> Chemicals & Drugs > Amino Acid > Ribulose-Bisphosphate Carboxylase

Ricin →

Ribulose-Bisphosphate Carboxylase

Ribulose-Bisphosphate Carboxylase: A key enzyme invovled in the carbon fixation process of photosynthesis.
Also known as RuBisCO, this enzyme catalyzes the carboxylation of ribulose-1,5-bisphosphate, the initial step in carbon dioxide assimilation.
RuBisCO plays a critical role in plant growth and productivity, making it an important target for agricultural and biotechnological research.

Most cited protocols related to «Ribulose-Bisphosphate Carboxylase»

Genome-Specific Metabolic Potential Analysis

Cited 21 times

Genome-specific metabolic potential was determined by (1) searching all predicted ORFs in a genome with Pfam35 (link), TIGRfam34 (link), Panther69 (link) and custom HMM profiles (Supplementary Data 8 and 12) of marker genes for specific pathways using hmmscan36 (link), and (2) assessment of complete pathways for metabolic transformations using ggKbase. For generation of custom HMM profiles, references for each marker gene were aligned using MUSCLE with default parameters followed by manually trimming the start and ends of the alignment. The alignment was converted into Stockholm format and databases were built using hmmscan36 (link). For Rubisco and hydrogenases70 (link), different hmm databases were constructed for each distinct group. For HMM searches against TIGRfam, all hits above the preset noise cutoff were considered for manual inspection. Individual cutoffs for all HMMs were determined by manual inspection and are listed in Supplementary Data 14.
In ggKbase, lists for specific metabolic pathways were generated by searching for specific keywords in gene annotations. Coupling the genome abundance to metabolic traits allowed the simultaneous assessment of all 2,540 genomes assembled in this study. All custom HMM profiles used in this study are publicly available from https://github.com/banfieldlab.

Anantharaman K., Brown C.T., Hug L.A., Sharon I., Castelle C.J., Probst A.J., Thomas B.C., Singh A., Wilkins M.J., Karaoz U., Brodie E.L., Williams K.H., Hubbard S.S, & Banfield J.F. (2016). Thousands of microbial genomes shed light on interconnected biogeochemical processes in an aquifer system. Nature Communications, 7, 13219.

Full text: Click here

Publication 2016

Gene Annotation Genes Genetic Markers Genome Hypertelorism, Severe, With Midface Prominence, Myopia, Mental Retardation, And Bone Fragility Muscle Tissue Open Reading Frames Ribulose-Bisphosphate Carboxylase

Quantifying Verticillium dahliae Infection in Arabidopsis

Cited 14 times

Two-week-old Arabidopsis plants were inoculated with V. dahliae strain JR2 as described above. After visible symptom development at 19–29 d post-inoculation, for each experiment and for each Arabidopsis genotype all above-ground tissues were harvested per plant and flash-frozen in liquid nitrogen. The samples were ground to a powder, of which an aliquot of approximately 100 mg was used for DNA isolation (Fulton et al., 1995 ). Quantitative real-time PCR was conducted using an ABI7300 PCR machine (Applied Biosystems, Foster City, USA) with the qPCR Core kit for SYBR Green I (Eurogentec Nederland BV, Maastricht, NL). To measure V. dahliae biomass, the internal transcribed spacer region of the ribosomal DNA was targeted using the fungus-specific ITS1-F primer (AAAGTTTTAATGGTTCGCTAAGA; Gardes and Bruns, 1993 (link)) in combination with the V. dahliae-specific reverse primer ST-VE1-R (CTTGGTCATTTAGAGGAAGTAA; Lievens et al., 2006 ), generating a 200 bp amplicon. For sample equilibration, the Arabidopsis large subunit of the RuBisCo gene was targeted using the primer set At-RuBisCo-F3 and -R3 (GCAAGTGTTGGGTTCAAAGCTGGTG and CCAGGTTGAGGAGTTACTCGGAATGCTG, respectively), generating a 120 bp amplicon. Real-time PCR conditions consisted of an initial 95 °C denaturation step for 4 min, followed by 30 cycles of denaturation for 15 s at 95 °C, annealing for 30 s at 60 °C, and extension for 30 s at 72 °C. The average fungal biomass was determined using at least four Verticillium-inoculated plants for each genotype.

