> Chemicals & Drugs > Amino Acid > SIRT1 protein, human

SIRT1 protein, human

Q: What is the SIRT1 protein and what are its key functions?

The SIRT1 protein is a member of the sirtuin family of NAD+-dependent protein deacetylases. It plays a crucial role in regulating cellular processes such as aging, apoptosis, and metabolism. SIRT1 has been implicated in the pathogenesis of various diseases, including neurodegenerative disorders, cancer, and metabolic syndrome.

SIRT1 protein is a member of the sirtuin family of NAD+-dependent protein deacetylases that play a key role in regulating cellular processes such as aging, apoptosis, and metabolism.
SIRT1 has been implicated in the pathogenesis of various diseases, including neurodegenerative disorders, cancer, and metabolic syndrome.
Researchers can leverage PubCompare.ai's AI-driven platform to enhance the reproducibility and accuracy of SIRT1 protein research by easily locating protocols from literature, preprints, and patents, and using AI-driven comparisons to identify the best protocols and products for their SIRT1 studies.
This user-friendly tool can help streamline the research process and improve the quality of SIRT1 protein-related findings.

Most cited protocols related to «SIRT1 protein, human»

Adenoviral Constructs for FoxO1, Sirt1, and Rab7

Cited 19 times

Adenoviruses harboring murine wildtype (WT) FoxO1 (Ad-FoxO1-WT), FoxO1(3A/LXXAA) (Ad-3A/LXXAA) 13 (link), Sirt1 (Ad-Sirt1) 8 (link), shRNA Sirt1 (Ad-sh-Sirt1) 10 (link), shRNA Scramble (Ad-sh-Scr)10 (link), GFP-LC3 (Ad-GFP-LC3) 2 (link), tandem fluorescent mRFP-GFP-LC3 14 (link) (Ad-tf-LC3) 15 , tTA (Ad-tTA) 16 (link), and LacZ (Ad-LacZ) 16 (link) have been described. Adenovirus harboring inducible p300 (Ad-p300) was purchased from Cell Biolabs. The plasmid constructs of hemagglutinin (HA) tagged human Rab7 (obtained from Missouri S&T cDNA Resource Center) and HA tagged WT FoxO3a (from Dr. Michael Greenberg) 17 (link) were used to generate adenoviruses Ad-HA-Rab7 and Ad-FoxO3-WT, respectively, using the Admax system (Microbix). Adenovirus harboring shRNA for FoxO1 (Ad-sh-FoxO1) was generated as previously described 2 (link) using the following hairpin forming oligo 5’ – CGCCAAACTCACTACACCATTTCAAGAGAATGGTGTAGTGAGTTTGGCTTTTTA – 3’. The hairpin loop sequence is underlined. Adenovirus harboring control scramble shRNA (Ad-sh-Scr) has been described. 10 (link) Lentivirus (Lt) harboring sh-Rab7 (Lt-sh-Rab7) was purchased from Open Biosystems. For knockdown studies, adenoviral and lentiviral transduction was carried out for 96 hours, while overexpression models involved 24 hours of adenoviral transduction.

Hariharan N., Maejima Y., Nakae J., Paik J., DePinho R.A, & Sadoshima J. (2010). Deacetylation of FoxO by Sirt1 plays an essential role in mediating starvation-induced autophagy in cardiac myocytes. Circulation research, 107(12), 1470-1482.

Publication 2010

Adenoviruses Adenovirus Vaccine Cells DNA, Complementary EP300 protein, human Hairpin Loop Sequence Hemagglutinin Homo sapiens LacZ Genes Lentivirus Mus Oligonucleotides Plasmids Short Hairpin RNA SIRT1 protein, human

Generation of SirT1 Conditional Knockout Mice

Cited 15 times

A previously described SirT1 targeting construct, KOII [23 (link)], was used to generate mice harboring a conditional targeted mutation in the SirT1 gene (SirT1^co/comice) (see Additional file 1). The breeding of SirT1^co/comice and CMV-Cre transgenic mice results in mice harboring a germline-transmitted deletion of exon 4 of the SirT1 gene (SirT1^+/komice). Both SirT1^co/comice and SirT1^+/comice were used to establish breeding colonies for generating SirT1^co/coand SirT1^ko/komice, respectively. Both SirT1^co/comice and SirT1^ko/komice were in a mixed 129SvJ/C57B6 background. Mice were housed in a special-pathogen-free facility and all procedures were approved by the University of Washington Animal Care and Use Committee. A PCR-based genotyping method was established to identify the wild-type, co, and ko loci of the SirT1 gene using three primers: 5' co primer, 5'-GGTTGACTTAGGTCTTGTCTG; 5' ko primer, 5'-AGGCGGATTTCTGAGTTCGA; 3' primer, 5'-CGTCCCTTGTAATGTTTCCC. Murine embryonic fibroblasts (MEFs) were isolated from the embryos between embryonic day 12.5 and embryonic day 14.5. The body weight was measured once a week.

