Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Superoxide Dismutase

Superoxide Dismutase

Superoxide Dismutase (SOD) is a crucial enzyme that catalyzes the dismutation of superoxide radicals into oxygen and hydrogen peroxide, protecting cells from oxidative damage.
This metalloenzyme plays a vital role in antioxidant defense mechanisms across a variety of organisms, including humans.
SOD isoforms exist in different cellular compartments, each with unique metal cofactors and functions.
Reserach on SOD is critical for understanding its involvement in various pathological conditions and developing therapeutic strategies to modulate its activity.
PubCompare.ai's innovative AI-driven platform can enhance the reproducibility and accuracy of SOD research by helping scientists easily locate the best protocols from literature, preprints, and patents, as well as identify the optimal experimental methods and products to streamline their scientific investigations.

Most cited protocols related to «Superoxide Dismutase»

1
Enzymatic Analyses of Antioxidant Activities
Cited 20 times
For enzyme extracts and assays, fresh roots (0.1 g) were ground in liquid nitrogen, and then suspended in 0.9 mL solution containing 10 mM phosphate buffer (pH 7.4). The homogenate was centrifuged at 4°C, 2500 rpm for 10 min and the resulting supernatant was collected for determination of the activities of superoxide dismutase (SOD, EC 1.15.1.1), catalase (CAT, EC 1.11.1.6), peroxidase (POD, EC 1.11.1.7) and glutathione peroxidase (GSH-Px, EC 1.11.1.9) using commercial assay kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). All enzymes above were detected using a microplate reader (SpectraMax M5, USA), and 5 to 10 seedlings were used to provide enough amounts of root tissues in each experimental replicate (n = 3).
The activity of SOD was determined by measuring the inhibiting rate of the enzyme to O2−· produced by the xanthine morpholine with xanthine oxidase using the SOD assay kit. Each endpoint assay was detected the red substances of the reaction system by absorbance at 550 nm after 40 min of reaction time at 37°C. And one unit SOD activity (U) was defined as the quantity of SOD required to produce 50% inhibition of reduction of nitrite in 1 mL reaction solution by measuring the change of absorbance at 550 nm.
The CAT activity was measured based on the hydrolysis reaction of hydrogen peroxide (H2O2) with CAT, which could be terminated by molybdenum acid (MA) to produce yellow MA-H2O2 complex. CAT activity was calculated by the decrease in absorbance at 405 nm due to the degradation of H2O2, and one unit is defined as the amount of enzyme that will cause the decompose of 1 µmol hydrogen peroxide (H2O2) per second at 37°C in 1.0 g fresh tissue according to CAT assay kit.
The POD activity was measured based on the change of absorbance at 420 nm by catalyzing H2O2. One unit was defined as the amount of enzyme which was catalyzed and generated 1 µg substrate by 1.0 g fresh tissues in the reaction system at 37°C. POD activity was calculated as the formula according to POD assay kit.
The GSH-Px activity was also measured using the assay kit based on the principle that oxidation of glutathione (GSH) and hydrogen peroxide (H2O2) could be catalyzed by GSH-Px to produce oxidized glutathione (GSSG) and H2O. In addition GSH reacts with 5, 5′-dithiobis (2-nitrobenzoic acid) (DTNB) to produce stable yellow substances and the decrease of GSH at 412 nm during the reaction is indicative of GSH-Px activity in tissues. One GSH-Px unit of GSH-Px activity (U) was calculated as the amounts of enzyme that will oxidize 1 µmol/L GSH in reaction system at 37°C per minute in 1.0 g fresh tissue according to the assay kit. All of the enzymes were expressed as in U/g FW.
