Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > STC1 protein, human

STC1 protein, human

STC1 (Stanniocalcin 1) is a glycoprotein hormone that plays a role in calcium and phosphate homeostasis.
It is expressed in various tissues and has been implicated in diverse physiological processes, including bone metabolism, renal function, and cardiovascular regulation.
STC1 has emerged as a potential therapeutic target in conditions such as osteoporosis, chronic kidney disease, and cardiovascular disease.
Researchers studying STC1 can leverage the AI-driven platform PubCompare.ai to optimize their research by identifying the most effective protocols and products from the literature, preprints, and patents, enhancing reproducibility and accuracy.
This powerful tool utilizes artificial intelligence to help researchers locate the best methods and products for their STC1 studies.

Most cited protocols related to «STC1 protein, human»

1
Whole-Mount In Situ Hybridization in Zebrafish
Cited 20 times
Whole-mount in situ hybridization of zebrafish embryos was performed as previously described [24 (link)]. The expression patterns of cdh17, clck, cyp26a1, evi1, gata3, mhc, myoD, nbc1, pax2a, pdzk1, raldh2, ret1, sall1, sglt1, slc4a2, slc20a1a, wt1a, and wt1b were previously reported [14 (link),24 (link),29 (link),37 (link),55 (link),56 (link),61 (link),82 (link)–86 (link)]. For antisense probe production, we used the following IMAGE clone template plasmids, restriction enzymes for DNA linearization, and RNA enzymes: mafb: 7995399, pExpress-1, EcoR1, T7; rfx2, pBK-CMV, template was PCR amplified using primers GTGAATTGTAATACGACTCACTATAGGG and TTAACCCTCACTAAAGGGAACAAA, T7; slc9a3: 6996791, pExpress-1, EcoRI, T7; slc26a2: 4760214, pBK-CMV, EcoRI, T7; slc13a1: 6793065, EcoRV, t7; slc13a3: 4744276, pCMV-sport6.1ccdb, EcoRI, T7; slc22a6: 4744276, pBK-CMV, SalI, T7; slc12a1: pBK-CMV, EcoRI, T7; slc12a3: 7037010, pExpress-1, EcoRI, T7; stc1 was amplified from 24 hpf embryo cDNA using primers ATGCTCCTGAAAAGCGGATTT and TTAAGGACTTCCCACGATGGA and cloned into pGemTEasy, NcoI, Sp6.
Wingert R.A., Selleck R., Yu J., Song H.D., Chen Z., Song A., Zhou Y., Thisse B., Thisse C., McMahon A.P, & Davidson A.J. (2007). The cdx Genes and Retinoic Acid Control the Positioning and Segmentation of the Zebrafish Pronephros. PLoS Genetics, 3(10), e189.
Full text: Click here
Publication 2007
ALDH1A2 protein, human CDH17 protein, human Cytochrome P450 26A1 Enzyme Deoxyribonuclease EcoRI DNA, Complementary DNA Restriction Enzymes Embryo Enzymes GATA3 protein, human In Situ Hybridization MAFB protein, human myelodysplasia syndrome 1 protein, human Oligonucleotide Primers Plasmids SLC5A1 protein, human STC1 protein, human Zebrafish
2
RNA Isolation and Real-time PCR Analysis of Gut Hormone Expression
Cited 6 times
After the normoxia or IH treatment, total RNA was isolated from Caco-2 and STC-1 cells with an RNeasy Protect Cell Mini Kit (Qiagen, Hilden, Germany), as described previously [4 (link),20 (link),21 (link),22 (link)]. The isolated RNA was reversetranscribed to the cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) for real-time PCR, as described previously [4 (link),20 (link),23 (link),24 (link)]. The mRNA levels of PYY, GLP-1, and NTS were measured by real-time RT-PCR. All the primers used for real-time RT-PCR were synthesized by Nihon Gene Research Laboratories, Inc. (NGRL; Sendai, Japan) and described in Table 1.