Ellendorff U., Fradin E.F., de Jonge R, & Thomma B.P. (2008). RNA silencing is required for Arabidopsis defence against Verticillium wilt disease. Journal of Experimental Botany, 60(2), 591-602.

Publication 2008

Arabidopsis DNA, Ribosomal Spacer Freezing Fungi Genes Genotype isolation Nitrogen Oligonucleotide Primers Plants Powder Real-Time Polymerase Chain Reaction Ribulose-Bisphosphate Carboxylase Ribulose-Bisphosphate Carboxylase Large Subunit Strains SYBR Green I Tissues V-Primer Vaccination Verticillium

Estimating Rubisco Decarboxylation Rate Using Chlorophyll Fluorescence

Cited 12 times

The method of Yin et al. (2009) to estimate R_d is based on the fact that at low values of irradiance A is limited by the light-dependent e^– transport rate. Building upon the well-known model of Farquhar et al. (1980) , Yin et al. (2004) described a generalized equation for A within the e^– transport-limited range as: where J₂ is the total rate of e^– transport passing PSII, f_cyc and f_pseudo represent fractions of the total e^– flux passing PSI that follow cyclic and pseudocyclic pathways, respectively, C_c is the CO₂ level at the carboxylation sites of Rubisco, and Γ_* is the C_c-based CO₂ compensation point in the absence of R_d. A special case of Equation (1) is the e^– transport-limited equation of the Farquhar et al. (1980) model: where J is the PSII e^– transport rate that is used for CO₂ fixation and photorespiration.
By definition, the variable J₂ in Equation (1) can be replaced by ρ₂βI_incΦ₂, where I_inc is the level of incident irradiance, β is the absorptance by leaf photosynthetic pigments, and ρ₂ is the fraction of absorbed irradiance partitioned to PSII. Substituting this term into Equation (1) gives:
For non-photorespiratory conditions where C_c approaches infinity and/or Γ_* approaches zero, Equation (3) becomes: where the lumped parameter s=ρ₂β[1–f_pseudo/(1–f_cyc)]. So, using data of the e^– transport-limited range under non-photorespiratory conditions, a simple linear regression can be performed for the observed A against (I_incΦ₂/4), in which Φ₂ is based on CF measurements. The slope of the regression will yield the estimate of a lumped parameter s, and the intercept will give an estimate of R_d (Yin et al., 2009 ). Clearly, this CF-based method is very similar to the Kok method; therefore, it should apply to the range of limiting irradiances, yet above the Kok break point if the Kok effect occurs. However, the Kok method has an additional assumption that Φ₂ is constant within the range of limiting lights. As will be shown later, this assumption is not true.
Assuming the variation of the term (C_c–Γ_*)/(C_c+2Γ_*) in Equation (3) is negligible across an A–I_inc curve, Yin et al. (2009) showed that the simple regression procedure can also be used to estimate R_d for photorespiratory conditions, although it is then less certain that the relationship between A and I_incΦ₂/4 will be linear. This assumption is in fact also used implicitly in applying the Kok method to estimate R_d or quantum yield under photorespiratory conditions. To correct for small differences of CO₂ level across an A–I_inc curve when estimating R_d, a procedure as proposed by Kirschbaum and Farquhar (1987) (link) would need to be implemented. However, their correction procedure was based on an assumption of infinite g_m, which is now known to be unlikely to be true (Harley et al., 1992 (link); Flexas et al., 2007b (link); Yin and Struik, 2009 ). A full correction would require a pre- or simultaneous estimation of g_m, in addition to the estimation of Γ_*. No correction was therefore made in using the CF method for the purpose of simplicity.

Yin X., Sun Z., Struik P.C, & Gu J. (2011). Evaluating a new method to estimate the rate of leaf respiration in the light by analysis of combined gas exchange and chlorophyll fluorescence measurements. Journal of Experimental Botany, 62(10), 3489-3499.

