Antibodies used were specific for ATPase subunit α and β (Invitrogen Molecular Probes), monoclonal and polyclonal acetyllysine (Cell Signaling Technology), SIRT3 (as described3 (link)), ETF and LCAD (generously provided by Jerry Vockley, University of Pittsburgh). Oxidation of [1-14C] palmitic acid by tissue homogenate was adapted from a previously established method26 (link). Briefly, tissue was homogenized in sucrose/Tris/EDTA buffer, and was incubated for 30–60 min in the reaction mixture (pH 8.0), containing [1-14C] palmitic acid, and measured for acid-soluble metabolites (ASM) and trapped CO2. Enzymatic activity for LCAD was measured using the anaerobic electron transfer flavoprotein (ETF) fluorescence reduction assay27 (link) using 2, 6-dimethyheptanoyl-CoA as a substrate in recombinant LCAD expressed and purified from HEK293T cells with wild-type or catalytically inactive SIRT3, or in E. coli in the absence (Control) or presence of nicotinamide (NAM, 50 mM)28 (link).
>
Chemicals & Drugs
>
Amino Acid
>
Sirtuin 3
Sirtuin 3
Sirtuin 3 is a member of the sirtuin family of NAD+-dependent protein deacetylases.
It is primarily localized in the mitochondria and plays a crucial role in regulating cellular metabolism, energy homeostasis, and various stress response pathways.
Sirtuin 3 has been implicated in a wide range of biological processes, including the regulation of oxidative phosphorylation, fatty acid oxidation, and amino acid metabolism.
It has also been associated with the modulation of mitochondrial biogenesis, apoptosis, and the response to caloric restriction.
Sirtuin 3 has emerged as a potential therapeutic target for a variety of metabolic and age-related disorders, making it an area of active research and clinical investigation.
It is primarily localized in the mitochondria and plays a crucial role in regulating cellular metabolism, energy homeostasis, and various stress response pathways.
Sirtuin 3 has been implicated in a wide range of biological processes, including the regulation of oxidative phosphorylation, fatty acid oxidation, and amino acid metabolism.
It has also been associated with the modulation of mitochondrial biogenesis, apoptosis, and the response to caloric restriction.
Sirtuin 3 has emerged as a potential therapeutic target for a variety of metabolic and age-related disorders, making it an area of active research and clinical investigation.
Most cited protocols related to «Sirtuin 3»
Acids
Adenosine Triphosphatases
Antibodies
Cells
Edetic Acid
Electron Transfer Flavoprotein
enzyme activity
Escherichia coli
Fluorescence
Molecular Probes
Niacinamide
Palmitic Acid
Protein Subunits
Sirtuin 3
Sucrose
Tissues
Tromethamine
Acids
Adenosine Triphosphatases
Antibodies
Cells
Edetic Acid
Electron Transfer Flavoprotein
enzyme activity
Escherichia coli
Fluorescence
Molecular Probes
Niacinamide
Palmitic Acid
Protein Subunits
Sirtuin 3
Sucrose
Tissues
Tromethamine
Antibodies, Anti-Idiotypic
Biological Assay
Buffers
Coenzyme I
Dithiothreitol
Magnesium Chloride
Niacinamide
Nitrocellulose
Peptides
SIRT3 protein, human
Sirtuin 3
SKP2 protein, human
Sodium Chloride
Tissue, Membrane
Tromethamine
Sirt3 floxed (Sirt3L2/L2) mice were generated using standard gene targeting procedures26 (link). These animals were crossed with liver-specific Cre-expressing mice (Alb-Cre)18 (link) to obtain the Sirt3hep−/− mouse line; or with the skeletal muscle-specific Cre-expressing line (HSA-Cre)17 (link) to obtain the Sirt3skm−/− line. These two mouse lines were backcrossed onto a pure C57BL/6J background. All animal work in the manuscript has been performed according to the validated standard operating procedures (SOPs)23 (link), as defined and validated by the Eumorphia program (see: http://empress.har.mrc.ac.uk/ ). Briefly, we subjected our mice to non-invasive monitoring of body fat and lean mass by EchoMRI; energy expenditure analysis by indirect calorimetry (CLAMS system); intraperitoneal glucose tolerance test (ipGTT); insulin tolerance test (ipITT); blood sampling before and after a 24 fast; endurance exercise on a treadmill; non-invasive blood pressure measurement; and cold test. A summary of these methods is given in the supplementary materials and methods section. Animal experiments were approved by the ethic veterinary committee of the canton of Vaud - Switzerland (Permit IDs 2307 and 2307-1).
