> Chemicals & Drugs > Amino Acid > Synapsins

Synapsins

Synapsins are a family of neuron-specific phosphoproteins that play a key role in the regulation of neurotransmitter release at the synaptic level.
These proteins are involved in the clustering and tethering of synaptic vesicles to the cytoskeleton, as well as in the modulation of neurotransmitter release.
Synapsins are essential for the maintanence of normal synaptic function and are implicated in various neurological disorders.
Understanding the structure, function, and regulation of synapsins is crucial for advancing our knowledge of synaptic biology and developing potential therapeutic interventions.

Most cited protocols related to «Synapsins»

Lentiviral and AAV-Mediated Expression in Hippocampal Neurons

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013

Calcium Phosphates Cre recombinase Histocytochemistry Infant, Newborn Lentivirus Mice, Laboratory Neurons Proteins Superinfection Synapsins Transfection Virus

Optogenetic Manipulation of Neural Circuits

All procedures were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Massachusetts Institute of Technology Committee on Animal Care. C57BL/6J E16-timed pregnant mice were used for electroporation. Surgery was done under ketamine-xylazine anesthesia and buprenorphine analgesia. For cortical experiments, DNA solution containing plasmids of interest were injected into lateral ventricle of each embryo using a pulled capillary tube. Five square pulses (50ms width, 1Hz, 35V) were applied using tweezer electrode for electroporation (Harvard Apparatus, ECM 830). Direct opsin-expressing experimental mice were electroporated with pCAG-opsin-GFP plasmid. Post-synaptic experimental mice were electroporated with pCAG-FLEX-rc[Chronos-GFP] and/or pCAG-FLEX-Chrimson-mOrange2, and pCAG-Cre plasmids. pCAG-Chrimson-tdTomato was additionally used in half of the single post-synaptic experiments.
For the retinal ganglion cell-superior colliculus experiment, intravitreal virus injection was performed on P0 C57BL/6 mice with Nanoject II (Drummond) under cold anesthesia. 100 nL of rAAV2/8-Synapsin-Chronos-GFP (titer 1.4×10¹³ particles/mL) was injected into the eye. AAV particles were produced by the University of North Carolina Chapel Hill Vector Core.

Klapoetke N.C., Murata Y., Kim S.S., Pulver S.R., Birdsey-Benson A., Cho Y.K., Morimoto T.K., Chuong A.S., Carpenter E.J., Tian Z., Wang J., Xie Y., Yan Z., Zhang Y., Chow B.Y., Surek B., Melkonian M., Jayaraman V., Constantine-Paton M., Wong G.K, & Boyden E.S. (2014). Independent Optical Excitation of Distinct Neural Populations. Nature methods, 11(3), 338-346.

Publication 2014

Anesthesia Animals Animals, Laboratory Buprenorphine Capillaries Cloning Vectors Common Cold Cortex, Cerebral Electroporation Therapy Embryo Ketamine Management, Pain Mice, Inbred C57BL Mus Operative Surgical Procedures Plasmids Pulses Retinal Ganglion Cells Rod Opsins Synapsins tdTomato Tectum, Optic Ventricle, Lateral Virus Xylazine