Publication 2011

Light Photosynthesis Pigmentation Plant Leaves Ribulose-Bisphosphate Carboxylase

Comprehensive RuBisCO Sequence Analysis

Cited 11 times

We extracted above-threshold hits for RuBisCO large chain (K01601), yielding a final set of genomes encoding the enzyme. To analyze the number of nonredundant genomes containing RuBisCO, we repeated the above analysis with a set of ∼3,000 high quality genomes from various environments. These genomes were dereplicated at 99% secondary Average Nucleotide Identity (ANI) using dRep (-comp 20) (Olm et al. 2017 (link)) and then analyzed for presence of RuBisCO.
To expand the breadth of our main RuBisCO set, we identified RuBisCO sequences (many of which were unbinned) from sediment and groundwater metagenomes (e.g., Anantharaman et al. 2016 (link); Hernsdorf et al. 2017 (link); Probst et al. 2017 (link)). We excluded sequences shorter than 200 amino acids in length to remove fragmented proteins. Phylum-level taxonomy for these sequences was assigned based on the closest affiliation of the encoded sequences. These sequences were added to those from genomes and the entire set was dereplicated (USEARCH, -id 0.99 -sort length) (Edgar 2010 (link)). Sourcing for dereplicated sequences can be found in supplementary table S1, Supplementary Material online. Next, we combined the full set with reference RuBisCO from NCBI and aligned it using MAFFT (default parameters) (Katoh and Standley 2013 (link)). Alignments were trimmed by removing columns with >95% gaps. The unmasked alignment file of dereplicated RuBisCO sequences with metadata is attached as supplementary file 1, Supplementary Material online. We next constructed a maximum-likelihood tree with RAxML-HPC BlackBox (v. 8.2.10) as implemented on cipres.org (default parameters with rapid bootstrapping) (Stamatakis et al. 2008 (link)) and subsequently assigned each RuBisCO sequence to previously identified Forms based on phylogenetic clustering with reference sequences. Binned sequences excluded from the dereplicated set were reinserted into the tree and classified for downstream analyses. Sequences in ambiguous phylogenetic positions were annotated as “unknown.” Custom HMMs were constructed using recovered sequences for each RuBisCO form with the HMMER suite (Finn et al. 2011 (link)) and were subsequently self-tested and manually refined to exclude low-scoring sequences.

Jaffe A.L., Castelle C.J., Dupont C.L, & Banfield J.F. (2018). Lateral Gene Transfer Shapes the Distribution of RuBisCO among Candidate Phyla Radiation Bacteria and DPANN Archaea. Molecular Biology and Evolution, 36(3), 435-446.

Publication 2018

Amino Acids Base Sequence COMP protocol Enzymes Genome Hypertelorism, Severe, With Midface Prominence, Myopia, Mental Retardation, And Bone Fragility Metagenome Nucleotides Proteins Ribulose-Bisphosphate Carboxylase Trees

Photosynthetic Enzyme Activity Assays

Cited 8 times

The activities of the photosynthetic enzymes Rubisco and PEPC were measured as previously described by Cousins et al. (2007) (link), with some changes. Frozen leaf tissue was processed in ice-cold glass homogenizers with 500 μl of extraction buffer (50 mM HEPES-KOH pH 7.8, 1 mM EDTA, 0.1% Triton-X, 10 mM dithiothreitol, and 1% polyvinylpolypyrrolidone) and 10 μl of protease inhibitor cocktail (Sigma). The homogenate was briefly centrifuged and the supernatant used for assays. For PEPC, 10 μl of leaf extract was combined with 980 μl of assay buffer (50 mM EPPS-NaOH pH 8, 10 mM MgCl₂, 0.5 mM EDTA, 0.2 mM NADH, 5 mM glucose-6-phosphate 1 mM NaHCO₃, and 1 U ml⁻¹ malate dehydrogenase) and the reaction initiated by the addition of 10 μl of 400 mM PEP. For Rubisco, 10 μl of leaf extract was combined with 970 μl of assay buffer (50 mM EPPS-NaOH pH 8, 10 mM MgCl₂, 0.5 mM EDTA, 1 mM ATP, 5 mM phosphocreatine, 20 mM NaHCO₃, 0.2 mM NADH, 50 U ml⁻¹ creatine phosphokinase, 0.2 mg carbonic anhydrase, 50 U ml⁻¹ 3-phosphoglycerate kinase, 40 U ml⁻¹ glyceraldehyde-3-phosphate dehydrogenase, 113 U m;⁻¹ Triose-phosphate isomerase, 39 U ml⁻¹ glycerol 3 phosphate dehydrogenase) and the reaction initiated by the addition of 20 μl of 21.9 mM ribulose-1, 5-bisphosphate (RuBP). The activity of both enzymes was calculated by monitoring the decrease of NADH absorbance at 340 nm with a diode array spectrophotometer (Hewlett Packard) after initiation of the reaction.
Chlorophyll was extracted from frozen leaf discs in a glass homogenizer with 80% acetone. The chlorophyll a and b contents of extracts were measured in a quartz cuvette at 663.3 nm and 646.6 nm, and calculated according to Porra et al. (1989) .