Li H., Rajendran G.K., Liu N., Ware C., Rubin B.P, & Gu Y. (2007). SirT1 modulates the estrogen–insulin-like growth factor-1 signaling for postnatal development of mammary gland in mice. Breast Cancer Research, 9(1), R1.

Full text: Click here

Publication 2007

Animals Body Weight Deletion Mutation Embryo Exons Fibroblasts Genes, vif Genetic Loci Genotyping Techniques Germ Line Mice, Laboratory Mice, Transgenic Mus Mutagenesis, Site-Directed Oligonucleotide Primers Pathogenicity SIRT1 protein, human

SIRT1-SKIP Interaction Analysis

Cited 9 times

All cDNAs were made according to standard methods and verified by sequencing. The full-length SKIP cDNA was amplified by PCR from a HeLa cDNA library and was inserted into the 5′-XhoI and 3′-BamHI or 3′-BglII sites of each vector. Expression plasmids for the SIRT1 wild type and point mutant (SIRT1 HY) are described elsewhere (19 (link)). For yeast two-hybrid screening, the full-length SIRT1 cDNA was inserted into the bait plasmid pBTM116 (LexA DBD vector). SIRT1 deletion mutants were created by PCR amplification and were also subcloned into pBTM116. For transient transfections, the Flag-tagged SIRT1 or SKIP gene was placed in the pcDNA3 vector. For the localization assay, GFP-tagged recombinant constructs were created in pEGFP-C3 (BD Biosciences, Palo Alto, CA, USA), respectively. For GST-fused proteins, pGEX4T-1 (Amersham Pharmacia Biotech, Piscataway, NJ, USA) was used.

Kang M.R., Lee S.W., Um E., Kang H.T., Hwang E.S., Kim E.J, & Um S.J. (2009). Reciprocal roles of SIRT1 and SKIP in the regulation of RAR activity: implication in the retinoic acid-induced neuronal differentiation of P19 cells. Nucleic Acids Research, 38(3), 822-831.

Publication 2009

Biological Assay cDNA Library Cloning Vectors Deletion Mutation DNA, Complementary Genes HeLa Cells Hybrids Plasmids Proteins Saccharomyces cerevisiae SIRT1 protein, human Transfection Transients

Quantifying mRNA and Protein Expression

Cited 6 times

The expression of mRNA was quantified by real-time PCR using the TaqMan probes (Life Technologies) in an Applied Biosystems 7300 Real-Time PCR system. Data were analyzed with the SDS Version1.3 software (Applied Biosystems) and normalized to Rpl19 RNA. Western blot images were detected with the use of the LI-COR Odyssey scanner and the Image studio 3.1 software (Li-Cor Biosciences, Lincoln, NE). The antibodies were purchased from Cell Signaling Technology: PARP (#9542), Acetylated-Lysine (#9814), FoxO3a (#12829), Beclin-1 (#3738), ATG3 (#3415), ATG101 (#13492), BNIP3 (#12396), ATG7 (#8558), mTOR (#2983), p-mTOR-S2448 (#5536), and p-mTOR-S2481 (#2974). The antibodies were purchased from Abcam: LC3B (ab51520), p62 (ab91526), ATG14 (ab139727), and TFEB (ab122910). The antibodies were purchased from Santa Cruz Biotechnology: ATG5 (sc-515347), β-actin (sc-47778), PPAR-γ (sc-7196), and PPAR-α (sc-9000). SIRT1 (#07–131) antibody was purchased from Millipore. The monoclonal antibody against human G6Pase-α was raised in mice using a peptide containing amino acid residues 227 to 268 in luminal loop 3 of human G6Pase-α [40 (link)]. Antigen injection, hybridoma generation, and clone screening were performed by A&G Pharmaceutical, Inc. Hybridoma clones were screened using the enzyme-linked immunosorbent assay (ELISA) on the immunogen. The culture supernatant from a hybridoma clone (3A9) showing high sensitivity to the immunogen was subjected to affinity purification using the peptide coupled agarose. The specificity of the purified antibody was confirmed by ELISA.