Comprehensive Macromolecular Structure Database

Data from 47 structures in the PHENIX library of MAD, SAD and MIR data sets were used along with 246 MAD and SAD structures from the Joint Center for Structural Genomics (JCSG; http://www.jcs.org). The structures from the PHENIX library included 1029B (PDB code 1n0e; Chen et al., 2004 ▶ ), 1038B (1lql; Choi et al., 2003 ▶ ), 1063B (1lfp; Shin et al., 2002 ▶ ), 1071B (1nf2; Shin, Roberts et al., 2003 ▶ ), 1102B (1l2f; Shin, Nguyen et al., 2003 ▶ ), 1167B (1s12; Shin et al., 2005 ▶ ), aep-transaminase (1m32; Chen et al., 2002 ▶ ), armadillo (3bct; Huber et al., 1997 ▶ ), calmodulin (1exr; Wilson & Brunger, 2000 ▶ ), cobd (1kus; Cheong et al., 2002 ▶ ), cp-synthase (1l1e; Huang et al., 2002 ▶ ), cyanase (1dw9; Walsh et al., 2000 ▶ ), epsin (1edu; Hyman et al., 2000 ▶ ), flr (1bkj; Tanner et al., 1996 ▶ ), fusion-complex (1sfc; Sutton et al., 1998 ▶ ), gene-5 (1vqb; Skinner et al., 1994 ▶ ), gere (1fse; Ducros et al., 2001 ▶ ), gpatase (1ecf; Muchmore et al., 1998 ▶ ), granulocyte (2gmf; Rozwarski et al., 1996 ▶ ), groEL (1oel; Braig et al., 1995 ▶ ), group2-intron (1kxk; Zhang & Doudna, 2002 ▶ ), hn-rnp (1ha1; Shamoo et al., 1997 ▶ ), ic-lyase (1f61; Sharma et al., 2000 ▶ ), insulin (2bn3; Nanao et al., 2005 ▶ ), lysozyme (unpublished results; CSHL Macromolecular Crystallography Course), mbp (1ytt; Burling et al., 1996 ▶ ), mev-kinase (1kkh; Yang et al., 2002 ▶ ), myoglobin (A. Gonzales, personal communication), nsf-d2 (1nsf; Yu et al., 1998 ▶ ), nsf-n (1qcs; Yu et al., 1999 ▶ ), p32 (1p32; Jiang et al., 1999 ▶ ), p9 (1bkb; Peat et al., 1998 ▶ ), pdz (1kwa; Daniels et al., 1998 ▶ ), penicillopepsin (3app; James & Sielecki, 1983 ▶ ), psd-95 (1jxm; Tavares et al., 2001 ▶ ), qaprtase (1qpo; Sharma et al., 1998 ▶ ), rab3a (1zbd; Ostermeier & Brunger, 1999 ▶ ), rh-dehalogenase (1bn7; Newman et al., 1999 ▶ ), rnase-p (1nz0; Kazantsev et al., 2003 ▶ ), rnase-s (1rge; Sevcik et