Pengelly J.J., Sirault X.R., Tazoe Y., Evans J.R., Furbank R.T, & von Caemmerer S. (2010). Growth of the C4 dicot Flaveria bidentis: photosynthetic acclimation to low light through shifts in leaf anatomy and biochemistry. Journal of Experimental Botany, 61(14), 4109-4122.

Publication 2010

Acetone Bicarbonate, Sodium Biological Assay Buffers Chlorophyll Chlorophyll A Cold Temperature Creatine Kinase Dehydratase, Carbonate Dithiothreitol Edetic Acid enzyme activity Freezing Glucose-6-Phosphate Glyceraldehyde-3-Phosphate Dehydrogenases Glycerol-3-Phosphate Dehydrogenase HEPES Magnesium Chloride Malate Dehydrogenase NADH Phosphocreatine Phosphotransferases Photosynthesis Plant Leaves polyvinylpolypyrrolidone Protease Inhibitors Quartz ribulose Ribulose-Bisphosphate Carboxylase Tissues Triose-Phosphate Isomerase

Most recents protocols related to «Ribulose-Bisphosphate Carboxylase»

Photosynthesis and Leaf Physiology

The net photosynthetic rate (P_n), transpiration rate (T_r), stomatal conductance (G_s), and intercellular CO₂ concentration (C_i) were measured by a Li-6400 photosynthetic instrument (LI-COR Inc., USA) from 8:30 to 10:30 a.m. under standardized climatic conditions; the light-saturation point was set to 1,200 μmol (photon)·mÀ 2·sÀ 1, the ambient temperature of the apple leaves was kept constant at 30°C, the CO₂ concentration was 400 μmol (CO₂)·molÀ 1, relative humidity was 60%–65%, and air flow was 500 μmol sÀ 1. The chlorophyll content was measured, as described by Wen et al. (2019) (link). Rubisco activity was measured by the method described by Liu et al. (2013) (link).

Tian G., Qin H., Liu C., Xing Y., Feng Z., Xu X., Liu J., Lyu M., Jiang H., Zhu Z., Jiang Y, & Ge S. (2023). Magnesium improved fruit quality by regulating photosynthetic nitrogen use efficiency, carbon–nitrogen metabolism, and anthocyanin biosynthesis in ‘Red Fuji’ apple. Frontiers in Plant Science, 14, 1136179.

Full text: Click here

Publication 2023

Chlorophyll Climate Humidity Light Photosynthesis Ribulose-Bisphosphate Carboxylase Surgical Stoma

Enzymatic Assay for RuBisCO Activity

The enzymatic assays for determining
the activity of RuBisCO were realized following the method described
by Yasumoto et al..^{37 (link)} The
chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Routier C., Vallan L., Daguerre Y., Juvany M., Istif E., Mantione D., Brochon C., Hadziioannou G., Strand Å., Näsholm T., Cloutet E., Pavlopoulou E, & Stavrinidou E. (2023). Chitosan-Modified Polyethyleneimine Nanoparticles for Enhancing the Carboxylation Reaction and Plants’ CO2 Uptake. ACS Nano, 17(4), 3430-3441.