Cho J.H., Kim G.Y., Pan C.J., Anduaga J., Choi E.J., Mansfield B.C, & Chou J.Y. (2017). Downregulation of SIRT1 signaling underlies hepatic autophagy impairment in glycogen storage disease type Ia. PLoS Genetics, 13(5), e1006819.

Full text: Click here

Publication 2017

Actins Amino Acids Antibodies Antibody Specificity Antigens BECN1 protein, human Chromatography, Affinity Clone Cells Enzyme-Linked Immunosorbent Assay FRAP1 protein, human Homo sapiens Hybridomas Hypersensitivity Immunoglobulins Lysine Monoclonal Antibodies Mus Peptides Peroxisome Proliferator-Activated Receptors Pharmaceutical Preparations Phenobarbital PPAR gamma Real-Time Polymerase Chain Reaction RNA, Messenger Sepharose SIRT1 protein, human TFEB protein, human Western Blotting

SIRT1 Regulation of Endothelial Cells

Cited 5 times

Endothelial cells were freshly isolated from human umbilical cord veins as previously described [13] (link) and cultured in M200 medium. Cells between the third and the sixth passages were grown in monolayers in a humidified atmosphere of 5% CO₂ at 37°C, and used for experiments at >80% confluence. Replication-defective adenoviral vectors expressing SIRT1 (Ad-SIRT1) or control green fluorescentprotein (Ad-GFP) were prepared using the AdEasy vector kit (Quantum Biotechnologies) in according to the manufacturer's instructions. The adenovirus-mediated knockdown of SIRT1 (Ad-SIRT1 RNAi) and control vector (Ad-U6) were generated using the same system. The SIRT1 RNAi sequence was reported previously [21] (link). HUVECs were infected with the above adenovirus for 24 h and were cultured in fresh M200 for further treatment. PMA, Ionomycin, cyclosporin A, resveratrol, sirtinol, NFAT inhibitor, and NF-κB inhibitor JSH-23 were purchased from Sigma-Aldrich.

Jia Y.Y., Lu J., Huang Y., Liu G., Gao P., Wan Y.Z., Zhang R., Zhang Z.Q., Yang R.F., Tang X., Xu J., Wang X., Chen H.Z, & Liu D.P. (2014). The Involvement of NFAT Transcriptional Activity Suppression in SIRT1-Mediated Inhibition of COX-2 Expression Induced by PMA/Ionomycin. PLoS ONE, 9(5), e97999.

Full text: Click here

Publication 2014

Adenoviruses Adenovirus Vaccine Atmosphere Cells Cloning Vectors Cone-Rod Dystrophy 2 Culture Media Cyclosporine DNA Replication Endothelial Cells Homo sapiens I-kappa B Proteins Ionomycin JSH 23 M-200 Resveratrol RNA Interference SIRT1 protein, human sirtinol Umbilical Cord Umbilical Vein Veins

Most recents protocols related to «SIRT1 protein, human»

Cloning and Mutagenesis of CDC42 and Related Constructs

Flag-CDC42 was created by cloning human CDC42 protein ORF (GenBank: NM_001039802.2) into a pCDH-Flag vector using EcoRI and NotI restriction sites. Point mutations of CDC42 were generated by using the KOD-plus-mutagenesis Kit (#SMK101, TOYOBO). GST-CDC42 was generated by cloning human CDC42 ORF (GenBank: NM_001039802.2) into a pGEX-4T-1 vector using BamHI and NotI restriction sites. HA-PAK4 and HA-PAK1 were constructed by cloning human PAK4 protein ORF (GenBank: NM_001014831.3) or PAK1 protein ORF (GenBank: NM_001128620.2) into a pKH3-HA vector using HindIII and XbaI restriction sites. Myc-Gcn5, HA-PCAF, HA-Tip60, HA-ACAT1, HA-SIRT2 and HA-SIRT1 were gifts from Prof. Shi-Min Zhao (School of Life Sciences and Institutes of Biomedical Sciences, Fudan University, Shanghai, China). HA-CBP and HA-p300 were gifts from Prof. Jian-Xiu Yu (Shanghai Jiao Tong University School of Medicine, China). V5-HDAC3, V5-HDAC6, V5-HDAC10, shRNA-CDC42 and shRNA-SIRT2 were purchased from DNA library (Shanghai Jiao Tong University School of Medicine, China).

