GATA TATGAACGCTGATTCCTTTTCCCCCTCCGTCCTCTCCACAAAGAGACTC –3′. Mutant huntingtin, mCherry, and EGFP were cloned into pGW1-CMV vectors as described (Arrasate et al., 2004 (link)). Sequence information for all plasmids is available at http://gind-db.ucsf.edu:8000/cgibin/Plasmid/main_menu2.cgi.
Barmada S.J., Skibinski G., Korb E., Rao E.J., Wu J.Y, & Finkbeiner S. (2010). Cytoplasmic Mislocalization of TDP-43 Is Toxic to Neurons and Enhanced by a Mutation Associated with Familial Amyotrophic Lateral Sclerosis. The Journal of Neuroscience, 30(2), 639-649.
Publication 2010
Adenine Amino Acids Cloning Vectors GATA3 protein, human Guanine HD protein, human Histidine Homo sapiens Mutagenesis, Site-Directed Mutation Nuclear Export Signals Nuclear Localization Signals Oligonucleotide Primers Plasmids Proteins protein TDP-43, human
3
Crosslinking Immunoprecipitation for TDP-43 and CELF2
Cited 13 times
The iCLIP protocol was performed as described previously10 (link), with the following modifications. SH-SY5Y neuroblastoma or H9 human embryonic stem cells were irradiate once with 150 mJ/cm2 in a Stratlinker 2400 at 254 nm, and brain tissue was dissociated in cold PBS and the suspension was crosslinked four times with 100 mJ/cm2. TDP-43 was immunoprecipitated with protein A Dynabeads (Invitrogen) conjugated to rabbit-anti TDP-43 (Proteintech, 10782-2-AP). For iCLIP of CELF2, protein G Dynabeads conjugated to mouse anti-CELF2 (Sigma, C9367) were used. In both cases, the region corresponding to 55–100kDa complexes was excised from the membrane to isolate the RNA. High-throughput sequencing using Illumina GA2 was done using 54 or 72 cycles (Supplementary Table S1). The barcode sequences corresponding to the individual experiment were as described (Supplementary table 1). The random barcodes were registered and the barcodes were removed before mapping the sequences to the human genome sequence (version GRCh37/hg19) allowing one mismatch using Bowtie version 0.10.1 (command line: -a -m 1 -v 1).
Tollervey J.R., Curk T., Rogelj B., Briese M., Cereda M., Kayikci M., Hortobágyi T., Nishimura A.L., Župunski V., Patani R., Chandran S., Rot G., Zupan B., Shaw C.E, & Ule J. (2011). Characterising the RNA targets and position-dependent splicing regulation by TDP-43; implications for neurodegenerative diseases. Nature neuroscience, 14(4), 452-458.
Publication 2011
Brain Cold Temperature G-substrate Genome, Human Human Embryonic Stem Cells Mice, House Neuroblastoma protein TDP-43, human Rabbits Radiotherapy Staphylococcal Protein A Tissue, Membrane Tissues
4
Alzheimer's Disease Subtypes and NFTD Analysis
Cited 12 times
Mayo Clinic Jacksonville brain bank database was searched for AD and NFTD that had been reviewed and diagnosed by a single neuropathologist (DWD). Classification of AD subtypes using a mathematical algorithm of hippocampal and cortical NFTs has been previously described in detail [30 (link)]. The following exclusion criteria were used for AD: Braak NFT stage ≤ IV, absence of paraffin blocks for immunohistochemical studies, and presence of hippocampal sclerosis (initial sample size HpSp = 97, typical = 665, LP = 127). Cases were further required to have antemortem clinical information available. Given the retrospective nature of this study and the absence of standardized clinical assessments, the sum of both HpSp and LP cases was used to set the number of typical AD for clinical history review. AD cases with three or more Mini-Mental State Exam (MMSE) scores [11 (link)] were included in the final AD subtype cohort (final sample size HpSp = 17, Typical = 52, LP = 19). Clinical parameters and availability are described later in “Materials and methods”.