Full text: Click here

Publication 2023

Enzyme Assays Ribulose-Bisphosphate Carboxylase

Serological Assays for Virus Detection

ELISA and western blot analyses were carried out as previously described [41 (link)]. ELISA results were considered positive when the optical density (O.D.) values were at least 2.5 times the negative (healthy) control. The negative control O.D. range was 0.005–0.015. For western blot analyses, the leaf samples were compared at constant ratios of urea-SDS-β-mercaptoethanol lysis buffer and leaf weight. Accordingly, the increase in PepMV-IL in ToBRFV and PepMV-IL mixed infected plants was a quantitative comparison with PepMV-IL singly infected plants. The specific antisera prepared against purified virions of ToBRFV from Tm-2² allele-bearing tomato plants and PepMV-IL virions isolated on D. stramonium plants, as previously described [19 (link), 42 (link)], were used in the assays. Ponceau-S staining was conducted before or following the detection of the specific coat proteins, the latter identifying the viral coat proteins (CP) and RuBisCO on the membrane.

Matzrafi M., Abu-Nassar J., Klap C., Shtarkman M., Smith E, & Dombrovsky A. (2023). Solanum elaeagnifolium and S. rostratum as potential hosts of the tomato brown rugose fruit virus. PLOS ONE, 18(3), e0282441.

Full text: Click here

Publication 2023

2-Mercaptoethanol Alleles Biological Assay Buffers Capsid Proteins Enzyme-Linked Immunosorbent Assay Immune Sera Jimsonweed Lycopersicon esculentum Plant Leaves Plants ponceau S Proteins Ribulose-Bisphosphate Carboxylase Tissue, Membrane Urea Virion Vision Western Blot

Photosynthesis Stress Response Assessment

In a photosynthesis assessment
study, four droplets of a 5 μL Spd-loaded P[BiBEM-g-(PAA₅₀-b-PNIPAm₅₀)]₃₂₀ polymer bottlebrush (0.5 g L^–1 polymer concentration
with 0.18 g L^–1 loaded Spd) were applied to adaxial
surfaces of tomato leaves with 0.1 vol % Silwet L-77. Then, 0.5 g
L^–1 of unloaded bottlebrush, 0.18 g L^–1 of free Spd, and Milli-Q water (control) were also applied to tomato
leaves with 0.1 vol % Silwet L-77 using the same approach. The bottlebrushes
were allowed to interact with plant mesophyll cells for 24 h. Photosynthesis
measurements were performed on the polymer treated leaves.
The
carbon (carbon assimilation rate versus intercellular CO₂ concentration, A-Ci) and light response (carbon assimilation rate
versus photosynthetic active radiation, A-PAR) curves of treated leaves
were measured 24 h after treatments before stress conditions. The
gas chamber of Li-Cor was used to create a simultaneous heat and light
stress conditions (T = 40 °C, 2000 μmol m^–2 s^–1 PAR, RH = 40%) for 1.5 h. The carbon and light
response curves were measured again and compared with the curves acquired
before stress. A-Ci curves were performed at 1200, 1000, 800, 600,
400, 200, 100, 50, and 0 ppm of Ci at 40 °C under 2000 μmol
m^–2 s^–1 PAR light. The A-PAR curves
were acquired at 1200, 900, 600, 400, 300, 200, 100, 50, and 0 μmol
m^–2 s^–1 PAR at 40 °C, 400
ppm of Ci. Light-adapted (PhiPSII) chlorophyll fluorescent tests were
also performed before and after stress conditions. The A-Ci curves
were analyzed by fitting A and C_c to extract V_Cmax according to a previously reported model
for C₃ plants:^{43 (link)} where V_C_max is the maximum carboxylation rate, C_c is the CO₂ partial pressure in
Rubisco, Γ* is the photorespiratory compensation point, O is the partial pressure of oxygen, R_d is the mitochondrial respiration rate, K_C and K_O are Michaelis constants
of Rubisco for carbon dioxide and oxygen, respectively. The quantum
yield of CO₂ assimilation (PhiCO₂) was acquired
by calculating the slopes of A-PAR curves at 200, 100, 50, and 0 μmol
m^–2 s^–1 PAR.^{8 (link)}