Wang D.N., Ni J.J., Li J.H., Gao Y.Q., Ni F.J., Zhang Z.Z., Fang J.Y., Lu J, & Yao Y.F. (2023). Bacterial infection promotes tumorigenesis of colorectal cancer via regulating CDC42 acetylation. PLOS Pathogens, 19(2), e1011189.

Full text: Click here

Publication 2023

CDC42 protein, human Cloning Vectors Deoxyribonuclease EcoRI DNA Library EP300 protein, human Gifts HDAC10 protein, human KAT5 protein, human Mutagenesis PAK1 protein, human PAK4 protein, human Point Mutation Proteins Short Hairpin RNA SIRT1 protein, human SIRT2 protein, human

Lentiviral Overexpression of Key Epigenetic Regulators

Lentivirus overexpressing mouse IKKβ, METTL3, METTL14, KAT2A, KAT2B, SIRT1, SIRT2, SIRT6, SIRT7, Spi2a, FTO or DERPINA3F, and human IKKβ, METTL14, KAT2B, SOCS1 or SERPINA3 were generated via cloning the coding region of mouse Ikkβ [NM_001159774.1], Mettl3 [NM_019721.2], Mettl14 [NM_201638.2], Kat2a [NM_020004.5], Kat2b [NM_020005.4], Sirt1 [NM_019812.3], Sirt2 [NM_022432.4], Sirt6 [NM_181586.4], Sirt7 [NM_153056.3], Spi2a [NM_009251.2], Fto [NM_011936.2], Serpina3f [NM_001168294.1] cDNA or human METTL14 [NM_020961.4], SOCS1 [NM_003745.1], IKKβ [NM_001556.3], KAT2B [NM_003884.5], SERPINA3 [NM_001085.5] cDNA into pLV[Exp]-Neo-EF1A lentiviral vector (VectorBuilder). Next, using these vectors as templates, an HA tag was added in the N-terminal of Kat2b, Spi2a, SERPINA3; a Flag tag was added in the N-terminal of Kat2a; a His tag was added in the N-terminal of Mettl14, Ikkβ, and IKKβ. Site-specific mutation of METTL14 and METTL3 was constructed by a QuickChange Site-Directed Mutagenesis Kit (Agilent) based on the manufacturer’s protocols. Packaging plasmids and lenti-vector were co-transfected into HEK293T cells. 48 h after transfection, lentivirus was collected from the cell culture medium and added into macrophages with 4 µg/ml polybrenes. The fragment bearing m⁶A site in the cDNA of Spi2a was subcloned to the downstream of Luc gene of luciferase reporter vector pGL3-Promoter (Promega, Cat#: 200517) to generate the pGL3-Spi2a plasmid. pGL3-Spi2a-Mut was generated by mutating the m⁶A motif sequence 5’GAACC3’ to 5’GATCC3’ in pGL3-Spi2a plasmid using the Mutagenesis Kit above. All of the mutations were confirmed by DNA sequencing. Primers were listed in Supplementary Table 1.

Wang X., Ding Y., Li R., Zhang R., Ge X., Gao R., Wang M., Huang Y., Zhang F., Zhao B., Liao W, & Du J. (2023). N6-methyladenosine of Spi2a attenuates inflammation and sepsis-associated myocardial dysfunction in mice. Nature Communications, 14, 1185.

Full text: Click here

Publication 2023

Cell Culture Techniques Cells Cloning Vectors Culture Media DNA, Complementary Genes, Reporter Homo sapiens IkappaB Kinase beta Lentivirus Luciferases Macrophage METTL3 protein, human METTL14 protein, human Mice, Laboratory Mutagenesis Mutagenesis, Site-Directed Mutation Oligonucleotide Primers Paragangliomas 3 Plasmids Promega SIRT1 protein, human SIRT2 protein, human sirtuin 6 protein, human Transfection

SIRT1 and GRP78 Protein Detection

The paraffin-embedded sections were dewaxed, rehydrated, and blocked using 5% goat serum albumin for 1 h. They were then incubated overnight at 4°C with anti-SIRT1 (1 : 1000, Abcam) and anti-GRP78 (1 : 300, Proteintech) primary antibodies, followed by incubation with Alexa Fluor-488 secondary antibody (1 : 500, Invitrogen) and DAPI. The images were visualized on a fluorescent microscope, and the mean fluorescence intensity was analyzed in each field.