al., 1996 ▶ ), rop (1f4n; Willis et al., 2000 ▶ ), s-hydrolase (1a7a; Turner et al., 1998 ▶ ), sec17 (1qqe; Rice & Brunger, 1999 ▶ ), synapsin (1auv; Esser et al., 1998 ▶ ), synaptotagmin (1dqv; Sutton et al., 1999 ▶ ), tryparedoxin (1qk8; Alphey et al., 1999 ▶ ), ut-synthase (1e8c; Gordon et al., 2001 ▶ ) and vmp ( l8w; Eicken et al., 2002 ▶ ).
The structures from the JCSG included PDB (Bernstein et al., 1977 ▶ ; Berman et al., 2000 ▶ ) entries 1o1x (Xu et al., 2004 ▶ ), 1vjf, 1vjr, 1vk4, 1vk8, 1vk9, 1vkd, 1vkn, 1vl0, 1vl5, 1vli, 1vlo, 1vly, 1vm8, 1vmg, 1vmi, 1vp8, 1vpm, 1vpz (Rife et al., 2005 ▶ ), 1vqr (Xu, Schwarzenbacher, McMullan et al., 2006 ▶ ), 1vqs, 1vqy, 1vqz, 1vr0 (DiDonato et al., 2006 ▶ ), 1vr3 (Xu, Schwarzenbacher, Krishna et al., 2006 ▶ ), 1vr5, 1vr8 (Xu, Krishna et al., 2006 ▶ ), 1vrm (Han et al., 2006 ▶ ), 1z82, 1z85, 1zbt, 1zej, 1zh8, 1zko, 1ztc, 1zx8 (Jin et al., 2006 ▶ ), 1zy9, 1zyb, 2a3n, 2aam, 2aml, 2ax3, 2b8n (Schwarzenbacher et al., 2006 ▶ ), 2etd, 2ets, 2evr, 2f4i, 2f4l, 2fg0, 2fg9, 2fna, 2ftr, 2fup, 2fur, 2g0w, 2gb5, 2gc9, 2gf6, 2gfg, 2ghr (Zubieta et al., 2007 ▶ ), 2gno, 2go7, 2gpi, 2gpj, 2grj, 2gvh, 2h1q, 2h1t, 2h9f, 2hcf, 2hh6, 2hhz, 2hi0, 2hq7, 2hq9, 2hr2, 2hsz, 2huh, 2hx1, 2hx5, 2hxv, 2i02, 2i8d, 2i9w, 2ig6, 2ii1, 2ilb, 2isb, 2it9, 2itb, 2nuj, 2o08, 2o2g, 2o2x, 2o2z, 2o3l, 2o62, 2oa2, 2oaf, 2oc6, 2od5, 2ogi, 2oh1, 2oh3, 2oik, 2ooj, 2ook, 2op5, 2opl, 2oqm, 2ord, 2osd, 2otm, 2ou3, 2ou5, 2ou6, 2own, 2oyo, 2ozg, 2ozj, 2p10, 2p1a, 2p7i, 2p8j, 2pbl, 2peb, 2pfw, 2pg4, 2pgc, 2pke, 2pn1, 2pq7, 2pr7, 2prr, 2prv, 2pv4, 2pv7, 2pwn, 2py6, 2pyq, 2pyx, 2q02, 2q04, 2q0t, 2q14, 2q3l, 2q78, 2q7x, 2q9k, 2q9r, 2qe6, 2qe9, 2qez, 2qg3, 2qhp, 2qj8, 2ql8, 2qml, 2qpx, 2qr6, 2qtp, 2qtq, 2qw5, 2qww, 2qwz, 2qyv, 2r01, 2r0x, 2r1i, 2r3b, 2r44, 2r4i, 2r9v, 2ra9, 2ras, 2rcc, 2rcd, 2rd9, 2rdc, 2re3, 2re7, 2rfp, 2rgq, 2rha, 2rhm, 2rij, 2ril, 2rkh, 3b5e, 3b5o, 3b77, 3b7f, 3b81, 3b8l, 3bb5, 3bb9, 3bcw, 3bdd and 3bde.