Zhang Y., Fu L., Martinez M.R., Sun H., Nava V., Yan J., Ristroph K., Averick S.E., Marelli B., Giraldo J.P., Matyjaszewski K., Tilton R.D, & Lowry G.V. (2023). Temperature-Responsive Bottlebrush Polymers Deliver a Stress-Regulating Agent In Vivo for Prolonged Plant Heat Stress Mitigation. ACS Sustainable Chemistry & Engineering, 11(8), 3346-3358.

Full text: Click here

Publication 2023

Aftercare Carbon Carbon dioxide Chlorophyll Hartnup Disease Light Lycopersicon esculentum Mitochondria Oxygen Partial Pressure Photosynthesis Plant Cells Plants Polymers Radiation Respiratory Rate Ribulose-Bisphosphate Carboxylase silwet L-77 Stress Disorders, Traumatic

Modeling Daily Canopy CO2 Assimilation in Rice

DCaPS developed by Wu et al. (2018) (link) was used for simulating daily canopy CO₂ assimilation (from sunrise to sunset) of rice. A schematic diagram of this model is shown in Figure S2, and detailed information about model parameters and equations is provided in Tables S1–S3. Model inputs are composed of environment, canopy architecture, canopy nitrogen status, CO₂ diffusion, photosynthetic and temperature response parameters, which is listed in Table S3. Model outputs are diurnal environment variables, diurnal canopy photosynthesis. Environment parameters in the form of hourly values of incident solar radiation, air temperature (T_a, an approximate value for leaf temperature), and air vapour pressure deficit for one day were derived from daily values. The LAI_can was split into sunlit and shade fractions by a single-layer sunlit-shade leaves modeling approach as described by De Pury and Farquhar (1997) (link), and then the amount of photosynthetically active radiation including direct and diffuse solar radiation intercepted by each fraction was determined. Canopy nitrogen distribution (SLN_ave; nitrogen concentration per unit leaf area at the top of the canopy, SLN_top) was used to estimate daily nitrogen status for sunlit and shaded leaves followed by previous crop model (Hammer et al., 2010 (link)). The key photosynthetic parameters (the maximum carboxylation rate of Rubisco at 25°C, V_cmax25; maximum electron transport rate at 25°C, J_max25; mesophyll conductance at 25°C, g_m25) were used to derive the slope of linear relationship between V_cmaxper leaf area at 25°C and nitrogen (χ_v), and the slope of linear relationship between J_maxper leaf area at 25°C and nitrogen (χ_J). Alternatively, hourly values of CO₂ assimilate rate (minimum value of A_c and A_j, Figure S1) of sunlit and shaded leaves were determined after combining with nitrogen status, CO₂ diffusion models and temperature adjustment based on photosynthetic parameters following Wu et al. (2018) (link). Finally, A_can,day was determined from integration of CO₂ assimilation rate across leaf fractions and time. The AM_DAY was calculated as:
where 44 is the molecular weight of CO₂, 0.85 represents the dry matter distribution coefficient of the aboveground at tillering stage and flowering stage (dimensionless), and 0.41 was introduced as a conversion factor that accounts for the loss of CO₂ assimilation (g biomass g^-1 CO₂), as described by Sinclair and Horie (1989) (link).

Pan Y., Cao Y., Chai Y., Meng X., Wang M., Wang G, & Guo S. (2023). Identification of photosynthetic parameters for superior yield of two super hybrid rice varieties: A cross-scale study from leaf to canopy. Frontiers in Plant Science, 14, 1110257.

Full text: Click here

Publication 2023

Air Pressure Crop, Avian Diffusion Electron Transport factor A Nitrogen Oryza sativa Photosynthesis Plant Leaves Radiation Ribulose-Bisphosphate Carboxylase Solar Energy

Top products related to «Ribulose-Bisphosphate Carboxylase»

Li 6400 by LI COR

Sourced in United States

The LI-6400 is a portable photosynthesis system designed for measuring gas exchange in plants. It is capable of measuring net carbon dioxide and water vapor exchange, as well as environmental conditions such as temperature, humidity, and light levels.