Li H.X., Xiao Y., Cao L.L., Yan X., Li C., Shi H.Y., Wang J.W, & Ye Y.H. (2013). Cerebroside C Increases Tolerance to Chilling Injury and Alters Lipid Composition in Wheat Roots. PLoS ONE, 8(9), e73380.
Full text: Click here
Publication 2013
Acids Biological Assay Buffers Cardiac Arrest Catalase DNA Replication Enzymes G-substrate Glutathione Disulfide Hydrolysis Molybdenum morpholine Nitrites Nitrogen Peroxidase Peroxidase, Glutathione Peroxide, Hydrogen Phosphates Plant Roots Psychological Inhibition Seedlings Superoxide Dismutase Tissues Xanthine Xanthine Oxidase
2
Mitochondrial H2O2 Production Assay
Cited 17 times
Fill a cuvette with the incubation buffer (item 2, Subheading 2, see Note 13), add magnetic stirring bar, turn on the stirrer, and wait until the cuvette reaches the desired temperature (25–37°C). Add 4 U/ml of horseradish peroxidase, 10 μM Amplex Red Ultra, 40 U/ml superoxide dismutase (optional, see Note 12) and the same amount of mitochondria as used in step 3.3 to build the calibration curve. Record the fluorescence for ~150 s. Add respiratory substrates (see Note 6) and record H2O2 emission.
To illustrate a typical experimental protocol, Fig. 2 presents recordings of H2O2 production by isolated mouse brain mitochondria oxidizing NAD+-dependent substrates or succinate. The H2O2 generation is triggered by the addition of a respiratory substrate (succinate, Fig. 2a or pyruvate and malate, Fig. 2b, see Note 14). With NAD+-dependent substrates, H2O2 production was stimulated by rotenone, which inhibits NADH oxidation at Complex I (Fig. 2b). With succinate, rotenone inhibited H2O2 production indicating that it was fueled by reverse electron transfer from succinate to a site in Complex I (24 (link)). With either substrate, H2O2 production was stimulated by an inhibitor of Complex III (Antimycin A) (24 (link), 37 (link)).
, & Starkov A.A. (2010). Measurement of Mitochondrial ROS Production. Methods in molecular biology (Clifton, N.J.), 648, 245-255.
Publication 2010
Antimycin A Brain Buffers Electron Transport Electron Transport Complex III Fluorescence Horseradish Peroxidase malate Mitochondria Mus NADH NADH Dehydrogenase Complex 1 Peroxide, Hydrogen Pyruvate Respiratory Rate Rotenone Succinate Superoxide Dismutase
3
Amplex Red Assay for Oxidative Stress
Cited 13 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2012
Biological Assay Buffers Catalase Cattle Chelex 100 Filtration Ions Kidney Liver Metals Oxides Pentetic Acid Peroxidase Peroxide, Hydrogen Phosphates pyrroline Resins, Plant resorufin Superoxide Dismutase Transition Elements TRAP1 protein, human
4
Mitochondrial H2O2 Release Assay
Cited 12 times
H2O2 release by isolated mitochondria was measured in the assay buffer containing 115 mM KCl, 10 mM KH2PO4, 2 mM MgCl2, 3 mM Hepes, 1 mM EGTA, 0.2% fatty acid free BSA, pH 7.2 at 37 °C, in the presence of exogenous superoxide dismutase (75 U/ml), horseradish peroxidase (HRP) (2 U/ml) and Amplex Red (50 µM) at 37 °C. The fluorescent intensity of resorufin, the oxidised product of AR, was monitored kinetically in a plate reader (FLUOstar Omega, BMG Labtech) at excitation 544 nm and emission 590 nm. The experiments were protected from light.
For the experiments to test catalase sensitivity to resorufin, the concentration of HRP was lowered to 0.05 U/ml in order for catalase to compete for H2O2. Accordingly, the H2O2 generating system (i.e. the concentration of mitochondria) was also lowered so that it did not exceed the capacity of H2O2 detection at the given HRP concentration.
Typically, the basal rate (with mitochondria, no substrates) was measured for 8–10 min, then respiratory substrates (either Pyruvate+Malate 5 mM or succinate 4 mM) were added to initiate respiration (and the electron transport chain-linked H2O2 release). The fluorescent intensities of the experiments were calibrated against that obtained by the addition of a known amount of H2O2 to the experimental media in the presence of AR and HRP.