Animals
Body Fat
Calorimetry, Indirect
Clams
Cold Temperature
Determination, Blood Pressure
Energy Metabolism
Ethics Committees
Glucose Tolerance Test
Immune Tolerance
Insulin
Liver
Mice, Laboratory
Sirtuin 3
Skeletal Muscles
Anti-Antibodies
Horseradish Peroxidase
Immunoglobulins
Rabbits
Sirtuin 3
SOD2 protein, human
Most recents protocols related to «Sirtuin 3»
First, we treated the NPCs with DHJSD (300 μg/mL) for 24 h before administrating IL-1β to investigate the effect of DHJSD on NPCs. After that, we pretreated NPCs with DHJSD (300 μg/mL) alone or combined with cyclosporin A (1 μM) for 24 h before IL-1β administration. To explore how miR-494 affected NPCs, we designed a miR-494 inhibitor and mimic and their negative control and synthesized them through GenePharma (Shanghai, China). They were then transfected into NPCs using lipofectamine 2000 before IL-1β administration. To knock down SIRT 3 expression, scrambled siRNA (siScr) and short interfering (si) RNA targeting SIRT 3 (si-sirt3) were designed and bought from GenePharma (Shanghai, China). The NPCs were co-transfected by adopting miR-494 suppressor (150 nM) and si-sirt3 (100 nM) for 48 h using lipofectamine 2000. Finally, NPCs were either treated with DHJSD alone or pretransfected with miR-494 mimic (50 nM) or si-sirt3 (100 nM) for 24 h to explore the role of mir-494/SIRT 3/mitophagy signal axis on DHJSD activity.
Full text: Click here
Cyclosporine
Epistropheus
Interleukin-1 beta
lipofectamine 2000
Mitophagy
RNA, Small Interfering
Sirtuin 3
The RNA of NPCs was extracted by applying the TRIzol reagent (Invitrogen) based on the manufacturer’s instructions. The RNA content was determined at a wavelength of 260 nm using a spectrometer. Reverse transcription of 1 μg total RNA was used for synthesizing cDNA, and a reaction volume of 10 μL (4.5 μL diluted cDNA, 0.25 μL primers and 5 μL 2 × SYBR Master Mix) was used for PCR amplification. The cycle threshold was recorded. The target gene expression level was normalized to the GAPDH level, and the miR-494 level was normalized to that of U6. The expression of SIRT 3 and miR-494 was calculated using the 2−ΔΔCt approach. The primers employed are provided in Table 1 .