Terwilliger T.C., Adams P.D., Read R.J., McCoy A.J., Moriarty N.W., Grosse-Kunstleve R.W., Afonine P.V., Zwart P.H, & Hung L.W. (2009). Decision-making in structure solution using Bayesian estimates of map quality: the PHENIX AutoSol wizard. Acta Crystallographica Section D: Biological Crystallography, 65(Pt 6), 582-601.

Publication 2009

Armadillos Calmodulin cyanase DNA Library epsin Genes Granulocyte Hydrolase Insulin Introns Joints Lyase Muramidase Myoglobin Nicotinate-nucleotide pyrophosphorylase (carboxylating) Nitric Oxide Synthase Oryza sativa Phosphotransferases Ribonucleases RNase P Synapsins Synaptotagmins Transaminases tryparedoxin

Optogenetic Manipulation of Neural Circuits

Publication 2014

Optimized CRISPR-Cas9 Plasmid Construction

For SpCas9 targets selection and generation of single guide RNA (sgRNA), the 20-nt target sequences were selected to precede a 5′-NGG protospacer-adjacent motif (PAM) sequence. To minimize off-targeting effects, the CRISPR design tool was used (http://crispr.mit.edu/). sgRNA was PCR amplified using U6 promoter as a template with forward primer: 5′-CGCACGCGTAATTCGAACGCTGACGTCATC-3′ and reverse primer containing the sgRNA with 20-nt DNA target site (bold): 5′-CACACGCGTAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACNNNNNNNNNNNNNNNNNNNCGGTGTTTCGTCCTTTCCAC-3′. Control sgRNA sequence was designed to target lacZ gene from Escherichia coli (target sequence: TGCGAATACGCCCACGCGATGGG). EGFP-KASH^{7 (link)} construct was a generous gift from Prof. Worman (Columbia University, NYC) and was used as PCR template for cloning the coding cassette into AAV backbone under the human Synapsin promoter (hSyn). U6-Mecp2sgRNA coding sequence was introduced using Mlu I site. For the multiplex gene targeting strategy, individual sgRNAs were PCR amplified as described above. All three sgRNAs were ligated with PCR amplified hSyn-GFP-KASH-bGHpA cassette (Fig. 4a) by using the Golden Gate cloning strategy. After PCR amplification, the ligation product containing three sgRNAs and hSyn-GFP-KASH-bGH pA was cloned into AAV backbone. All obtained constructs were sequenced verified. In order to find the optimal promoter sequence to drive SpCas9 expression in neurons we tested: hSyn1, mouse truncated Mecp2 (pMecp2), and truncated rat Map1b (pMap1b) promoter sequences^{6 (link)} (Supplementary Fig. 1a). The following primers were used to amplify promoter regions: hSyn_F: 5′-GTGTCTAGACTGCAGAGGGCCCTG-3′; hSyn_R: 5′-GTGTCGTGCCTGAGAGCGCAGTCGAGAA-3′; Mecp2_F 5′-GAGAAGCTTAGCTGAATGGGGTCCGCCTC-3′; Mecp2_R 5′-CTCACCGGTGCGCGCAACCGATGCCGGGACC-3′; Map1b-283/-58_F 5′-GAGAAGCTTGGCGAAATGATTTGCTGCAGATG-3′; Map1b-283/-58_R 5′-CTCACCGGTGCGCGCGTCGCCTCCCCCTCCGC-3′.
Another truncation of rat map1b promoter was assembled with the following oligos: 5′-AGCTTCGCGCCGGGAGGAGGGGGGACGCAGTGGGCGGAGCGGAGACAGCACCTT CGGAGATAATCCTTTCTCCTGCCGCAGAGCAGAGGAGCGGCGGGAGAGGAACACTT CTCCCAGGCTTTAGC AGAGCCGGA-3′ and 5′-CCGGTCCGGCTCTGCTAAAGCCTGGGAGAAGTGTTCCTCTCCCGCCGCTCCTCTGCTCTGCGGCAGGAGAAAGGATTATCTCCGAAGGTGCTGTCTCCGCTCCGCCCACTGCGTCCCCCCTCCTCCCGGCGCGA-3′. Short synthetic polyadenylation signal (spA)^{31 (link)} was assembled using the following DNA oligonucleotides: 5′-AATTCAATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTTTTTTGTGTGC-3′ and 5′- GGCCGCACACAAAAAACCAACACACAGATCTAATGAAAATAAAGATCTTTTATTG-3′. SpCas9 and its D10A/H840A mutant version (dSpCas9) were described previously^{27 (link),32 (link),33 (link)}. Plasmid encoding red fluorescent protein (mCherry) under control of EF1α promoter was used for neuron transfection with Lipofectamine 2000 (Life Technologies).

Swiech L., Heidenreich M., Banerjee A., Habib N., Li Y., Trombetta J., Sur M, & Zhang F. (2014). In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nature biotechnology, 33(1), 102-106.

Publication 2014

2',5'-oligoadenylate Clustered Regularly Interspaced Short Palindromic Repeats Escherichia coli Homo sapiens LacZ Genes Ligation lipofectamine 2000 MECP2 protein, human Mice, Laboratory microtubule-associated protein 1B Neurons Oligonucleotide Primers Oligonucleotides Open Reading Frames Plasmids Polyadenylation red fluorescent protein RNA, Single Guide Synapsins Transfection Vertebral Column

Most recents protocols related to «Synapsins»

Drosophila Synapse Immunostaining and Imaging

Third instar larvae were dissected in HL3 buffer and subsequently fixed in HL3 + 3.7%PFA for 20 min. Tissue was permeabilized using 1× PBS with 0.2% Triton-X and 5% BSA. Staining was performed using the following probes/antibodies: horseradish peroxidase (HRP; Jackson ImmunoResearch Laboratories, 1:250), Disc Large 1 (4F3, DHSB, 1:50), mouse monoclonal YARS1 (Abnova, 1:500), rabbit polyclonal GFP (Invitrogen, 1:2000), rabbit polyclonal RFP (Abcam, 1:250), mouse monoclonal Brp (nc82, DHSB, 1:100), mouse monoclonal FasII (1D4, DHSB, 1:250), mouse monoclonal Synapsin (SynORF1, 3C11, DHSB, 1:500). Alexa Fluor®−488 and Alexa Fluor®−546 secondary antibodies were used (Invitrogen, 1:1000). Muscle 6/7 of abdominal hemisegments 3 and 4 were imaged.
Laser scanning confocal microscopy was performed on a Carl Zeiss LSM700 microscope equipped with a 20× Plan-Apochromat (0.8 NA) or 63× Plan-Apochromat (1.4 NA) objective. Super-resolution structured illumination microscopy was performed on a Zeiss ELYRA S.1 microscope equipped with a 63× Plan-Apochromat objective (1.4 NA). For a description of methods used to calculate Lifeact-RFP distribution at synaptic boutons, please see Supplementary Fig. 7.