Neurofibrillary tangle-predominant dementia was objectively diagnosed with a mathematical algorithm that used hippocampal and cortical NFT and SP counts in cases with a gestalt diagnosis of NFTD to set standards. NFTD had to have SP counts of ≤30 according to the minimum level described by Khachaturian criteria [24 (link)] (see Fig. 1). Of the 62 NFTD cases identified, we excluded cases with concomitant tau pathology (e.g., corticobasal degeneration, progressive supranuclear palsy, Guam parkinsonism–dementia complex, diffuse argyrophilic grain disease) to avoid confounding immunohistochemical differences in tau burden that may not accurately reflect differences among AD subtypes and when compared with NFTD. Other concurrent postmortem diagnoses that could interfere with data interpretation included frontotemporal lobar degeneration, hippocampal sclerosis, amyotrophic lateral sclerosis, and multiple system atrophy. Of the remaining 20 cases, 1 was excluded because of absence of dementia in the clinical history.
There were two primary sources for study cases: the State of Florida Alzheimer’s Disease Initiative (ADI) (n = 53; 50 %) [4 (link)] and the Mayo Clinic Jacksonville Memory Disorder Clinic (n = 30; 28 %). Of the remaining cases (n = 22), 2 (2 %) were from the Einstein Aging Study (P01 AG03949), 2 (2 %) from the CurePSP Brain Bank, 2 (2 %) from Mayo Clinic Jacksonville Movement Disorder Clinic, 2 (2 %) from the Florida Alzheimer’s Disease Research Center (P50 AG25711), and 15 (14 %) from various referral sources.
Standardized neuropathologic assessment included gross and microscopic evaluation. Senile plaque (SP, 10× objective) and NFT densities (40× objective), using thioflavin-S fluorescent microscopy, were assessed on an Olympus BH2 fluorescent microscope [36 (link)–38 (link)]. SP counts were truncated at 50 (i.e., twice the number needed for neuropathologic AD diagnosis [24 (link)]) and included primitive, neuritic, and cored type of plaques. NFT counts used in the classification algorithm include intracellular and extracellular tangles from two hippocampal sectors (CA1 and subiculum) and three association cortices (middle frontal, inferior parietal, and superior temporal). The detailed algorithm methods have been previously described, including steps, sample sizes, and median values [30 (link)]. To classify NFTD cases objectively, a Microsoft Excel 2003 function was designed. Three algorithm requirements were written to classify NFTD: (1) the hippocampal and average hippocampal NFT densities had to be greater than the minimum NFT found in cases with a gestalt diagnosis of NFTD (minimum of 9 for CA2/3, 5 for CA1, 2 for subiculum, and 10 for hippocampal average); (2) at least three of the cortical and average cortical NFT densities had to be less than the maximum NFT found in cases with a subjective diagnosis of NFTD (maximum of 35 for superior temporal, 4 for inferior parietal, 6 for mid-frontal, and 14 for average cortical); and (3) the SP densities in the association cortex had to be less than or equal to the cutoff according to Khachaturian criteria [24 (link)] (≤30 for middle frontal, inferior parietal, and superior temporal cortices).