As inhibitor of HRP-independent conversion of AR to resorufin, 100 µM PMSF (2 µl of 10 mM PMSF in ethanol to the 200 µl total volume) was added to the experimental medium immediately prior to the or during the measurement. Controls received ethanol only.
In the Homovanillic acid (HVA) assay, AR was replaced with HVA (4 mM) while all the other experimental conditions remained identical to the AR assay, and the fluorescent intensity was read at excitation 310 nm and emission 430 nm.
Miwa S., Treumann A., Bell A., Vistoli G., Nelson G., Hay S, & von Zglinicki T. (2016). Carboxylesterase converts Amplex red to resorufin: Implications for mitochondrial H2O2 release assays. Free Radical Biology & Medicine, 90, 173-183.
Full text: Click here
Publication 2016
Biological Assay Buffers Catalase Cell Respiration Egtazic Acid Electron Transport Ethanol Fatty Acids HEPES Homovanillic Acid Horseradish Peroxidase Hypersensitivity Light Magnesium Chloride malate Mitochondria Peroxide, Hydrogen Pyruvate resorufin Respiratory Rate Succinate Superoxide Dismutase
5
Enzyme Activity Assays for Ginsenoside Biosynthesis
Cited 10 times
Amylase (AMY, EC 3.1.1.2) activity was detected by the 3,5-dinitrosalicylic acid colorimetric method (Hao et al., 2007 ). Malate dehydrogenase (MDH, EC 1.1.1.37) activity was examined as described by Husted and Schjoerring (1995 (link)), with some modifications. Ten microliter samples were added to a 3 ml reaction mixture containing 0.17 mM oxalacetic acid and 0.094 mM β-NADH disodium salt in 0.1 M Tris buffer, pH 7.5. The reaction was measured by the decrease in absorbance at 340 nm for 180s in a spectrophotometer (Hitachi U-2001 Japan), the same reaction system only with sample buffer added in was used as a blank. Superoxide dismutase (SOD, EC 1.14.1.1) activity was measured according to the method of Zhang and Kirkham (1996 (link)), and Xu and Huang (2004 (link)). One unit of SOD activity is defined as the amount of SOD required to cause 50% inhibition of nitroblue tetrazolium (NBT) reduction at 560 nm min-1. Catalase (CAT, EC 1.11.1.6) and peroxidase (POD, EC.1.11.1.7) activity were determined based on the method of Chance and Maehly (1955 (link)) as described in detail for creeping bentgrass in Xu and Huang (2004 (link)). Enzyme activities were based on the absorbance change of the reaction solution per minute at a given wavelength for each enzyme: CAT at 240 nm and POD at 470 nm.
The activities of farnesyl diphosphate synthase (FDPS, EC. 2.5.1.10), cycloartenol synthase (CAS, EC. 5.4.99.8), squalene epoxidases (SE, EC:1.14.13.132), and squalene synthase (SS, EC. 2.5.1.21) involved in ginsenosides biosynthesis, were quantified by an indirect competitive enzyme-linked immunosorbent assay (ELISA). The optical density (OD) values of each sample were read by a BioTek ELx800 microplate reader at 450 nm. The primary concentration of each test sample was calculated from the linear regression equation based on the OD values of the standards.
Ma R., Sun L., Chen X., Mei B., Chang G., Wang M, & Zhao D. (2016). Proteomic Analyses Provide Novel Insights into Plant Growth and Ginsenoside Biosynthesis in Forest Cultivated Panax ginseng (F. Ginseng). Frontiers in Plant Science, 7, 1.
Full text: Click here
Publication 2016
Acids Agrostis Amylase Anabolism Buffers Catalase Colorimetry cycloartenol synthase Enzyme-Linked Immunosorbent Assay enzyme activity Enzymes Farnesyltransferase, Farnesyl-Diphosphate Geranyltranstransferase Ginsenosides NADH Nitroblue Tetrazolium Oxaloacetic Acid Peroxidase Psychological Inhibition Sodium Chloride Squalene Monooxygenase Superoxide Dismutase Tromethamine