Real-time PCR was performed by the KAPA SYBR® Fast qPCR Master Mix (Kapa Biosystems, Boston, MA, USA) and the Thermal Cycler Dice Real Time System (Takara, Kusatsu, Japan), as described previously [4 (link),20 (link),22 (link),25 (link),26 (link)]. PCR was performed with an initial step of 3 min at 95 °C followed by 45 cycles of 3 s at 95 °C and 20 s at 66 °C for hPYY, mPyy, hGLP-1, and mGlp-1, and was conducted with an initial step of 3 min at 95 °C followed by 45 cycles of 3 s at 95 °C and 20 s at 60 °C for hNTS, mNts, β-actin, and Rig/RpS15. Target cDNAs were cloned into pBluescript SK(-) plasmid (Stratagene, La Jolla, CA, USA), and sequential 10-fold dilutions from 102~107 copies/µL were prepared. The serial dilutions were run to verify the specificity and to test the sensitivity of the SYBR Green-based real-time RT-PCR. The respective mRNA levels were normalized by those of the β-actin mRNA for human, by those of Rig/RpS15 mRNA for mouse mRNAs, and the miR levels were normalized by U6 RNA level as an internal standard [4 (link),20 (link),22 (link),25 (link),26 (link),27 (link),28 (link),29 (link)].
Shobatake R., Itaya-Hironaka A., Yamauchi A., Makino M., Sakuramoto-Tsuchida S., Uchiyama T., Ota H., Takahashi N., Ueno S., Sugie K, & Takasawa S. (2019). Intermittent Hypoxia Up-Regulates Gene Expressions of Peptide YY (PYY), Glucagon-like Peptide-1 (GLP-1), and Neurotensin (NTS) in Enteroendocrine Cells. International Journal of Molecular Sciences, 20(8), 1849.
Full text: Click here
Publication 2019
Actins Cells DNA, Complementary Genes Glucagon-Like Peptide 1 Homo sapiens Hypersensitivity Mus Oligonucleotide Primers Plasmids Real-Time Polymerase Chain Reaction Reverse Transcription RNA, Messenger STC1 protein, human SYBR Green I Technique, Dilution U6 small nuclear RNA
3
Epigenetic Regulation of Colony Cycles in Clonal Ants
Cited 5 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2016
Ants Brain Clone Cells Eggs Freezing Genotype hydrogen sulfite KMT2B protein, human Larva Light Precipitating Factors Reproduction STC1 protein, human Workers
4
Isolation and Purification of Intestinal Cell Populations
Cited 5 times
Animal procedures were approved by the local ethics committee and conformed to United Kingdom Home Office regulations. GLU-Venus and GIP-Venus mice (2–6 months of age) (13 (link), 14 (link)), maintained on a C57BL6 background, were killed by cervical dislocation and the gut was collected into ice-cold Leibovitz-15 (L-15) medium (Sigma, Poole, UK); all chemicals were supplied by the same manufacturer unless otherwise stated). Upper SI (10 cm of gut immediately distal to the stomach), lower SI (10 cm proximal to the cecum) or colon (tissue distal to the ileocolic junction), were opened longitudinally and rinsed in PBS. For purification of cell populations by FACS, but not FACS analysis, intestinal pieces were then stripped of the outer muscle layers. Tissue was chopped into 1- to 2-mm pieces and digested to single cells with 1 mg/ml collagenase in calcium-free Hanks' buffered salt solution (HBSS). Pancreatic islets from GLU-Venus mice were prepared by injecting the pancreas with 0.5 mg/ml collagenase type V in HBSS. Tissue was incubated for 15 min at 37 C and mechanically disrupted by shaking. Islets were hand picked into HBSS containing 10 mm glucose and 0.1% BSA, incubated at 37 C for 1 min in 0.1 × trypsin, and triturated to obtain a single cell suspension, after which fetal bovine serum was added to a final concentration of 10%. Samples were separated immediately by flow cytometry, as described below.