Ermanoska B., Asselbergh B., Morant L., Petrovic-Erfurth M.L., Hosseinibarkooie S., Leitão-Gonçalves R., Almeida-Souza L., Bervoets S., Sun L., Lee L., Atkinson D., Khanghahi A., Tournev I., Callaerts P., Verstreken P., Yang X.L., Wirth B., Rodal A.A., Timmerman V., Goode B.L., Godenschwege T.A, & Jordanova A. (2023). Tyrosyl-tRNA synthetase has a noncanonical function in actin bundling. Nature Communications, 14, 999.

Publication 2023

Abdominal Muscles alexa fluor 488 Alexa fluor 546 Antibodies Buffers Larva Light Microscopy Mice, House Microscopy Microscopy, Confocal, Laser Scanning Presynaptic Terminals Rabbits Synapsins Tissues

Generating Recombinant Agrin Constructs for Neuronal Morphogenesis

Full-length (GeneID: 11,603) agrin constructs were obtained from Dharmacon (accession: BC150703). The DNA sequence corresponding to the 22 kDa C-terminus of agrin was used to induce spinogenesis and filopodia as previously described [7 (link)], while the 15 kDa C-terminus sequence was used as a control [10 (link)]. The cDNA was amplified using primers (sequences of the primers can be found in supplementary data, Table S2) and cloned into an AAV vector where the gene was expressed under the synapsin promoter and fused at the N-terminus of the red fluorescent reporter protein scarlet [79 (link)]. To secrete agrin fragments into the extracellular environment, we additionally cloned a secretion signal sequence from the receptor protein tyrosine phosphatase sigma at the N-terminus of the agrin sequence as described previously [80 (link)].
AAV particles were produced as previously described [81 (link)] with minor modifications. Briefly, HEK 293 T cells were transfected using the calcium phosphate method with an equimolar mixture of the expression plasmid, pHelper plasmid and RapCap plasmid DJ. After 48 h of transfection, cells were lysed using freeze–thaw cycles and treated with benzonase at a final concentration of 50 units/ml for 1 h at 37 °C. The lysate was centrifuged at 8000 g at 4 °C. The supernatant was collected and filtered with a 0.2-micron filter. The filtered supernatant was passed through pre-equilibrated Hitrap Heparin columns (Cat no. 17–0406-01; Ge HealthCare Life Science), followed by a wash with wash Buffer 1 (20 mM Tris, 100 mM NaCl, pH 8.0; filtered sterile). Columns were additionally washed with wash Buffer 2 (20 mM Tris 250 mM NaCl, pH 8.0; filtered sterile). Viral particles were eluted with elution buffer (20 mM Tris 500 mM NaCl, pH 8.0; filtered sterile). Amicon Ultra-4 centrifugal filters (100 kD cutoff) were used to exchange the elution buffer with sterile PBS. Finally, viral particles were filtered through a 0.22 μm syringe filter (Sigma-Aldrich, product no. Z741696-100EA), aliquoted, and stored at -80 °C until required.

Ferrer-Ferrer M., Jia S., Kaushik R., Schneeberg J., Figiel I., Aleshin S., Mironov A., Safari M., Frischknecht R., Wlodarczyk J., Senkov O, & Dityatev A. (2023). Mice deficient in synaptic protease neurotrypsin show impaired spaced long-term potentiation and blunted learning-induced modulation of dendritic spines. Cellular and Molecular Life Sciences, 80(4), 82.