List of primers employed in RT-PCR
| Name | Primer | Sequence | Size |
|---|---|---|---|
| Homo GAPDH | Forward | 5′- TCAAGAAGGTGGTGAAGCAGG -3′ | 115 bp |
| Reverse | 5′- TCAAAGGTGGAGGAGTGGGT -3′ | ||
| Homo SIRT3 | Forward | 5’- CTTACTAGAGTGCGGCGGT-3’ | 220 bp |
| Reverse | 5’- ACAGGTCCACTCATCTTCGT-3’ | ||
| U6 | Forward | 5 ‘- CGCTTCGGCAGCACATATAC -3’ | |
| Reverse | 5 ‘- AAATATGGAACGCTTCACGA -3’ | ||
| hsa-miR-494 | Forward | 5 ‘-TGCGCAGGTTGTCCGTGTTGTCT-3 ‘ | |
| Reverse | 5′- CCAGTGCAGGGTCCGAGGTATT-3′ |
Full text: Click here
DNA, Complementary
GAPDH protein, human
Gene Expression
Homo
Oligonucleotide Primers
Reverse Transcription
Sirtuin 3
trizol
Mitochondrial, cytoplasmic and total proteins were extracted, and the corresponding kit (Beyotime) was used to detect the content. Thereafter, 25 µg of protein was subjected to sodium dodecylsulfate-polyacrylamide gel electrophoresis. The protein was transferred to a polyvinylidene fluoride film (Millipore, Billerica, Massachusetts, USA) using a semidry method. The polyvinylidene fluoride film was soaked in TBST containing 5% skimmed milk powder and sealed with a shaker for 2 h at room temperature. The blots were incubated overnight, with the primary antibodies diluted from 1:500 to 1:1000. The antibodies were used against the proteins listed below: Parkin (ab77924), PINK1 (ab23707), Bax (ab32503), Bcl-2 (ab32124), Cyt-c (ab110325), Collagen II (ab34712), Adamts5(ab41037) (Abcam, Cambridge, UK); P62 (#5114), LC3 (#2775), SIRT3 (#2627S), GAPDH (#5174), Caspase-3 (#9662) and Cleaved-Caspase-3 (#9664) (Cell Signaling Technology; Danvers, Massachusetts, USA); VDAC1 (sc-32063) (Santa Cruz Biotechnology; Dallas, Texas, USA); Aggrecan (13880-1-AP) and MMP3 (17873-1-AP) (Wuhan Sanying, Wuhan, China). After rinsing the film, the proper secondary antibody was incubated through the blot for 1 h at 25 °C. The film’s gray values were analyzed after darkroom exposure using Image J software v1.46 (NIH, Bethesda, MD, USA).
Full text: Click here
Aggrecans
Antibodies
BCL2 protein, human
CASP3 protein, human
Collagen
Cytoplasm
GAPDH protein, human
Immunoglobulins
Milk, Cow's
Mitochondria
MMP3 protein, human
PARK2 protein, human
polyvinylidene fluoride
Powder
Proteins
SDS-PAGE
Sirtuin 3
VDAC1 protein, human
The bioinformatics algorithms and related databases were used to search for the potential targets for miR-494. SIRT 3 was confirmed to have an assumed binding site on miR-494. Wild-type (WT) and mutant (MUT) 3′-UTR fragments containing the assumed miR-494 binding site were amplified and inserted into the pGL3 vector (RiboBio). HEK 293 cells were seeded in a 6-well plate, grown in an incubator at 37 °C for 24 h with 5% CO2 and then co-transfected with 100 ng of pGL3 vector harboring MUT 3′-UTR or WT and 40 nM of miR-Scr or miR-494 mimic employing transfection reagent, lipofectamine 2000. The cells were harvested in 48 h to detect luciferase activity through a dual luciferase reporter assay kit (Promega, Madison, Wisconsin, USA).
Full text: Click here
Binding Sites
Biological Assay
Cells
Cloning Vectors
HEK293 Cells
lipofectamine 2000
Luciferases
Paragangliomas 3
Promega
Sirtuin 3
Transfection
Protocol full text hidden due to copyright restrictions
Open the protocol to access the free full text link
Acetylcysteine
Actins
Adenosine Triphosphatases
Animals
Antibodies
Antioxidants
Autophagosome
Autophagy
bafilomycin A1
Bone Marrow
CDKN1A protein, human
CDKN2A Gene
Female Castrations
Females
Femur
Fluorescein-5-isothiocyanate
Genistein
Goat
leptin receptor, human
Lysosomes
Mus
Operative Surgical Procedures
Ovary
Oxidative Stress
PARK2 protein, human
Penicillins
PPARGC1A protein, human
Protoplasm
Rabbits
Rats, Sprague-Dawley
Rattus norvegicus
Sirtuin 3
Streptomycin
Tibia
Vacuolar H+-ATPase
Top products related to «Sirtuin 3»
Sourced in United States, United Kingdom
SIRT3 is a lab equipment product manufactured by Cell Signaling Technology. It is a nicotinamide adenine dinucleotide (NAD+)-dependent deacetylase enzyme that regulates mitochondrial protein acetylation and activity.