Single cell suspensions were separated by flow cytometry using a MoFlo Beckman Coulter Cytomation sorter (Coulter Corp., Hialeah, FL). Side scatter, forward scatter, and pulse-width gates were used to exclude debris and aggregates and Venus-positive cells were collected at approximately 95% purity, alongside negative (control) cells that comprised a mixed population dominated by other epithelial cell types (13 (link)). In islet sorts, α-cells were identified by their Venus fluorescence, and β-cells were identified by their lack of Venus fluorescence and high-side scatter, as described previously (13 (link)). L- and islet cell populations were collected from GLU-Venus mice and K-cells were collected from GIP-Venus mice. Cells were sorted into lysis buffer for mRNA extraction. Total RNA from FACS-sorted cells were isolated using a microscale RNA isolation kit (Applied Biosystems, Warrington, UK). RNA from GLUTag and STC-1 cells was extracted using a standard TRI Reagent protocol.
Habib A.M., Richards P., Cairns L.S., Rogers G.J., Bannon C.A., Parker H.E., Morley T.C., Yeo G.S., Reimann F, & Gribble F.M. (2012). Overlap of Endocrine Hormone Expression in the Mouse Intestine Revealed by Transcriptional Profiling and Flow Cytometry. Endocrinology, 153(7), 3054-3065.
Publication 2012
Animals Bladder Detrusor Muscle Buffers Calcium Cecum Cells Cold Temperature Collagenase Colon Epithelial Cells Fetal Bovine Serum Flow Cytometry Fluorescence Glucose Intestines Islets of Langerhans isolation Joint Dislocations MMP9 protein, human Mus Neck Pancreas Population Group PRSS1 protein, human Pulse Rate Regional Ethics Committees RNA, Messenger Sodium Chloride STC1 protein, human Stomach Tissues
5
Genetic Modifications of S. pombe Strains
Cited 5 times
For S. pombe strains, see Table S1. Deletion and epitope tagging (3xFLAG or GFP) of Stc1 were achieved by homologous recombination with PCR fragments comprising resistance cassettes flanked by sequence homologous to insertion sites (Bähler et al., 1998 (link)). LIM domain mutations were generated with Quickchange II XL Kit (Stratagene) and integrated by replacement of stc1:ura4+. The Clr4-GBD tethering system was described previously (Kagansky et al., 2009 (link)). For pDUAL-TetR-2xFLAG-Stc1, stc1+ was cloned into a modified pDUAL-HFF81c vector (Matsuyama et al., 2004 (link)), made by swapping His to TetRoff (Promega), so that Stc1 was N-terminally tagged with TetRoff followed by 2xFLAG, under the nmt81 promoter. Not1-digested plasmid was integrated at leu1+. For the 4xTetO-ade6+ reporter, 4xTetO repeats (TCCCTATCAGTGATAGAGA) were introduced upstream of ade6+ inserted at the ura4+ locus via the strategy described previously for 3xgbs-ade6+ (Kagansky et al., 2009 (link)).
Bayne E.H., White S.A., Kagansky A., Bijos D.A., Sanchez-Pulido L., Hoe K.L., Kim D.U., Park H.O., Ponting C.P., Rappsilber J, & Allshire R.C. (2010). Stc1: A Critical Link between RNAi and Chromatin Modification Required for Heterochromatin Integrity. Cell, 140(5), 666-677.