Luo Y., Zhao Y., Lai J., Wei L., Zhou G., Yu Y, & Liu J. (2023). Resveratrol Suppresses Bupivacaine-Induced Spinal Neurotoxicity in Rats by Inhibiting Endoplasmic Reticulum Stress via SIRT1 Modulation. BioMed Research International, 2023, 1176232.

Full text: Click here

Publication 2023

alexa fluor 488 Antibodies DAPI Fluorescence Glucose Regulated Protein 78 kDa Goat Immunoglobulins Microscopy Paraffin Serum Albumin SIRT1 protein, human

Mammalian Vectors for FBXO7 and SIRT7

Mammalian expression vectors for FLAG-tagged human wildtype FBXO7 isoform-1 and its F-box deleting mutant were provided by Dr H.J. Kuiken (The Netherlands Cancer Institute). The mammalian expression vector for V5/His-tagged human wildtype SIRT7 was provided by Dr K.Y. Choi (Pohang University of Science and Technology). Plasmids encoding FLAG-tagged SIRT2, SIRT3, SIRT4, and SIRT7 were kindly provided by H.S. Kim (Ewha Womans University). Plasmids encoding FLAG-tagged SIRT1, SIRT5, and SIRT6 were provided by Y.J. Oh (Yonsei University). All plasmid sequences were verified using DNA sequencing (Bionics). siRNAs for FBXO7, SIRT7, and CUL1, and control scrambled siRNA (catalog no.: 51-01-14-04) were designed and synthesized by Integrated DNA Technologies (Hanam-si). FBXO7-specific siRNA duplex sequences were 5′-UUGGUUCUCCUCUAGAUUGAAGU(dTdT)-3′ (sense) and 5′-ACUUCAAUCUAGAGGAGAACCAA(dTdT)-3′ (antisense). SIRT7-specific siRNA duplex sequences were 5′-GUGUGAACUUUAUAGAAU(dTdT)-3′ (sense) and 5′-AGAGAGGAUUCUAUAAAG(dTdT)-3′ (antisense). The CUL1-specific siRNA duplex sequences were 5′-CAGGUUUACCUUCAUGAAAGCACAC(dTdT)-3′ (sense) and 5′-GUGUGCUUUCAUGAAGGUAAACCUGAA(dTdT)-3′ (antisense).

Lee S.H., Lee Y.J., Jung S, & Chung K.C. (2023). E3 ligase adaptor FBXO7 contributes to ubiquitination and proteasomal degradation of SIRT7 and promotes cell death in response to hydrogen peroxide. The Journal of Biological Chemistry, 299(3), 102909.

Full text: Click here

Publication 2023

Cloning Vectors CUL1 protein, human Homo sapiens Malignant Neoplasms Mammals Plasmids Protein Isoforms RNA, Small Interfering SIRT1 protein, human SIRT2 protein, human Sirtuin 3 sirtuin 6 protein, human

Protein Expression Analysis in Muscle Cells

After 48-h treatment, the total protein of gastrocnemius samples and C2C12 myotubes were isolated by RIPA (Beyotime Biotechnology, Haimen, China). Sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was conducted, and the protein was transferred to polyvinylidene fluoride membranes (BioSharp, Tallinn, Estonia). After being blocked, the membranes were incubated with primary and secondary antibody, successively. Finally, an ECL Kit (Sangon Biotech, Shanghai, China) was used for the detection of protein bands. The antibodies were purchased from Abcam (Cambridge, UK), including p-adenosine 5’-monophosphate-activated protein kinase (AMPK; 1:1,000 and 1:2,000), silent information regulator factor 2-related enzyme 1 (SIRT1) (1:2,000), hypoxia-inducible factor-1α (HIF-1α; 1:500), p-phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K; 1:2,000 and 1:1,000), p-protein kinase B (AKT; 1:2,000 and 1:1,000), cleaved caspase-3 (C-caspase 3) (1:1,000), B-cell lymphoma-2 (Bcl2, 1:1,000), GAPDH (1:5,000), and goat anti-rabbit immunoglobin G (IgG; H + L) horseradish peroxidase antibody (1:10,000).