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
Sourced in United States, United Kingdom, China
Anti-SIRT3 is a primary antibody that specifically binds to the SIRT3 protein. SIRT3 is a member of the sirtuin family of NAD-dependent deacylases.
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, Sweden, Netherlands, Switzerland, Italy, Belgium, Australia, France, India, Ireland
β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is an important component of the microfilament system and is involved in various cellular processes such as cell motility, structure, and integrity.
Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Switzerland, Denmark, Belgium, Italy, Australia, Singapore, Spain, Colombia, Sweden, Netherlands, New Zealand, Poland, Pakistan, Lithuania
Lipofectamine RNAiMAX is a transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and short hairpin RNA (shRNA) into a wide range of cell types. It is a cationic lipid-based formulation that facilitates the uptake of these nucleic acids into the target cells.
Sourced in China, United States, Germany, Puerto Rico, United Kingdom, Switzerland, Japan, Sweden
The BCA protein assay kit is a colorimetric-based method for the quantitative determination of total protein concentration in a sample. It uses bicinchoninic acid (BCA) to detect and quantify the presence of protein.
Sourced in United States, United Kingdom, China, Germany, Canada, Morocco, Japan, Italy, Switzerland, France, Israel, Singapore, Hong Kong, Sweden, Macao, Panama
β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is a component of the microfilament system and plays a crucial role in various cellular processes, such as cell motility, maintenance of cell shape, and intracellular trafficking.
More about "Sirtuin 3"
Sirtuin 3 (SIRT3), a member of the sirtuin family of NAD+-dependent protein deacetylases, is a crucial player in regulating cellular metabolism, energy homeostasis, and various stress response pathways.
This mitochondrial protein is known for its pivotal role in modulating oxidative phosphorylation, fatty acid oxidation, and amino acid metabolism.
Sirtuin 3 has been implicated in a wide range of biological processes, including the regulation of mitochondrial biogenesis, apoptosis, and the response to caloric restriction.
Its importance has made it a subject of active research and clinical investigation, with potential therapeutic applications in metabolic and age-related disorders.
When studying Sirtuin 3, researchers often utilize various tools and techniques, such as Lipofectamine 2000 for transfection, Anti-SIRT3 antibodies for detection, TRIzol reagent for RNA extraction, and FBS for cell culture.
Additionally, protein analysis may involve the use of PVDF membranes, β-actin as a loading control, and BCA protein assay kits for quantification.
Lipofectamine RNAiMAX is another transfection reagent that can be employed for Sirtuin 3 research.
By understanding the key roles and functions of Sirtuin 3, as well as the commonly used research tools and techniques, scientists can optimize their investigations and unlock new insights into this dynamic and multifaceted protein.
This mitochondrial protein is known for its pivotal role in modulating oxidative phosphorylation, fatty acid oxidation, and amino acid metabolism.
Sirtuin 3 has been implicated in a wide range of biological processes, including the regulation of mitochondrial biogenesis, apoptosis, and the response to caloric restriction.
Its importance has made it a subject of active research and clinical investigation, with potential therapeutic applications in metabolic and age-related disorders.
When studying Sirtuin 3, researchers often utilize various tools and techniques, such as Lipofectamine 2000 for transfection, Anti-SIRT3 antibodies for detection, TRIzol reagent for RNA extraction, and FBS for cell culture.
Additionally, protein analysis may involve the use of PVDF membranes, β-actin as a loading control, and BCA protein assay kits for quantification.
Lipofectamine RNAiMAX is another transfection reagent that can be employed for Sirtuin 3 research.
By understanding the key roles and functions of Sirtuin 3, as well as the commonly used research tools and techniques, scientists can optimize their investigations and unlock new insights into this dynamic and multifaceted protein.