Five-micrometer-thick sections of formalin-fixed, paraffin-embedded tissue from the middle frontal gyrus were stained with H&E. Additional serial sections were processed using a DAKO Autostainer (Universal Staining System Carpinteria, CA, USA) using the chromogen 3,3′-diaminobenzidine and immunostained for phospho-tau detecting early neuritic and NFT pathology, including pretangles (CP13, mouse IgG1, 1:1,000, generous gift of Peter Davies, Albert Einstein College of Medicine, Bronx, NY, USA), an antibody to a conformational epitope in NFTs detecting late-stage tangles (Ab39, monoclonal, 1:350, generous gift from Shu-Hui Yen, Mayo Clinic, Jacksonville, FL, USA) [42 (link)], pan-Aβ (33.1.1, 1:1,000, human Aβ1-16 specific) [25 (link)], and Aβ40 (13.1.1, 1:1,000, human Aβ-specific) [25 (link)]. Slides were counterstained with hematoxylin after immunostaining. Stained slides were digitally scanned at 20× on the ScanScope XT (Aperio, Vista, CA, USA) and viewed/annotated using ImageScope v10.2 software (Aperio, Vista, CA, USA). The regions of interest (ROI) for each case were initially drawn on the H&E section and the ROI was transferred to the immunostained slides. Slides were edited if there were any differences between the serial sections. The gray–white matter boundary was evaluated at 20× and marked with arrow tools along a parallel gyrus, neither including the gyral ridge nor depth. Two custom algorithms were designed to specifically detect the optical density of the tau and amyloid [8 (link)]. The result is a percentage burden that reflects the amount of stained pathology out of the total area that was stained.
Immunohistochemical methods for assessment of TAR DNA binding protein 43 (TDP-43) pathology [2 (link)] and Lewy body pathology [38 (link)] were performed as previously described. Non-Alzheimer pathologies are reported as frequencies in Table 1. Cerebral amyloid angiopathy (CAA) was graded on a four-point semi-quantitative scale: none, mild, moderate, and severe using thioflavin-S microscopy. The severity of NFTs and SPs in the molecular layer of the dentate fascia and basal ganglia was similarly graded on a four-point semi-quantitative scale by retrospectively reviewing neuropathology reports from each case. Vascular calcification was assessed using a four-point semi-quantitative severity scale in the basal ganglia on a routine hematoxylin and eosin (H&E) stained section by extracting information from neuropathology reports. Ab39 immunohistochemistry in the midbrain and pons was assessed using a four-point scale. Midbrain severity was considered: mild if Ab39-immunopositive neurites and<10 NFTs were confined to the substantia nigra; moderate if significant neuritic and extracellular NFT pathology was found in the substantia nigra, with widespread pathology found in the perinigral and periaqueductal gray; severe if neuritic, extracellular NFT were found in substantia nigra, and perinigral and periaqueductal gray. The locus coeruleus and raphe nuclei were considered as: mild, if NFTs were disproportionate to neurons present and contained no extracellular NFTs; moderate, if of the neurons affected a greater proportion were NFTs; severe, if extracelluar NFTs were greater than the number of NFTs. The severity scores were used to determine the absence (sum of none and mild semi-quantitative severity scores) versus the presence (sum of moderate and severe scores) of pathology. The presence of any NFTs in the basal ganglia, whether mild or moderate, was sufficient to be summed as present given the scarcity of NFT pathology.
Clinic reports were reviewed blind to pathologic diagnosis. This study had Mayo Clinic Institutional Review Board approval. Clinical parameters included: education, age of onset, disease duration, and MMSE scores and dates. Elapsed years between age at death and age of onset were used to calculate disease duration. Three or more MMSE testing dates and scores were required to calculate longitudinal decline as a slope, setting MMSE score as the dependent variable and elapsed years between testing and death as the independent variable. Elapsed time between age of onset or death was not a factor used for exclusion of data in longitudinal decline; data available anywhere along the clinical course were included for evaluation. Antemortem clinical diagnoses compatible with dementia included AD, aphasia, Binswanger’s disease, corticobasal syndrome, Creutzfeldt-Jakob disease, dementia with Lewy bodies, frontotemporal dementia, normal pressure hydrocephalus, Parkinson’s disease dementia, Pick’s disease, progressive supranuclear palsy, and semantic dementia. The available clinical parameters in HpSp, typical, LP, and NFTD, respectively, are: education [11 (65 %), 50 (95 %), 17 (89 %), 11 (61 %)], age of onset and disease duration [16 (94 %), 45 (87 %), 14 (74 %), 16 (89 %)], MMSE initial [10 (59 %), 25 (48 %), 8 (42 %), 7 (39 %)], MMSE final [10 (59 %), 16 (31 %), 11 (58 %), 6(33 %)], and longitudinal MMSE [17 (100 %), 52 (100 %), 19 (100 %), 4 (22 %)]. MAPT and APOE genotyping was available for all cases, except one typical AD which did not have frozen tissue available for genotyping. Genomic DNA was extracted from frozen brain tissue according to previously described methods. Each sample was genotyped for MAPT H1/H2 (SNP rs1052553 A/G, A = H1, G = H2) and APOE alleles (SNP rs429358 C/T and rs7412 C/T) using ABI on-demand Taqman assays (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) and analyzed with SDS 2.2.2 software (also from Applied Biosystems).