Full text: Click here
Publication 2010
Cloning Vectors Deletion Mutation Epitopes Homologous Recombination Mutation Plasmids Promega Schizosaccharomyces pombe STC1 protein, human Strains

Most recents protocols related to «STC1 protein, human»

1
Isolation and Characterization of Umbilical Cord-Derived MSCs
Following informed consent of the mother, we isolated MSC from the umbilical cord tissue of a term, healthy infant under current good manufacturing practice (cGMP) conditions based on a protocol we previously described.15 (link) Briefly, we dissociated the disinfected, mechanically disrupted umbilical cord tissue using DNAse (F. Hoffmann-La Roche), hyaluronidase (Riemser Pharma) and collagenase (Nordmark Arzneimittel) and cultured so-obtained cells for two passages on membrane-based culture systems (Corning) in humidified, hypoxic (5% O2, 5% CO2) atmospheres to maintain their potency and avoid onset of cellular senescence during cell production.16 (link) GMP-compliant Dulbecco’s low glucose Modified Eagle Medium (Thermo Fisher) supplemented with 10% platelet-rich plasma17 (link) was used as culture medium. We froze down the cell product at 8 × 106 cells per mL in 90% human serum albumin, (50 mg/mL solution; Baxter, Deerfield, IL, USA) and 10% dimethyl sulfoxide (WAK-Chemie) in a fixed-rate freezer for storage in the vapor phase of liquid nitrogen.
Characterization of the MSC product (Table 1) as per ISCT consensus criteria18 (link) was performed using freshly thawed, once-rinsed passage 2 cells prepared in exactly the same way as for injection. Flow cytometry, analyses of colony formation and tri-lineage differentiation potential were performed as previously described.19 (link) We confirmed immunomodulatory potency of the employed cells by successful induction of indoleamine 2,3-dioxygenase (IDO) transcription upon 24 hours of stimulation20 (link) with 10 ng/mL interferon-γ (R&D Systems), using a validated IDO primer assay (QuantiTect, Qiagen). To analyze secretion of stanniocalcin-1 (R&D Systems) and FGF-10 (Abbexa), both suggested to mediate MSC’s effects in the (newborn) lung,3 (link),21 (link),22 (link) we obtained 24-hour, cell-free conditioned medium as described.19 (link)
Möbius M.A., Seidner S.R., McCurnin D.C., Menschner L., Fürböter-Behnert I., Schönfeld J., Marzahn J., Freund D., Münch N., Hering S., Mustafa S.B., Anzueto D.G., Winter L.A., Blanco C.L., Hanes M.A., Rüdiger M, & Thébaud B. (2023). Prophylactic Administration of Mesenchymal Stromal Cells Does Not Prevent Arrested Lung Development in Extremely Premature-Born Non-Human Primates. Stem Cells Translational Medicine, 12(2), 97-111.
Publication 2023
Atmosphere Biological Assay Blood Platelets Cells Cellular Senescence Collagenase Culture Media Culture Media, Conditioned Deoxyribonucleases Dioxygenases Eagle FGF10 protein, human Flow Cytometry Freezing Glucose Hyaluronidase Hypoxia Immunomodulation Infant, Newborn Interferon Type II Lung Mothers Nitrogen Oligonucleotide Primers secretion Serum Albumin, Human STC1 protein, human Sulfoxide, Dimethyl Tissue, Membrane Tissues Transcription, Genetic Umbilical Cord
2
Quantitative RT-PCR for Gene Expression Analysis
Quantitative real-time PCR (qRT-PCR) was used for the confirmation of microarray
data and for quantifying the expression level of Nr4a3 in HUVECs. Briefly,
first-strand cDNA was generated from RNA samples by a 20 μL mixture containing
SuperScript™ III RT (Invitrogen, Bleiswijk, the Netherlands), RNase Out
inhibitor (40 units; Invitrogen) and 250 ng random hexamers (Promega, Leiden,
the Netherlands). 10 ng of cDNA was used for each PCR reaction. Assays were
performed on a ViiA 7 real-time PCR System (Applied Biosystems, Nieuwerkerk aan
den IJssel, The Netherlands) using the absolute QPCR Rox Mix (Thermo Fischer
Scientific). Samples were normalized with ΔCt method using GAPDH as a reference.