Most recents protocols related to «Superoxide Dismutase»

1
Restoring Mitochondrial Function in Friedreich's Ataxia Neurons
Not available on PMC !

Example 2

The next experiments asked whether inhibition of the same set of FXN-RFs would also upregulate transcription of the TRE-FXN gene in post-mitotic neurons, which is the cell type most relevant to FA. To derive post-mitotic FA neurons, FA(GM23404) iPSCs were stably transduced with lentiviral vectors over-expressing Neurogenin-1 and Neurogenin-2 to drive neuronal differentiation, according to published methods (Busskamp et al. 2014, Mol Syst Biol 10:760); for convenience, these cells are referred to herein as FA neurons. Neuronal differentiation was assessed and confirmed by staining with the neuronal marker TUJ1 (FIG. 2A). As expected, the FA neurons were post-mitotic as evidenced by the lack of the mitotic marker phosphorylated histone H3 (FIG. 2B). Treatment of FA neurons with an shRNA targeting any one of the 10 FXN-RFs upregulated TRE-FXN transcription (FIG. 2C) and increased frataxin (FIG. 2D) to levels comparable to that of normal neurons. Likewise, treatment of FA neurons with small molecule FXN-RF inhibitors also upregulated TRE-FXN transcription (FIG. 2E) and increased frataxin (FIG. 2F) to levels comparable to that of normal neurons.

It was next determined whether shRNA-mediated inhibition of FXN-RFs could ameliorate two of the characteristic mitochondrial defects of FA neurons: (1) increased levels of reactive oxygen species (ROS), and (2) decreased oxygen consumption. To assay for mitochondrial dysfunction, FA neurons an FXN-RF shRNA or treated with a small molecule FXN-RF inhibitor were stained with MitoSOX, (an indicator of mitochondrial superoxide levels, or ROS-generating mitochondria) followed by FACS analysis. FIG. 3A shows that FA neurons expressing an NS shRNA accumulated increased mitochondrial ROS production compared to EZH2- or HDAC5-knockdown FA neurons. FIG. 3B shows that FA neurons had increased levels of mitochondrial ROS production compared to normal neurons (Codazzi et al., (2016) Hum Mol Genet 25(22): 4847-485). Notably, inhibition of FXN-RFs in FA neurons restored mitochondrial ROS production to levels comparable to that observed in normal neurons. In the second set of experiments, mitochondrial oxygen consumption, which is related to ATP production, was measured using an Agilent Seahorse XF Analyzer (Divakaruni et al., (2014) Methods Enzymol 547:309-54). FIG. 3C shows that oxygen consumption in FA neurons was ˜60% of the level observed in normal neurons. Notably, inhibition of FXN-RFs in FA neurons restored oxygen consumption to levels comparable to that observed in normal neurons. Collectively, these preliminary results provide important proof-of-concept that inhibition of FXN-RFs can ameliorate the mitochondrial defects of FA post-mitotic neurons.

Mitochondrial dysfunction results in reduced levels of several mitochondrial Fe-S proteins, such as aconitase 2 (ACO2), iron-sulfur cluster assembly enzyme (ISCU) and NADH:ubiquinone oxidoreductase core subunit S3 (NDUFS3), and lipoic acid-containing proteins, such as pyruvate dehydrogenase (PDH) and 2-oxoglutarate dehydrogenase (OGDH), as well as elevated levels of mitochondria superoxide dismutase (SOD2) (Urrutia et al., (2014) Front Pharmacol 5:38). Immunoblot analysis is performed using methods known in the art to determine whether treatment with an FXN-RF shRNA or a small molecule FXN-RF inhibitor restores the normal levels of these mitochondrial proteins in FA neurons.

US11873494B2. Genetic and pharmacological transcriptional upregulation of the repressed FXN gene as a therapeutic strategy for Friedreich ataxia (2024-01-16). University of Massachusetts [US]. Inventors: Michael R. Green [US], Minggang Fang [US].
Full text: Click here
Patent 2024
Aconitate Hydratase Biological Assay Cells Cloning Vectors Enzymes EZH2 protein, human frataxin Genets HDAC5 protein, human Histone H3 Immunoblotting Induced Pluripotent Stem Cells inhibitors Iron Ketoglutarate Dehydrogenase Complex Mitochondria Mitochondrial Inheritance Mitochondrial Proteins MitoSOX NADH NADH Dehydrogenase Complex 1 NEUROG1 protein, human Neurons Oxidoreductase Oxygen Consumption Proteins Protein Subunits Psychological Inhibition Pyruvates Reactive Oxygen Species Repression, Psychology Seahorses Short Hairpin RNA Sulfur sulofenur Superoxide Dismutase Superoxides Thioctic Acid Transcription, Genetic
2
Candidate Gene Screening for Tobacco Mutants
Not available on PMC !