SigmaPlot (Ver. 11, San Jose, CA, USA) was used to analyze all statistical data and create graphs. Group comparisons of continuous variables were performed using Kruskal–Wallis one-way analysis of variance on ranks, and pairwise comparisons were performed with the Mann–Whitney rank sum test. Analyses of categorical data were performed using a χ2 test to determine whether the proportions of observations varied between the groups and between the comparison groups. Each group was evaluated for interrelationships of the hippocampal and cortical NFT using a Spearman correlation. A multiple logistic regression model was constructed to control for APOE ε4 allele status when examining pan-Aβ differences between HpSp and LP.
Janocko N.J., Brodersen K.A., Soto-Ortolaza A.I., Ross O.A., Liesinger A.M., Duara R., Graff-Radford N.R., Dickson D.W, & Murray M.E. (2012). Neuropathologically defined subtypes of Alzheimer’s disease differ significantly from neurofibrillary tangle-predominant dementia. Acta neuropathologica, 124(5), 681-692.
Publication 2012
5
RNA FISH and Immunodetection of ALS Markers
Cited 7 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
Dot Immunoblotting Fibroblasts Fluorescent in Situ Hybridization Fractionation, Chemical glycylproline Homo sapiens Immunoglobulins Poly A protein TDP-43, human ran GTP-Binding Protein Sucrose Technique, Dilution Tissues Urea

Most recents protocols related to «Protein TDP-43, human»

1
Evaluating STMN2 and TDP-43 in ALS

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2024
2
A Comprehensive Workflow for Isolating and Analyzing Motor Neurons from Human Spinal Cord Tissue

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2024
3
Quantifying Plasma TDP-43 Levels

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2024
4
Purification of TDP-43 and PDI Proteins
Not available on PMC !
A plasmid-encoding, human full-length TDP-43 was a kind gift from Dr. H.-N. Du (College of Life Sciences, Wuhan University). Recombinant, full-length wild-type human TDP-43 (residues 1-414) containing a tag of six histidine residues (polyhistidine tag) at its C-terminal domain was constructed into a prokaryotic expression vector pET22b and expressed in E. coli BL21 (DE3) cells (Novagen, Merck, Darmstadt, Germany). TDP-43 protein was purified to homogeneity by nickel affinity chromatography as described by Vega et al. (70) . After purification, the refolded TDP-43 protein was dialyzed against 50 mM Tris-HCl buffer (pH 8.0) containing 150 mM NaCl four times to remove the detergents and salts, concentrated, and then centrifuged at 17,000 g for 30 min at 4 °C to remove large aggregates. The supernatant of the refolded TDP-43 protein was freshly used or stored at -80 °C. SDS-PAGE was used to confirm that the purified human TDP-43 protein was single species. We used a BCA protein assay kit (Beyotime, P0012) to determine the concentration of human TDP-43 protein.