Publication 2023

Agrin Benzonase Buffers Calcium Phosphates Cells Cloning Vectors DNA, Complementary Filopodia Freezing Genes HEK293 Cells Heparin Oligonucleotide Primers Plasmids Protein Tyrosine Phosphatase, Receptor Type S red fluorescent protein secretion Sodium Chloride Sterility, Reproductive Synapsins Syringes Transfection Tromethamine Virion

Antibody Validation for Western Blotting

For western blotting, primary and secondary antibodies were obtained from the following sources and were used with the following concentrations (Table 1). Before applying western blotting technique, we analyzed the specificity of the primary antibodies. All of them showed the specific bands with expected molecular weights (Figs. 2A, 4A, 5A).Table 1

Antibodies

Target	Epitope	Source	Company (cat. no.)	Dilution
Cα	Hu Cα C-terminus	Ms mAb	Santa Cruz (sc-28315)	1/1000
Cβ	Hu Cβ C-terminus	Rb pAb	Santa Cruz (sc-904)	1/1000
RIα	Hu RIα residues 1–381	Ms mAb	Santa Cruz (sc-136231)	1/1000
RIβ	Hu RIβ C-terminus	Ms mAb	Santa Cruz (sc-100414)	1/1000
RIIα	Ms RIIα C-terminus	Rb pAb	Santa Cruz (sc-909)	1/1000
RIIβ	Hu RIIβ residues 21–110	Ms mAb	Santa Cruz (sc-376778)	1/800
SNAP-25	Hu SNAP-25 residues around Gln116	Rb mAb	CST (5309)	1/1000
pSNAP-25 (T138)	Hu SNAP-25 residues around T138	Rb pAb	Biorbyt (orb163730)	1/1000
Synapsin-1	Hu Synapsin-1a,b	Rb pAb	AB1543 Chemicon	1/1000 1/500
pSynapsin-1 (S9)	Hu Synapsin-1 residues around S9	Rb pAb	CST (2311S)	1/1000
AKAP150	Rat AKAP150 residues 428–449	Rb pAb	Millipore (07-210)	1/1000
GAPDH	Rb GAPDH	Ms mAb	Santa Cruz (sc-32233)	1/4000
ATPase	Chicken ATPase residues 27–55	Ms mAb	DSHB (a6f)	1/2000
Syntaxin	Rat Syntaxin	Ms mAb	Millipore (S0664)	1/1000
Secondary antibodies	Anti-Rb conjugated HRP	Dk pAb	711-035-152	1/10000
Secondary antibodies	Anti-Ms conjugated HRP	Rb pAb	A9044	1/10000
	Anti-Ms conjugated TRITC	Dk pAb	715-025-151	1/1000
	Anti-Rb conjugated Alexa fluor 488	Dk pAb	A21206	1/1000
	α-Bungarotoxin conjugated Alexa Fluor 647		B35450	1/1000
	α-Bungarotoxin conjugated TRITC		T1175	1/1000

Antibodies used in this study and procedure specifications

Dk donkey, Hu human, mAb monoclonal antibody, Ms mouse, pAb polyclonal antibody, Rb rabbit

Polishchuk A., Cilleros-Mañé V., Just-Borràs L., Balanyà-Segura M., Vandellòs Pont G., Silvera Simón C., Tomàs M., Garcia N., Tomàs J, & Lanuza M.A. (2023). Synaptic retrograde regulation of the PKA-induced SNAP-25 and Synapsin-1 phosphorylation. Cellular & Molecular Biology Letters, 28, 17.

Publication 2023

Adenosinetriphosphatase Antibodies Antibody Specificity Bungarotoxins Equus asinus Figs Homo sapiens Immunoglobulins Mice, House Monoclonal Antibodies Rabbits SNAP25 protein, human Synapsin I Synapsins

Inducible NGN2 Neuronal Differentiation

hESCs (H1) were obtained from the WiCell Institute, cultured in StemPro media (Gibco) on Matrigel, and routinely passaged using Versene. To generate the inducible NGN2 line, we electroporated ESCs (Nucleofector program A-023; Lonza) with three plasmids: piggyBac-EF1α::Tet-ON 3G transactivator, piggyBac-TRE3G::NGN2, and a transient Super PiggyBac transposase plasmid (System Biosciences). Following drug selection with puromycin and G418, several clonal lines were tested for their capacity to uniformly differentiate into neurons upon addition of 1 μg/ml doxycycline to the medium. A single NGN2-ESC line was used for all subsequent experiments. NGN2-ESCs were electroporated with the transposase plasmid along with one of five piggyBac vectors driven by a CMVe/synapsin promoter:tau[WT]-BioID2, tau[P301L]-BioID2, α-synuclein[WT]-BioID2, α-synuclein[A53T]-BioID2, or BioID2 only. The cells were expanded in zeocin-containing media for 3 weeks before the polyclonal BioID2 NGN2-ESC lines were ready for differentiation.