Example 5

Three tobacco lines, FC401 wild type (Wt); FC40-M207 mutant line fourth generation (M4) and FC401-M544 mutant line fourth generation (M4) were used for candidate gene screening. Low anatabine traits were confirmed for the two tobacco mutant lines (M207 and M544) in root and leaf before screening (see FIG. 3).

RNA was extracted from root tissues of wild type (Wt) FC401, M207 and M544 with RNeasy Plus Mini kit from Quiagen Inc. following the manufacturer's protocol. cDNA libraries were prepared from the RNAs using In-Fusion® SMARTer® Directional cDNA Library Construction Kit from Clontech Inc. cDNA libraries were diluted to 100 ng/μl and used as the template for candidate gene PCR screening.

PCR amplifications were performed in 50 μl final volumes that contained 50-100 ng of template DNA (i.e., the cDNA library) and 0.2 μM of primers (Fisher Scientific) using the Platinum® Taq DNA Polymerase High Fidelity kit (Life Technology Inc.). Thermocycling conditions included a 5 min incubation at 94° C.; followed by 34 cycles of 30 seconds at 94° C., 30 seconds at 58° C., 1 min 30 seconds at 68° C.; with a final reaction step of 68° C. for 7 mins. The PCR products were evaluated by agarose gel electrophoresis, and desired bands were gel purified and sequenced using an ABI 3730 DNA Analyzer (ABI).

51 candidate genes (listed in Table 4) were cloned from F401, Wt, M207 and M544 lines, and sequenced for single nucleotide polymorphism (SNP) detection.

TABLE 4
Listing of Candidate Genes for Screening
Quinolinate Synthase A-1Pathogenesis related protein 1
Allene oxide synthaseAllene oxide cyclase
ET861088.1 Methyl esteraseFH733463.1 TGACG-sequence specific transcription factor
FH129193.1 Aquaporin-TransportFH297656.1 Universal stress protein
Universal stress protein Tabacum sequenceFH077657.1 Scarecrow-like protein
FH864888.1 EIN3-binding F-box proteinFH029529.1 4,5 DOPA dioxygenase
FI010668.1 Ethylene-responsive transcription EB430189 Carboxylesterase
factor
DW001704 Glutathione S transferaseEB683763 Bifunctional inhibitor/lipid transfer protein/seed
storage 2S albumin
DW002318 Serine/threonine protein kinaseDW004086 Superoxide dismutase
DW001733 Lipid transfer protein DIRIDW001944 Protein phosphatase 2C
DW002033EB683763 Bifunctional inhibitor/lipid transfer protein/seed
storage 2S albumin
DW002318 Serine/threonine protein kinaseDW002576 Glycosyl hydrolase of unknown function DUF1680
EB683279EB683763
EB683951FG141784 (FAD Oxidoreductase)
BBLa-Tabacum sequencesBBLb
BBLeBBLd
PdrlPdr2
Pdr3Pdr5a
Pdr5bNtMATEl
NtMATE2NtMATE3
WRKY8EIG-I24
WRKY3WRKY9
EIG-E17AJ748263.1 QPT2 quinolinate phosphoribosyltransferase
AJ748262.1 QPT1