Xiao M., Guo W., Zhang C., Zhu Y., Li Z., Shao C., Jiang J., Yang Z., Zhang J, & Lin L. (2023). Jian Pi Sheng Sui Gao (JPSSG) alleviation of skeletal myoblast cell apoptosis, oxidative stress, and mitochondrial dysfunction to improve cancer-related fatigue in an AMPK-SIRT1- and HIF-1-dependent manner. Annals of Translational Medicine, 11(3), 156.

Publication 2023

Adenosine Monophosphate anti-IgG Antibodies B-Cell Lymphomas BCL2 protein, human Caspase 3 Enzymes GAPDH protein, human Goat HIF1A protein, human Horseradish Peroxidase Immunoglobulins Muscle, Gastrocnemius OCA2 protein, human Phosphatidylinositol 3-Kinases Phosphatidylinositols Phosphotransferases polyvinylidene fluoride Proteins Rabbits Radioimmunoprecipitation Assay SDS-PAGE SIRT1 protein, human SIRT2 protein, human Skeletal Myocytes Tissue, Membrane

Top products related to «SIRT1 protein, human»

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Pvdf membrane by Merck Group

Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria

PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.

Sirt1 by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Japan

SIRT1 is a nicotinamide adenine dinucleotide (NAD+)-dependent protein deacetylase enzyme. It plays a key role in the regulation of cellular processes by deacetylating target proteins.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Bca protein assay kit by Beyotime

Sourced in China, United States, Germany, Puerto Rico, United Kingdom, Switzerland, Japan, Sweden

The BCA protein assay kit is a colorimetric-based method for the quantitative determination of total protein concentration in a sample. It uses bicinchoninic acid (BCA) to detect and quantify the presence of protein.

Sirt1 by Abcam

Sourced in United States, United Kingdom, China

SIRT1 is a nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylase enzyme. It plays a role in the regulation of cellular processes such as apoptosis, senescence, and metabolism.

Sirt1 by Santa Cruz Biotechnology

Sourced in United States, China, United Kingdom, Canada

SIRT1 is a nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylase enzyme. It regulates various cellular processes, including gene expression, metabolism, and stress response, by deacetylating target proteins.

Ripa lysis buffer by Beyotime

Sourced in China, United States, Switzerland, Germany, Japan, United Kingdom

RIPA lysis buffer is a detergent-based buffer solution designed for the extraction and solubilization of proteins from cells and tissues. It contains a mixture of ionic and non-ionic detergents that disrupt cell membranes and solubilize cellular proteins. The buffer also includes additional components that help to maintain the stability and activity of the extracted proteins.

Bca protein assay kit by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Japan, Belgium, France, Switzerland, Italy, Canada, Australia, Sweden, Spain, Israel, Lithuania, Netherlands, Denmark, Finland, India, Singapore

The BCA Protein Assay Kit is a colorimetric detection and quantification method for total protein concentration. It utilizes bicinchoninic acid (BCA) for the colorimetric detection and quantification of total protein. The assay is based on the reduction of Cu2+ to Cu1+ by protein in an alkaline medium, with the chelation of BCA with the Cu1+ ion resulting in a purple-colored reaction product that exhibits a strong absorbance at 562 nm, which is proportional to the amount of protein present in the sample.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

What is the SIRT1 protein and what are its key functions?

How can PubCompare.ai help with SIRT1 protein research?

PubCompare.ai's AI-driven platform can help enhance the reproducibility and accuracy of SIRT1 protein research in several ways: 1. It allows you to screen protocol literature more efficiently by helping you easily locate protocols from literature, preprints, and patents. 2. The platform's AI-driven analysis can help you identify the most effective protocols related to SIRT1 protein, human for your specific research goals. Its AI-driven comparisons can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy. 3. This user-friendly tool can help streamline the research process and improve the quality of SIRT1 protein-related findings by assisting researchers in identifying the most suitable protocols and products for their SIRT1 studies.

What are some common applications of the SIRT1 protein?