Fold change in gene expression versus control was analyzed by the
2−ΔΔCt method.13 (link) Rat GAPDH (assay ID
Rn01775763_g1), Nars (assay ID Rn01491242_m1), Mars (assay ID Rn01504657_m1),
Yars (assay ID Rn01749701_m1), Gars (assay ID Rn01410234_m1), Iars (assay ID
Rn01450644_m1), Bcl2 (assay ID Rn99999125_m1), Nqo1 (assay ID Rn00566528_m1),
Nqo1 (assay ID Rn00566528_m1), NR4A3 (assay ID Rn01534012_m1), Gpd1 (assay ID
Rn00573596_m1), Stc1 (assay ID Rn00579636_m1) and Tsc22d3 (assay ID
Rn00580222_m1) were purchased as Assay-on-Demand from Applied Biosystems
(Nieuwekerk a/d IJssel, the Netherlands).
Li Y., Faiz A., Moshage H., Schilling L, & Kamps J.A. (2023). Responses of retinal and brain microvasculature to streptozotocin induced diabetes revealed by global expression profiling. Diabetes & Vascular Disease Research, 20(1), 14791641221147533.
Full text: Click here
Publication 2023
BCL2 protein, human Biological Assay DNA, Complementary Endoribonucleases GAPDH protein, human GART protein, human Gene Expression NAD(P)H dehydrogenase (quinone) 1, human NR4A3 protein, human Promega Real-Time Polymerase Chain Reaction STC1 protein, human TSC22D3 protein, human
3
Isolation of C. orbiculare Protoplasts
C. orbiculare protoplasts were prepared as previously described (Kubo, 1991 (link); Rodriguez and Yoder, 1987 (link); Vollmer and Yanofsky, 1986 (link)) with modifications. A frozen glycerol stock of C. orbiculare was streaked on 3.9% (w/v) potato dextrose agar (PDA) medium (Nissui) in a 90 mm dish and incubated at 25°C in the dark for 3 days. Outer edges of a colony were transferred to 20 ml of 2.4% (w/v) potato dextrose broth (BD Biosciences) and incubated for 2 days at 25°C in the dark. The proliferated mycelium was collected using a 70 µm cell strainer (Corning) and incubated in 150 ml of potato-sucrose liquid medium supplemented with 0.2% yeast extract (BD Biosciences) at 25°C with shaking at 140 rpm. The mycelium was harvested, washed with sterile water, and resuspended in 20 ml of filter-sterilized (0.2 µm pore size, GE Healthcare) osmotic medium (1.2 M MgSO4 and 5 mM Na2HPO4) containing 10 mg/ml driselase from Basidiomycetes sp. (Sigma-Aldrich) and 10 mg/ml lysing enzyme from Trichoderma harzianum (Sigma-Aldrich) in a 50 ml tube (Falcon, Corning). The suspension was gently agitated in a rotary shaker at 60 rpm for 90 min at 30°C. Then, the suspension was underlaid with 20 ml of trapping buffer (0.6 M sorbitol, 50 mM Tris-HCl pH 8.0, and 50 mM CaCl2) and centrifuged at 760 × g for 5 min using a swinging-bucket rotor (Hitachi, T4SS31). Protoplasts isolated from the interface of the two layers were pelleted, washed twice using STC (1 M sorbitol, 50 mM Tris-HCl pH 8.0, and 50 mM CaCl2), resuspended in STC at 108–109 protoplasts/ml, added to a 25% volume of polyethylene glycol (PEG) solution (40% [w/w] PEG3350, 500 mM KCl, 40 mM Tris-HCl pH 8.0, and 50 mM CaCl2), and stored at −80°C until use.
Chen M., Kumakura N., Saito H., Muller R., Nishimoto M., Mito M., Gan P., Ingolia N.T., Shirasu K., Ito T., Shichino Y, & Iwasaki S. (2023). A parasitic fungus employs mutated eIF4A to survive on rocaglate-synthesizing Aglaia plants. eLife, 12, e81302.