US11873500B2. Genetic locus imparting a low anatabine trait in tobacco and methods of using (2024-01-16). ALTRIA CLIENT SERVICES LLC [US]. Inventors: Chengalrayan Kudithipudi [US], Alec J. Hayes [US], Robert Frank Hart [US], Yanxin Shen [US], Jesse Frederick [US], Dongmei Xu [US].
Full text: Click here
Patent 2024
Albumins allene oxide cyclase allene oxide synthase Amino Acid Sequence anatabine Carboxylesterase cDNA Library Dioxygenases Dopa Electrophoresis, Agar Gel Esterases Ethylenes Genes Glutathione S-Transferase Heat Shock Proteins Histocompatibility Testing Hydrolase lipid transfer protein Neoplasm Metastasis Nicotiana Nicotinate-nucleotide pyrophosphorylase (carboxylating) NOS1 protein, human Oligonucleotide Primers Oxidoreductase pathogenesis Plant Leaves Plant Roots Platinum Protein-Serine-Threonine Kinases Protein-Threonine Phosphatase Protein Kinases protein methylesterase Protein Phosphatase Protein Phosphatase 2C Proteins Quinolinate RNA Single Nucleotide Polymorphism Superoxide Dismutase Synapsin I Taq Polymerase Transcription, Genetic Transcription Factor Transfer Factor Water Channel
3
Quantifying Oxidative Stress Markers in Plasma
In plasma samples, the following oxidative stress markers were measured: nitrite (NO2), superoxide anion radical (O2−), hydrogen peroxide (H2O2), and the index of lipid peroxidation (measured as TBARS – thiobarbituric acid reactive substances).
Nitric oxide decomposes rapidly to form stable metabolite nitrite/nitrate products. The nitrite level was measured and used as an index of nitric oxide (NO) production using the Griess reagent. A total of 0.5 ml of plasma was precipitated with 200 μl of 30% sulphosalicylic acid, vortexed for 30 min, and centrifuged at 3000 × g. Equal volumes of supernatant and Griess reagent containing 1% sulphanilamide in 5% phosphoric acid/0.1% naphthalene ethylenediamine dihydrochloride were added and incubated for 10 min in the dark, and the sample was measured at 543 nm. The nitrite levels were calculated using sodium nitrite as the standard [13 (link)].
The O2− concentration was measured after the reaction of nitro blue tetrazolium in Tris buffer with the plasma at 530 nm. Distilled water served as the blank [14 ].
The measurement of H2O2 is based on the oxidation of phenol red by H2O2 in a reaction catalysed by horseradish peroxidase (HRPO). Two hundred μl of plasma was precipitated with 800 ml of freshly prepared phenol red solution, followed by the addition of 10 μl of (1:20) HRPO (made ex tempore). Distilled water was used as the blank instead of the plasma sample. H2O2 was measured at 610 nm [15 (link)].
The degree of lipid peroxidation in the plasma samples was estimated by measuring TBARS using 1% thiobarbituric acid in 0.05 NaOH, incubated with the plasma at 100 °C for 15 min, and measured at 530 nm. Distilled water served as the blank [16 (link)].
The activity of the following antioxidants in the lysate was determined: reduced glutathione (GSH), catalase (CAT), and superoxide dismutase (SOD). The level of reduced glutathione was determined based on GSH oxidation with 5,5-dithiobis-6,2-nitrobenzoic acid using a method by Beutler [17 ]. The CAT activity was determined according to Aebi [18 (link)]. The lysates were diluted with distilled water (1:7 v/v) and treated with chloroform-ethanol (0.6:1 v/v) to remove haemoglobin, and then 50 μl of CAT buffer, 100 μl of sample and 1 ml of 10 mM H2O2 were added to the samples. The detection was performed at 360 nm. SOD activity was determined by the epinephrine method of Beutler [19 (link)]. Lysate (100 μl) and 1 ml carbonate buffer were mixed, and then 100 μl of epinephrine was added. The detection was performed at 470 nm.
Radoman K., Zivkovic V., Zdravkovic N., Chichkova N.V., Bolevich S, & Jakovljevic V. (2023). Effects of dandelion root on rat heart function and oxidative status. BMC Complementary Medicine and Therapies, 23, 78.
Full text: Click here
Publication 2023
Anions Antioxidant Activity Buffers Carbonates Catalase Chloroform Epinephrine Ethanol ethylenediamine dihydrochloride Griess reagent Hemoglobin Horseradish Peroxidase Lipid Peroxidation naphthalene Nitrates Nitrites Nitrobenzoic Acids Nitroblue Tetrazolium Oxidative Stress Oxide, Nitric Peroxide, Hydrogen Phosphoric Acids Plasma Reduced Glutathione Sodium Nitrite Sulfanilamide sulfosalicylic acid Superoxide Dismutase Superoxides thiobarbituric acid Thiobarbituric Acid Reactive Substances Tromethamine
4
Oxidative Stress Markers Quantification
The concentration of malondialdehyde (MDA) as a marker of oxidative stress and the levels of total antioxidant capacity (TAC), catalase (CAT) and superoxide dismutase (SOD) activity were measured using commercial kits and according to the manufacturer’s protocol (Kiazist, Iran). Briefly, kidney tissues were homogenized in lysis buffer containing protease inhibitors (Sigma–Aldrich, USA). After centrifugation by a 3-18KS Sigma centrifuge (Sigma, Germany), supernatants were collected for next analysis. MDA level was quantified by measuring thiobarbituric acid reactive substances produced in the reaction of MDA with thiobarbituric acid. TAC level was measured based on the capacity to convert Cu2+ to Cu+ ion. The activity of catalase was determined according to the reaction of the enzyme with methanol in the presence of hydrogen peroxide and measurement of generated formaldehyde. SOD activity was assayed by measuring the dismutation of superoxide radicals generated by the xanthine/xanthine oxidase system. Protein concentration of lysates was measured using Bradford method. Then the levels of oxidative stress markers were normalized to protein content [20 (link), 21 (link)].
Naghibi N., Sadeghi A., Movahedinia S., Rahimi Naiini M., Rajizadeh M.A., Bahri F, & Nazari-Robati M. (2023). Ellagic acid ameliorates aging-induced renal oxidative damage through upregulating SIRT1 and NRF2. BMC Complementary Medicine and Therapies, 23, 77.
Full text: Click here
Publication 2023
Antioxidants Buffers Catalase Centrifugation Enzymes Formaldehyde Kidney Malondialdehyde Methanol Oxidative Stress Peroxide, Hydrogen Protease Inhibitors Proteins Superoxide Dismutase Superoxides thiobarbituric acid Thiobarbituric Acid Reactive Substances Tissues Xanthine Oxidase
5
Longitudinal Gene Expression Analysis in Honey Bees
A total of five genes were investigated in this study, namely: 1- vitellogenin (Vg), 2- major royal jelly protein 1 (mrjp1), 3- acetylcholine esterase 2 (AChE-2), 4- superoxide dismutase-like (Rsod) and 5- thioredoxin 1 (Trx-1). Sequences of the primers and their amplicon sizes are given in Table 1. Two-step reverse transcription quantitative PCR (RT-qPCR) using BioRad iTaq SYBER Green Supermix 2X was conducted on three biological and technical replicates per sample on five time points enabling a greater longitudinal analysis of gene regulation. cDNA was synthesized from RNA extractions using BioRad iScript Kit following the manufacturer’s protocol. Target genes were normalized against two housekeeping genes (GAPDH, RPS18) known for their stability in honey bee tissues38 (link),62 (link).