Protease inhibitor cocktail by Merck Group

Sourced in United States, Germany, China, United Kingdom, Italy, Japan, Sao Tome and Principe, France, Canada, Macao, Switzerland, Spain, Australia, Israel, Hungary, Ireland, Denmark, Brazil, Poland, India, Mexico, Senegal, Netherlands, Singapore

The Protease Inhibitor Cocktail is a laboratory product designed to inhibit the activity of proteases, which are enzymes that can degrade proteins. It is a combination of various chemical compounds that work to prevent the breakdown of proteins in biological samples, allowing for more accurate analysis and preservation of protein integrity.

Li 6400xt by LI COR

Sourced in United States, Germany, United Kingdom

The LI-6400XT is a portable photosynthesis system designed for measuring gas exchange in plants. It is capable of measuring net photosynthesis, transpiration, stomatal conductance, and other physiological parameters. The system consists of a control unit and a leaf chamber that encloses a portion of a plant leaf.

Li 6800 by LI COR

Sourced in United States

The LI-6800 is a portable photosynthesis system designed for field research. It measures gas exchange and fluorescence parameters to study physiological responses in plants. The device features a temperature-controlled leaf chamber and can be used to analyze a variety of plant species and environmental conditions.

Supersignal west femto maximum sensitivity substrate by Thermo Fisher Scientific

Sourced in United States, Japan, United Kingdom, Germany, China, France, Australia, Switzerland, Canada, Denmark, Israel

SuperSignal West Femto Maximum Sensitivity Substrate is a chemiluminescent substrate used for the detection of proteins in Western blot analysis. It provides high sensitivity detection with a wide linear dynamic range.

Imagequant las 4000 by GE Healthcare

Sourced in United States, United Kingdom, Japan, Sweden, Germany, Australia, China, Canada, Spain, France, Switzerland, Belgium, Italy, Netherlands, New Zealand, Morocco

The ImageQuant LAS 4000 is a laboratory imaging system designed for the detection and quantification of radioisotope-labeled or chemiluminescent samples. The system utilizes a charge-coupled device (CCD) camera and high-performance optics to capture images of various types of gels, membranes, and other samples. The ImageQuant LAS 4000 provides researchers with a versatile and sensitive tool for a range of imaging applications.

Pvdf membrane by Merck Group

Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria

PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Immobilon p by Merck Group

Sourced in United States, Germany, United Kingdom, Japan, Ireland, Morocco, Switzerland, Sweden, France, Italy, Spain, China, Canada, Israel, Denmark

Immobilon-P is a polyvinylidene fluoride (PVDF) membrane designed for use in Western blotting applications. It provides a high-binding capacity for proteins and offers good mechanical strength and low background. The membrane is chemically stable and has a pore size of 0.45 μm.

Protease inhibitor cocktail by Roche

Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel

Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.

What is the significance of Ribulose-Bisphosphate Carboxylase (RuBisCO) in biology and agriculture?

Ribulose-Bisphosphate Carboxylase, also known as RuBisCO, is a critical enzyme in the carbon fixation process of photosynthesis. It catalyzes the initial step in CO2 assimilation, making it a key driver of plant growth and productivity. RuBisCO's central role in plant physiology has made it an important target for agricultural and biotechnological research, as optimizing its function can lead to improved crop yields and biomass production.

What are the different types or variants of RuBisCO, and how do they differ in their properties and applications?

RuBisCO comes in several different forms, each with unique characteristics. The most common is Form I, found in higher plants, green algae, and many bacteria. Form II is found in some chemoautotrophs and dinoflagellates, while Form III is present in certain archaea. These forms vary in their catalytic efficiency, CO2/O2 specificity, and thermal stability, making them suited for different environmental conditions and research applications.

What are some common challenges researchers face when working with Ribulose-Bisphosphate Carboxylase, and how can PubCompare.ai help address them?