Full text: Click here
Publication 2023
Agar Basidiomycota Buffers Cells driselase Enzymes Freezing Glucose Glycerin Hyperostosis, Diffuse Idiopathic Skeletal Mycelium Osmosis polyethylene glycol 3350 Polyethylene Glycols Protoplasts Solanum tuberosum Sorbitol STC1 protein, human Sterility, Reproductive Sucrose Sulfate, Magnesium Trichoderma harzianum Tromethamine Yeasts
4
Photovoltaic System for Hospital Rooftops
Based on the significant amount of radiation in Tehran and also the average suitable temperature, it is reasonable to use photovoltaic panels. For every 10 square meters, it is possible to extract one kilowatt of electricity (Gökçek, 2018 ). Due to the limited space of the hospital and considering that this clinic has 2 buildings, the total area of ​​the roofs of these four buildings is about 200 square meters. Therefore, there is a maximum possibility of extracting 20 kW of electricity. The model used in this research is sharp ND-250QCS. The cost of purchasing this equipment is 1300 $, the cost of replacing is also 1300 $ and the cost of repairing and maintaining is 10 $ per year. The lifespan of this equipment is equal to 20 years.
In order to simulate the operation of photovoltaic panels the equations which are related to this component is employed. HOMER software uses Eq.3 to calculate the output power of photovoltaic panels. (Singh et al., 2017 ) PPV=YPVfPVGTGT.STC1+αPTC-TC.STC where YPV is the rated capacity of photovoltaic panels, fPV belongs to the derating factor, GT is the solar radiation incident, GT.STC is related to solar radiation incident under standard test condition (STC) of photovoltaic panels, αP is the temperature coefficient of PVs which is available in the data sheet of solar panels, TC is the temperature which PVs are working in and TC.STC is equal to the temperature of standard test condition of the photovoltaic panels. As shown in Eq.3 the temperature also affect the efficiency of solar panels, in this case Eq.4 is utilized to determine the effects of temperature on cells. (Mandal et al., 2018 ) ατGT=ULTC-Ta+ηCGT where α is equal to the solar absorption of the photovoltaic panels, τ is related to the solar transmittance of PVs which belong to the cover that is over them, UL is the coefficient of heat transfer, Ta is the ambient temperature which is available from the data in Fig. 8 and ηc belongs to the electrical efficiency of the solar panels.
Hossein Jahangir M., Eslamnezhad S, & Kargarzadeh A. (2023). Designing reliable energy hubs for healthcare centers during the Corona pandemic using hybrid optimization methods and deep analysis. Cleaner Materials, 7, 100178.
Publication 2023
Electricity Radiation Solar Energy STC1 protein, human
5
Colorectal Cancer Tissue Collection and Analysis
Fresh tissues were collected from the resected tissues of four patients with colorectal cancer, preferably 10 mm × 8 mm × 6 mm in size. Excess fluid, such as blood, was aspirated using dust-free paper (Kimtech, Cat#: 0131-10, Texas, USA) to ensure that as many tissues as possible were of no liquid residue. The prepared tissues were put into the mold (Leica, Cat#:14702218313, 6mm×8mm, Hesse, Germany) after marking the direction from epithelial layer to serosal layer using forceps. A little pre-cooled OCT (pre-cooled at four °C for ≥30 min; Sakura, Cat#: 4583, CA, USA) was then injected into the mold to thoroughly cover the tissue. Finally, the embedded tissue was transferred to a -80°C freezer for storage.
We collected resected tissues from 45 CRC patients in the Second Affiliated Hospital of Chongqing Medical University. Immunohistochemical staining of PRL5, HLA-A, STC1, AKR1B1, and CD47 expression was performed on tumor tissue sections. The study was approved by the ethical review board of the Second Affiliated Hospital of Chongqing Medical University (Chongqing China; Project identification code: 2019.133) and all patients signed informed written consent.