Griffin T.A., Schnier P.D., Cleveland E.M., Newberry R.W., Becker J, & Carlson G.A. (2023). Fibril treatment changes protein interactions of tau and α-synuclein in human neurons. The Journal of Biological Chemistry, 299(3), 102888.

Publication 2023

antibiotic G 418 Cells Clone Cells Cloning Vectors Doxycycline Enhanced S-Cone Syndrome Human Embryonic Stem Cells matrigel Neurons Pharmaceutical Preparations Plasmids Puromycin SNCA protein, human Synapsins Trans-Activators Transients Transposase Versene Zeocin

Inducible Transgene Expression Plasmids

A piggyBac transposon expression plasmid (PB510B-1) was obtained from System Biosciences. The promoter was replaced with an inducible Tet-ON 3G promoter, a constitutive eukaryotic translation elongation factor 1α (EF1α) promoter, or a CMVe/synapsin promoter. In some plasmids, the puromycin resistance gene was replaced with a neomycin or zeocin resistance gene. The human NGN2 transgene and BioID2 transgenes were codon optimized and synthesized (IDT) and then inserted into the expression plasmids via In-Fusion cloning (Takara). BioID2 was genetically fused to the C terminus of 0N4R (WT or P301L) tau or α-synuclein (WT or A53T) using a 15-amino acid linker that is compatible with tau and α-synuclein aggregation in cell lines expressing tau or α-synuclein fused to YFP (70 ).

Publication 2023

Amino Acids Cell Lines Codon Elongation Factor 1alpha Eukaryotic Cells Genes Homo sapiens Jumping Genes Neomycin Plasmids Puromycin SNCA protein, human Synapsins Transgenes Zeocin

Top products related to «Synapsins»

Synapsin by Merck Group

Sourced in United States

Synapsin is a laboratory equipment product manufactured by Merck Group. It is a device used for the detection and analysis of synaptic proteins. The core function of Synapsin is to facilitate the study of synaptic transmission and neurotransmitter release in biological samples.

Gapdh by Merck Group

Sourced in United States, United Kingdom, Germany, China, Canada, Italy, Japan, Morocco, Israel, Australia, France, Sao Tome and Principe, Denmark

GAPDH is an enzyme that catalyzes the sixth step of glycolysis, the metabolic pathway that converts glucose into energy. It is responsible for the conversion of glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate. GAPDH is commonly used as a control or reference gene in molecular biology experiments.

4 6 diamidino 2 phenylindole (dapi) by Merck Group

Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore

DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.

Alexa fluor 488 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Japan, France, Italy, Canada, China, Spain, Switzerland, Denmark, Australia, Hungary, Belgium, Ireland, Israel, Netherlands, Moldova, Republic of, India, Austria, Czechia, Poland

Alexa Fluor 488 is a fluorescent dye used in various biotechnological applications. It has an excitation maximum at 495 nm and an emission maximum at 519 nm, producing a green fluorescent signal. Alexa Fluor 488 is known for its brightness, photostability, and pH-insensitivity, making it a popular choice for labeling biomolecules in biological research.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Anti synapsin by Synaptic Systems

Sourced in Germany

Anti-synapsin is a primary antibody used to detect and visualize synaptic proteins in neuronal cells. It binds specifically to the synaptic vesicle protein synapsin, which is involved in the regulation of neurotransmitter release. The anti-synapsin antibody can be utilized in various immunodetection techniques, such as immunohistochemistry and Western blotting, to study the distribution and expression of synaptic proteins in biological samples.

Metamorph software by Molecular Devices

Sourced in United States, Japan, Germany, United Kingdom, Canada, France, Azerbaijan

MetaMorph software is a comprehensive image analysis platform designed for life science research. It provides advanced tools for acquiring, processing, and analyzing digital images from a variety of microscopy techniques. The software's core function is to enable researchers to quantify and extract meaningful data from their experimental images.