One of the key challenges in RuBisCO research is identifying the most effective protocols and methods from the vast literature. Researchers must sift through numerous studies to find the optimal approach for their specific goals and experimental conditions. PubCompare.ai can help streamline this process by using AI-driven analysis to quickly compare protocols, highlight critical differences, and recommend the best options for reproducibility and accuracy. This saves researchers time and ensures they are using the most effective techniques for their Ribulose-Bisphosphate Carboxylase studies.

How can PubCompare.ai assist in optimizing the use of Ribulose-Bisphosphate Carboxylase in agricultural and biotechnological applications?

PubCompare.ai's AI-powered protocol comparisons can be invaluable for researchers working to optimize Ribulose-Bisphosphate Carboxylase in agricultural and biotechnology settings. By quickly identifying the most effective protocols for activities like enzyme purification, kinetic assays, and genetic engineering, the platform helps researchers maximize the efficiency and productivity of RuBisCO-based systems. This can lead to breakthroughs in crop yield enhancement, biofuel production, and other applications that rely on this crucial photosynthetic enzyme.

What are some unique or lesser-known applications of Ribulose-Bisphosphate Carboxylase that PubCompare.ai can help explore?

In addition to its well-known role in photosynthesis, Ribulose-Bisphosphate Carboxylase has been explored for more novel applications, such as carbon capture and utilization. Some researchers are investigating ways to harness RuBisCO's ability to fix CO2 for the production of valuable chemicals and fuels. PubCompare.ai can assist in this endeavor by helping identify the most effective protocols for RuBisCO engineering, immobilization, and optimization in non-photosynthetic systems. This can unlock new avenues for sustainable chemical production and atmospheric carbon mitigation using this versatile enzyme.

How does PubCompare.ai's AI-driven protocol comparison feature work, and how can it benefit Ribulose-Bisphosphate Carboxylase research specifically?

PubCompare.ai's AI-driven protocol comparison feature works by rapidly analyzing the methods and results reported across a large number of published studies. For Ribulose-Bisphosphate Carboxylase research, the platform can identify key differences in factors like enzyme source, purification techniques, kinetic assay conditions, and genetic engineering strategies. By highligghting these critical insights, PubCompare.ai empowers researchers to quickly select the most effective protocols and avoid repeating time-consuming optimization steps. This streamlines the research process and increases the chances of successful, reproducible results when working with this important photosynthetic enzyme.

More about "Ribulose-Bisphosphate Carboxylase"

Ribulose-Bisphosphate Carboxylase, also known as RuBisCO, is a crucial enzyme involved in the carbon fixation process of photosynthesis.
It catalyzes the carboxylation of ribulose-1,5-bisphosphate, which is the initial step in carbon dioxide assimilation.
This enzyme plays a critical role in plant growth and productivity, making it an important target for agricultural and biotechnological research.
RuBisCO is a complex enzyme that is composed of large and small subunits.
It is found in the chloroplasts of plants and some bacteria, where it helps convert carbon dioxide into organic compounds.
The efficiency of RuBisCO can be influenced by various factors, such as temperature, pH, and the availability of carbon dioxide and other substrates.
Researchers often use specialized equipment and techniques to study RuBisCO and its role in photosynthesis.
For example, the LI-6400 and LI-6800 are portable photosynthesis systems that can be used to measure gas exchange and other parameters related to RuBisCO activity.
Protease inhibitor cocktails can be used to prevent the degradation of RuBisCO during protein extraction and purification.
In addition, techniques such as Western blotting, using PVDF membranes and SuperSignal West Femto Maximum Sensitivity Substrate, can be employed to detect and quantify RuBisCO levels in plant samples.
ImageQuant LAS 4000 is a popular imaging system that can be used to analyze RuBisCO-related Western blots.
TRIzol reagent is commonly used to extract RNA, which can be used to study the expression of genes encoding RuBisCO subunits.
Overall, Ribulose-Bisphosphate Carboxylase is a fasinating enzyme that continues to be the focus of extensive research in the fields of plant biology, agricultural science, and biotechnology.