Target genes investigated in this study, housekeeping genes, primer sequences, amplicon size and NCBI accession numbers.

GeneDescriptionF/RbpNCBI Accession
Target
AChE-2Acetylcholinesterase-2

GACGCGAAGACCATATCCGT

TCTGTGTCCTTGAAGTCCGC

140NM_001040230.1
Mrjp1Major royal jelly protein 1

TGACCAATGGCATGATAAG

GACCACCATCACCGACCT

98NM_001011579.1
VgVitellogenin

AACGCTTTTACTGTTCGCGG

TATGCACGTCCGACAGATCG

128NM_001011578.1
RsodSuperoxide dismutase-like

GGAGCAGTATCTGCAATGGGA

CGCTACAAAACGTGGTGGTT

141XM_006558333.2
Trx-1Thioredoxin-1

AATGCACCGGCTCAAGAACA

CATGCGACAAGGATTGCACC

138XM_393603.7
Housekeeping
GAPDHGlyceraldehyde-3-phosphate dehydrogenase 2

TACCGCTTTCTGCCCTTCAA

GCACCGAACTCAATGGAAGC

142XM_393605.7
RPS1840S ribosomal protein S18

AATTATTTGGTCGCTGGAATTG

TAACGTCCAGCAGAATGTGGTA

238XM_625101.6
Alburaki M., Madella S, & Cook S.C. (2023). Non-optimal ambient temperatures aggravate insecticide toxicity and affect honey bees Apis mellifera L. gene regulation. Scientific Reports, 13, 3931.
Full text: Click here
Publication 2023
Acetylcholinesterase Biopharmaceuticals DNA, Complementary GAPDH protein, human Gene Expression Regulation Genes Genes, Housekeeping Genes, vif Honey Oligonucleotide Primers Oxidoreductase Phosphates Proteins Reverse Transcription Ribosomal Proteins royal jelly Superoxide Dismutase Thioredoxin 1 Vitellogenins