A plasmid-encoding, human full-length PDI was a kind gift from Dr. L. W. Ruddock (Faculty of Biochemistry and Molecular Medicine, University of Oulu). The gene for PDI 1-491 was constructed in a prokaryotic expression vector pET23, and a PDI mutant dnPDI was constructed by site-directed mutagenesis using a wild-type PDI template; the primers are shown in table S1. All PDI plasmids were transformed into Escherichia coli. Recombinant full-length wild-type human PDI (residues 1-491) and its variant dnPDI were expressed from the vector pET23 in E. coli BL21 (DE3) Codon plus-RIL cells (Novagen, Merck, Darmstadt, Germany). PDI proteins were purified to homogeneity by nickel affinity chromatography as described by Wang et al. (71) . The eluted fractions were dialyzed against 50 mM Tris-HCl buffer (pH 8.0) containing 150 mM NaCl twice to remove EDTA. The PDI proteins were freshly used or stored at -80 °C. SDS-PAGE was used to confirm that the purified human PDI proteins were single species. We used a UV-2550 Probe spectrophotometer (Shimadzu, Kyoto, Japan) to determine the concentrations of wild-type human PDI and dnPDI, using their absorbances at 214 nm with a standard calibration curve drawn by BSA.
Liu J., Liu F., Li Y., Liu X., Wang L., Wang K., Yang Z., Fu Q., Xu X., Chen J., Zhang Y., Zhou J., Le W., Cui M., & Liang Y. (2024). Protein disulfide isomerase disassembles stress granules and blocks cytoplasmic aggregation of TDP-43 in ALS.
Publication 2024
5
Generating Fusion Protein Expression Plasmids
To create the expression
plasmids of proteins that SNR was tagged at the C-terminus of G3BP1
and TDP-43, the SNR cDNA fragment (gift from Prof. T. Nagai) was inserted
into the BamHI and NotI sites of
pcDNA3.1(+) (Thermo Fisher Scientific, Waltham, MA, USA) (pcDNA-SNR).
Next, the DNA fragments of human TDP-43 obtained from the TDP-43 expression
plasmid as previously reported45 (link) and G3BP1
from Addgene (Clone#129339, Watertown, MA, USA) were inserted into
the HindIII and BamHI sites of pcDNA-SNR
(pTDP43-SNR and pG3BP1-SNR, respectively). To create monomeric enhanced
green fluorescent protein (meGFP)-tagged TDP-43 or G3BP1 expression
vectors, the DNA fragment of the SNR of pTDP43-SNR and pG3BP1-SNR
was cut and substituted with that of meGFP digested from pmeGFP-N145 (link) using the BamHI and NotI sites (pTDP43-GFP and pG3BP1-GFP, respectively). The
expression plasmid for meGFP-tagged histone H2B (pBOS-H2B-GFP) and
pCAGGS was the same as that used previously.45 (link),46 (link)
Koizumi T., Fujimoto A., Kawaguchi H., Kurosaki T, & Kitamura A. (2024). Stress Granule Dysfunction via Chromophore-Associated Light Inactivation. ACS Omega, 9(19), 21298-21306.
Publication 2024

Top products related to «Protein TDP-43, human»

1
Rabbit anti tdp 43 by Proteintech
Rabbit anti-TDP-43 is a primary antibody that specifically recognizes the TDP-43 (Transactive Response DNA Binding Protein 43) protein. TDP-43 is a DNA/RNA-binding protein involved in various cellular processes, including transcription, splicing, and stress granule formation. This antibody can be used for the detection and analysis of TDP-43 in a variety of applications, such as Western blotting, immunohistochemistry, and immunofluorescence.
2
Immobilon p by Merck Group
Sourced in United States, Germany, United Kingdom, Japan, Ireland, Morocco, Switzerland, Sweden, France, Italy, Spain, China, Canada, Israel, Denmark
Immobilon-P is a polyvinylidene fluoride (PVDF) membrane designed for use in Western blotting applications. It provides a high-binding capacity for proteins and offers good mechanical strength and low background. The membrane is chemically stable and has a pore size of 0.45 μm.
3
Gapdh by Merck Group
Sourced in United States, United Kingdom, Germany, China, Canada, Italy, Japan, Morocco, Israel, Australia, France, Sao Tome and Principe, Denmark
GAPDH is an enzyme that catalyzes the sixth step of glycolysis, the metabolic pathway that converts glucose into energy. It is responsible for the conversion of glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate. GAPDH is commonly used as a control or reference gene in molecular biology experiments.