Anti synorf1 by Developmental Studies Hybridoma Bank

Sourced in United States

Anti-SYNORF1 is a monoclonal antibody that recognizes the SYNORF1 protein. The SYNORF1 protein is a synaptic vesicle protein involved in neurotransmitter release. Anti-SYNORF1 can be used to detect and localize the SYNORF1 protein in various biological samples.

Neuronal nuclei (neun) by Merck Group

Sourced in United States, United Kingdom, Germany, Canada, Denmark, Morocco, Japan, Ireland

NeuN is a protein marker used for the detection and identification of neuronal cell nuclei in various vertebrate species. It is commonly used in immunohistochemistry and other laboratory techniques to study the distribution and properties of neurons in biological samples.

Synaptophysin by Synaptic Systems

Sourced in United States, Germany

Synaptophysin is a glycoprotein found in the membrane of synaptic vesicles. It is a commonly used biomarker for the identification and quantification of synapses in both neurological and non-neurological tissues.

What are the key functions of Synapsins?

Synapsins are a family of neuron-specific phosphoproteins that play a crucial role in the regulation of neurotransmitter release at the synaptic level. They are involved in the clustering and tethering of synaptic vesicles to the cytoskeleton, as well as the modulation of neurotransmitter release. Synapsins are essential for maintaining normal synaptic function and are implicated in various neurological disorders.

How can different types of Synapsins vary in their properties and applications?

There are multiple isoforms and variants of Synapsins, each with potentially unique structural and functional characteristics. These different Synapsin types may have distinct roles in synaptic biology, neurotransmitter release, and neurological processes. Understanding the nuances between Synapsin variations can be important when selecting the appropriate Synapsin-related protocols for your research needs.

What are some common challenges in studying and working with Synapsins?

Studying Synapsins can present some unique challenges, such as their complex regulation, post-translational modifications, and interactions with other synaptic proteins. Properly designing and optimizing protocols to investigate Synapsin structure, function, and localization can be crucial for obtaining reliable and reproducible results. Navigating the vast literature on Synapsins can also be time-consuming and difficult without the right tools.

How can PubCompare.ai help streamline Synapsin-related research?

PubCompare.ai's AI-powered insights can greatly assist researchers working with Synapsins. The platfrom allows you to more efficietly screen protocol literature, leveraging AI to pinpoint critical insights. PubCompare.ai can help you identify the most effective protocols related to Synapsins for your specific research goals, highlighting key differences in protocol effectiveness and enabling you to choose the best option for reproducibility and accuracy.

More about "Synapsins"

Synapsins are a family of neuron-specific phosphoproteins that play a crucial role in the regulation of neurotransmitter release at the synaptic level.
These synaptic proteins, also known as SYN, are involved in the clustering and tethering of synaptic vesicles to the cytoskeleton, as well as the modulation of neurotransmitter exocytosis.
Synapsins are essential for the maintenance of normal synaptic function and are implicated in various neurological disorders, such as epilepsy, autism spectrum disorders, and Alzheimer's disease.
Understanding the structure, function, and regulation of synapsins is pivotal for advancing our knowledge of synaptic biology and developing potential therapeutic interventions.
Researchers often utilize various techniques, including immunofluorescence with Anti-synapsin and Anti-SYNORF1 antibodies, as well as microscopy software like MetaMorph, to visualize and analyze the localization and dynamics of synapsins in neuronal cells.
Synapsins are closely related to other key synaptic proteins, such as GAPDH, DAPI, Alexa Fluor 488, Lipofectamine 2000, and Synaptophysin, which are commonly used in synaptic research.
By incorporating these related terms and techniques, researchers can optimize their research protocols, enhance reproducibility, and gain deeper insights into the complex mechanisms underlying synaptic function and dysfunction.
Leveraging the power of AI-powered tools like PubCompare.ai can further aid researchers in locating the best protocols from literature, preprints, and patents, ultimately boosting their research efficiency and confidence.
With a comprehensive understanding of synapsins and their role in synaptic biology, scientists can work towards developing more effective therapeutic strategies for neurological disorders and advancing our knowledge of the brain.