The SIRT1 protein has a wide range of applications in various fields of research and medicine. Some of the key applications include: 1. Aging and longevity studies: SIRT1 plays a crucial role in regulating the aging process, making it a target for research on extending lifespan and healthspan. 2. Metabolic disease research: SIRT1 is involved in the regulation of metabolism, making it a potential therapeutic target for conditions such as obesity, type 2 diabetes, and metabolic syndrome. 3. Neurodegeneration studies: SIRT1 has been implicated in the pathogenesis of neurodegenerative disorders, such as Alzheimer's disease and Parkinson's disease, opening up new avenues for neuroprotective interventions. 4. Cancer research: SIRT1 has been shown to play a role in the development and progression of various cancers, making it a potential target for cancer therapeutics.

Are there different variations or types of the SIRT1 protein?

Yes, there are different variations or isoforms of the SIRT1 protein. While the core SIRT1 protein structure is highly conserved, some species and cell types may express different splice variants or post-translationally modified forms of SIRT1. These variations can exhibit slightly different functional characteristics or subcellular localization patterns. Reserchers should be aware of these differencies when selecting the appropriate SIRT1 protein for their specific studies.

What are some common challenges in working with the SIRT1 protein, and how can PubCompare.ai help?

Some common challenges in working with the SIRT1 protein include: 1. Identifying the most effective protocols and products: With a vast amount of literature and products available, it can be difficult for researchers to determine the most suitable protocols and reagents for their SIRT1 protein studies. 2. Ensuring reproducibility and accuracy: Variations in experimental conditions, reagents, and protocols can lead to inconsistent results, making it challenging to reproduce findings and draw reliable conclusions. 3. Staying up-to-date with the latest research: The field of SIRT1 protein research is rapidly evolving, and it can be time-consuming for researchers to stay informed about the latest developments. PubCompare.ai can help address these challenges by: 1. Allowing researchers to efficiently screen protocol literature and identify the most effective protocols related to SIRT1 protein, human for their specific research goals. 2. Leveraging AI-driven comparisons to highlight key differences in protocol effectiveness, enabling researchers to choose the best option for reproducibility and accuracy. 3. Providing a user-friendly platform that helps streamline the research process and improve the quality of SIRT1 protein-related findings.

Can you provide an example of how PubCompare.ai can be used to optimize SIRT1 protein research?

Sure, let me give you an example: Suppose a researcher is studying the role of SIRT1 protein in regulating metabolism and wants to identify the most effective protocol for measuring SIRT1 activity. They can use PubCompare.ai to search for and compare various SIRT1 activity assay protocols from the literature, preprints, and patents. The platform's AI-driven analysis can help the researcher identify the key differences between the protocols, such as sensitivity, specificity, and reproducibility. This information can then be used to select the most suitable protocol for their research, ensuring that they obtain accurate and reliable results. Additionally, PubCompare.ai can help the researcher stay up-to-date with the latest developments in SIRT1 protein research by providing curated insights and recommendations, saving them time and improving the overall quality of their work.

More about "SIRT1 protein, human"

The SIRT1 (Sirtuin 1) protein is a member of the sirtuin family of NAD+-dependent protein deacetylases.
These enzymes play a crucial role in regulating various cellular processes, including aging, apoptosis (programmed cell death), and metabolism.
SIRT1 has been implicated in the pathogenesis of numerous diseases, such as neurodegenerative disorders, cancer, and metabolic syndrome.
Researchers can leverage the AI-driven platform of PubCompare.ai to enhance the reproducibility and accuracy of their SIRT1 protein research.
This user-friendly tool allows researchers to easily locate protocols from literature, preprints, and patents, and then use AI-driven comparisons to identify the best protocols and products for their SIRT1 studies.
This can help streamline the research process and improve the quality of SIRT1 protein-related findings.
When conducting SIRT1 protein research, researchers may utilize various techniques and reagents, such as Lipofectamine 2000 for transfection, PVDF (polyvinylidene fluoride) membranes for Western blotting, fetal bovine serum (FBS) for cell culture, BCA (bicinchoninic acid) protein assay kit for protein quantification, RIPA (radioimmunoprecipitation assay) lysis buffer for protein extraction, and TRIzol reagent for RNA extraction.
By combining these tools with the insights from PubCompare.ai's AI-driven platform, researchers can enhance the reproducibility and accuracy of their SIRT1 protein-related studies, leading to more reliable and impactful findings.