Liu H.T., Chen S.Y., Peng L.L., Zhong L., Zhou L., Liao S.Q., Chen Z.J., Wang Q.L., He S, & Zhou Z.H. (2023). Spatially resolved transcriptomics revealed local invasion-related genes in colorectal cancer. Frontiers in Oncology, 13, 1089090.
Full text: Click here
Publication 2023
AKR1B1 protein, human BLOOD CD47 protein, human Edema Ethical Review Forceps Fungus, Filamentous Neoplasms Patients Serous Membrane STC1 protein, human Tissues

Top products related to «STC1 protein, human»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
3
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
4
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
5
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
6
Lysing enzyme by Merck Group
Sourced in United States, Sao Tome and Principe
Lysing enzyme is a product designed for cell lysis, a process used to break down the cell membrane and release the cellular contents. It is a complex mixture of enzymes that can effectively disrupt various types of cells, including bacterial, plant, and animal cells. The core function of lysing enzyme is to facilitate the extraction and isolation of biomolecules, such as proteins, nucleic acids, and organelles, from the cellular environment.
7
Polybrene by Merck Group
Sourced in United States, Germany, China, Sao Tome and Principe, United Kingdom, Macao, Canada, France, Japan, Switzerland, Italy, Australia, Netherlands, Morocco, Israel, Ireland, Belgium, Denmark, Norway
Polybrene is a cationic polymer used as a transfection reagent in cell biology research. It facilitates the introduction of genetic material into cells by enhancing the efficiency of DNA or RNA uptake.
8
Primescript rt reagent kit by Takara Bio
Sourced in Japan, China, United States, France, Germany, Switzerland, Canada, Sweden, Italy, Puerto Rico, Singapore
The PrimeScript RT reagent kit is a reverse transcription kit designed for the synthesis of first-strand cDNA from RNA templates. The kit includes RNase-free reagents and enzymes necessary for the reverse transcription process.
9
Sc 30183 by Santa Cruz Biotechnology
Sourced in United States
Sc-30183 is a laboratory equipment product from Santa Cruz Biotechnology. It is designed for conducting scientific experiments and research. The core function of this product is to facilitate the handling and processing of samples in a laboratory setting. No further details about the intended use or specifications of this product can be provided in an unbiased and factual manner.
10
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.

More about "STC1 protein, human"

Stanniocalcin-1 (STC1) is a glycoprotein hormone that plays a crucial role in calcium and phosphate homeostasis.
This important protein is expressed in various tissues and has been implicated in diverse physiological processes, including bone metabolism, renal function, and cardiovascular regulation.
As a potential therapeutic target, STC1 has garnered significant attention in the treatment of conditions such as osteoporosis, chronic kidney disease, and cardiovascular disease.
Researchers studying STC1 can leverage the power of PubCompare.ai, an AI-driven platform, to optimize their research efforts.
This innovative tool utilizes artificial intelligence to help researchers identify the most effective protocols and products from the literature, preprints, and patents, enhancing the reproducibility and accuracy of their STC1 studies.
To further enhance their STC1 research, researchers may also consider utilizing a variety of laboratory reagents and techniques.
For example, the TRIzol reagent can be used for efficient RNA extraction, while cell culture media like DMEM supplemented with FBS can provide a suitable environment for STC1 experiments.
Transfection reagents such as Lipofectamine 2000 or Lipofectamine 3000 can facilitate the introduction of genetic material into cells to study STC1 expression and function.
Additionally, the RNeasy Mini Kit can be employed for high-quality RNA purification, and Lysing enzyme can be used to disrupt cell membranes for efficient protein extraction.
Polybrene may be utilized to enhance the efficiency of viral transduction, and the PrimeScript RT reagent kit can be employed for reverse transcription and cDNA synthesis.
By leveraging the insights from PubCompare.ai, along with the use of these specialized reagents and techniques, researchers can enhance the reproducibility, accuracy, and overall effectiveness of their STC1 investigations, ultimately contributing to a deeper understanding of this important protein and its role in health and disease.