4
Protease inhibitors cocktail and phosphor inhibitor by Thermo Fisher Scientific
Protease inhibitor cocktail and phosphor inhibitor are lab equipment designed to inhibit the activity of proteases and phosphatases, respectively. Protease inhibitors are used to prevent the degradation of proteins during sample preparation and analysis, while phosphor inhibitors are used to maintain the phosphorylation state of proteins. These products are commonly used in biochemical and cell-based assays, as well as in the preparation of protein samples for various analytical techniques.
5
Cac tip ptd m01 by Cell Signaling Technology
The CAC-TIP-PTD-M01 is a laboratory equipment product manufactured by Cell Signaling Technology. It serves as a cell culture accessory, but a detailed description of its core function cannot be provided while maintaining an unbiased and factual approach without extrapolation.
6
Pcmv6 ac gfp by OriGene
Sourced in United States
PCMV6-AC-GFP is a plasmid vector that expresses the green fluorescent protein (GFP) under the control of the cytomegalovirus (CMV) promoter. The plasmid backbone contains an ampicillin resistance gene for selection in bacteria.
7
Ripa lysis buffer by Cell Signaling Technology
Sourced in United States, China
RIPA lysis buffer is a solution used for the extraction and solubilization of proteins from cells and tissues. It contains a combination of detergents, salts, and other components that help disrupt cell membranes and release proteins into solution, enabling their subsequent analysis and detection.
8
Quickchange mutagenesis kit by Agilent Technologies
Sourced in United States
The QuickChange mutagenesis kit is a molecular biology tool designed for site-directed mutagenesis. It allows users to introduce specific mutations into double-stranded plasmid DNA.
9
Mouse anti gapdh by Santa Cruz Biotechnology
Sourced in United States, Canada, United Kingdom
Mouse anti-GAPDH is a primary antibody that recognizes the GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) protein. GAPDH is a widely expressed enzyme involved in glycolysis. This antibody can be used to detect and quantify GAPDH expression in various samples.
10
Tip ptd m01 by Cosmo Bio
Sourced in Japan, United States
The TIP-PTD-M01 is a laboratory equipment item designed for general use in scientific research and analysis. It serves as a mechanical device for transferring precise volumes of liquids. The core function of this product is to facilitate accurate liquid handling and dispensing tasks commonly performed in laboratory settings.

More about "Protein TDP-43, human"

Protein TDP-43, also known as TAR DNA-binding protein 43, is a multifunctional protein that plays a crucial role in various cellular processes, including gene expression regulation, RNA processing, and neurodegeneration.
This DNA/RNA-binding protein is a key component in the pathology of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), where it undergoes mislocalization and aggregation.
Studying the function and behavior of TDP-43 is crucial for understanding the underlying mechanisms of these neurodegenerative disorders and developing effective therapies.
Researchers can utilize a variety of tools and techniques to investigate TDP-43, such as Rabbit anti-TDP-43 antibodies, Immobilon-P membranes, and GAPDH as a loading control.
Additionally, the use of protease inhibitors cocktail and phosphor inhibitor can help preserve the integrity of TDP-43 during experimental procedures.
The CAC-TIP-PTD-M01 and PCMV6-AC-GFP plasmids are commonly used to study the effects of TDP-43 overexpression or mutation, while RIPA lysis buffer and the QuickChange mutagenesis kit provide the means to extract and manipulate TDP-43 in the laboratory.
Mouse anti-GAPDH antibodies can serve as a valuable reference for normalizing TDP-43 expression levels.
By leveraging these tools and techniques, researchers can gain deeper insights into the role of TDP-43 in neurodegenerative diseases, ultimately contributing to the development of more effective treatments and therapies.
The TIP-PTD-M01 molecule, for instance, has been explored as a potential therapeutic agent for targeting TDP-43-related pathologies.