Top products related to «Superoxide Dismutase»

1
Superoxide dismutase assay kit by Cayman Chemical
Sourced in United States, Poland
The Superoxide Dismutase Assay Kit is a laboratory tool designed to measure the activity of the enzyme superoxide dismutase (SOD) in biological samples. The kit provides the necessary reagents and protocols to quantify SOD levels using a colorimetric or fluorometric detection method.
2
Gsh px by Nanjing Jiancheng
Sourced in China, United States
GSH-Px is a lab equipment used for measuring the activity of the enzyme Glutathione Peroxidase (GSH-Px). GSH-Px is an important antioxidant enzyme that catalyzes the reduction of hydrogen peroxide and organic hydroperoxides. The GSH-Px equipment provides a quantitative analysis of GSH-Px levels in biological samples.
3
Superoxide dismutase by Merck Group
Sourced in United States, Germany, Italy, United Kingdom
Superoxide dismutase is an enzyme that catalyzes the dismutation of superoxide radicals into oxygen and hydrogen peroxide. It is an important antioxidant defense in nearly all cells exposed to oxygen.
4
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
5
Lipid peroxidation mda assay kit by Beyotime
Sourced in China, United States, Japan
The Lipid Peroxidation MDA Assay Kit is a laboratory tool designed to measure the levels of malondialdehyde (MDA), a marker of lipid peroxidation. The kit provides a colorimetric method to quantify MDA concentrations in various biological samples.
6
Bca protein assay kit by Beyotime
Sourced in China, United States, Germany, Puerto Rico, United Kingdom, Switzerland, Japan, Sweden
The BCA protein assay kit is a colorimetric-based method for the quantitative determination of total protein concentration in a sample. It uses bicinchoninic acid (BCA) to detect and quantify the presence of protein.
7
Sod assay kit by Nanjing Jiancheng
Sourced in China
The SOD assay kit is a laboratory tool used to measure the activity of the enzyme superoxide dismutase (SOD) in biological samples. SOD is an important antioxidant enzyme that plays a crucial role in protecting cells from oxidative stress. The kit provides a reliable and efficient method to quantify SOD levels, which can be useful for various research and diagnostic applications.
8
Total superoxide dismutase assay kit with wst 8 by Beyotime
Sourced in China
The Total Superoxide Dismutase Assay Kit with WST-8 is a colorimetric assay used to measure the total superoxide dismutase (SOD) activity in samples. The kit utilizes the water-soluble tetrazolium salt WST-8 to produce a water-soluble formazan dye upon reduction with a superoxide anion, which can be detected spectrophotometrically.
9
Catalase by Merck Group
Sourced in United States, Germany, United Kingdom, Macao, Italy, Sao Tome and Principe, China, Spain, India, Australia, Canada, France, Denmark, Poland
Catalase is a common enzyme found in the cells of most living organisms. It functions as a catalyst, accelerating the decomposition of hydrogen peroxide (H2O2) into water (H2O) and oxygen (O2).

More about "Superoxide Dismutase"

Superoxide Dismutase (SOD) is a crucial metalloenzyme that plays a vital role in antioxidant defense mechanisms across various organisms, including humans.
This enzyme catalyzes the dismutation of superoxide radicals into oxygen and hydrogen peroxide, protecting cells from oxidative damage.
SOD isoforms exist in different cellular compartments, each with unique metal cofactors and functions.
Research on SOD is critical for understanding its involvement in various pathological conditions, such as neurodegeneration, cardiovascular disease, and cancer.
Modulating SOD activity is a promising therapeutic strategy, and researchers often use assays like the Superoxide Dismutase Assay Kit, GSH-Px, and Lipid Peroxidation MDA Assay Kit to measure SOD levels and activity.
The BCA protein assay kit and SOD assay kit, including the Total Superoxide Dismutase Assay Kit with WST-8, are commonly used to quantify SOD and assess its role in cellular processes.
PubCompare.ai's innovative AI-driven platform can enhance the reproducibility and accuracy of SOD research by helping scientists easily locate the best protocols from literature, preprints, and patents, as well as identify the optimal experimental methods and products to streamline their scientific investigations.
This can lead to more reliable and impactful findings on the function of Superoxide Dismutase and its therapeutic potential.