Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > T4 DNA Ligase

T4 DNA Ligase

T4 DNA Ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in double-stranded DNA.
It plays a crucial role in DNA repair, replication, and recombination processes.
The enzyme is derived from the bacteriophage T4 and is widely used in molecular biology techniques, such as DNA cloning, library construction, and genetic engineering.
PubCompare.ai, an AI-driven platform, can help researchers optimize their T4 DNA Ligase protocols, enhancing reproducibility and research accuracy.
By easily locating the best protocols from literature, pre-prints, and patents using AI-powered comparisons, researchers can improve their efficieny and confidence in their T4 DNA Ligase-based experiments.

Most cited protocols related to «T4 DNA Ligase»

1
Genomic DNA Library Preparation Protocol
Cited 149 times
Genomic DNA (0.1–1 µg; from either individual or pooled samples) was digested for 15 min at 37°C in a 50 µL reaction with 20 units (U) of EcoRI or SbfI (New England Biolabs [NEB]). Samples were heat-inactivated for 20 min at 65°C. 2.5 µL of 100 nM P1 Adapter, a modified Solexa© adapter (2006 Illumina, Inc., all rights reserved; for EcoRI digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxx-3′ [x = barcode], bottom: 5′-Phos-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′, for SbfI digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA-3′, bottom: 5′-Phos-xxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′) were added to the sample along with 1 µL of 100 mM rATP (Promega), 1 µL 10× EcoRI buffer, 0.5 µL (1000 U) T4 DNA Ligase (high concentration, NEB), 5 µL H2O and incubated at room temperature (RT) for 20 min. Samples were again heat-inactivated for 20 min at 65°C, pooled, and randomly sheared (Bioruptor or Branson sonicator 450) to an average size of 500 bp. Samples were then run out on a 1% agarose (Sigma), 0.5× TBE gel and DNA 300 bp to 700 bp was isolated using a MinElute Gel Extraction Kit (Qiagen). The Quick Blunting Kit (NEB) was used to polish the ends of the DNA. Samples were then purified using a Quick Spin column (Qiagen) and 15 U of Klenow exo− (NEB) was used to add adenine (Fermentas) overhangs on the 3′ end of the DNA at 37°C. After another purification, 1 µL of 10 µM P2 Adapter, a divergent modified Solexa© adapter (2006 Illumina, Inc., all rights reserved; top: 5′-Phos-CTCAGGCATCACTCGATTCCTCCGAGAACAA-3′, bottom: 5′-CAAGCAGAAGACGGCATACGACGGAGGAATCGAGTGATGCCTGAGT-3′), was ligated to the DNA fragments at RT. Samples were again purified and eluted in 50 µL. 5 µL of this product was used in a PCR amplification with 50 µL Phusion Master Mix (NEB), 5 µL of 10 µM modified Solexa© Amplification primer mix (2006 Illumina, Inc., all rights reserved; P1-forward primer: 5′-AATGATACGGCGACCACCGA-3′; P2-reverse primer: 5′-CAAGCAGAAGACGGCATACGA-3′), and 40 µL H2O. Phusion PCR settings followed product guidelines (NEB) for a total of 18 cycles. Samples were gel purified, excising DNA 300–700 bp, and diluted to 10 nM. Illumina Solexa protocols were followed for sequencing. Sequences are available at the Short Read Archive (http://www.ncbi.nlm.nih.gov/Traces/sra/), at accession SRA001825.1.
Baird N.A., Etter P.D., Atwood T.S., Currey M.C., Shiver A.L., Lewis Z.A., Selker E.U., Cresko W.A, & Johnson E.A. (2008). Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers. PLoS ONE, 3(10), e3376.
Full text: Click here
Publication 2008
Adenine Buffers Deoxyribonuclease EcoRI Digestion Genome Oligonucleotide Primers Promega Sepharose sodium-binding benzofuran isophthalate T4 DNA Ligase
2
PacBio Sequencing by Synthesis Protocol
Cited 147 times
Genomic DNA was sheared to 8 kb using an ultrasonicator (Covaris Inc, Woburn, MA) and was converted into the proprietary SMRTbell™ library format using RS DNA Template Preparation Kit (Pacific Biosciences, Melon Park, CA). Briefly, sheared DNA was end repaired, and hairpin adapters were ligated using T4 DNA ligase. Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III and Exonuclease VII. The resulting DNA templates were purified using SPRI magnetic beads (AMPure, Agencourt Bioscience, Beverly, MA) and annealed to a two-fold molar excess of a sequencing primer that specifically bound to the single-stranded loop region of the hairpin adapters.
SMRTbell templates were subjected to standard SMRT sequencing using an engineered phi29 DNA polymerase on the PacBio RS system according to manufacturer's protocol. The PacBio RS system continuously monitors zero-mode waveguides (ZMWs) in sets of 75000 at a time. Within each ZMW a single DNA polymerase molecule is attached to the bottom surface such that it permanently resides within the detection volume where it can be watched as it performs sequencing by synthesis. Within each chamber, Phospholinked nucleotides, each type labeled with a different colored fluorophore, are then introduced into the reaction solution at high concentrations that promote enzyme speed, accuracy, and processivity. Pulse calling, utilized a threshold algorithm on the dye weighted intensities of fluorescence emissions, and read alignments, achieved using a Smith-Waterman algorithm. Reads were filtered after alignment to remove low quality sequences derived from doubly-loaded ZMWs.
English A.C., Richards S., Han Y., Wang M., Vee V., Qu J., Qin X., Muzny D.M., Reid J.G., Worley K.C, & Gibbs R.A. (2012). Mind the Gap: Upgrading Genomes with Pacific Biosciences RS Long-Read Sequencing Technology. PLoS ONE, 7(11), e47768.
Full text: Click here
Publication 2012
Anabolism DNA DNA-Directed DNA Polymerase DNA Library Enzymes exodeoxyribonuclease III Exonuclease Fluorescent Dyes Genome Melons Molar NCOR2 protein, human Nucleotides Oligonucleotide Primers Pulse Rate T4 DNA Ligase
3
Efficient Multi-part DNA Assembly using Type IIS Enzymes
Cited 146 times
Restriction-ligations were set up by pipetting in one tube approximately 40 fmol (∼100 ng of DNA for a 4 kb plasmid) of each DNA component (PCR product or plasmid), 10 U of the required restriction enzyme (BsaI or BpiI) and 10 U T4 DNA ligase (using high concentration ligase, 20 U/µl) in Promega ligation buffer in a final reaction volume of 20 µl. The reaction was incubated in a thermocycler for 5 hours at 37°C, 5 min at 50°C and 10 min at 80°C. The reaction mix was then added to 100 µl chemically competent DH10b cells, incubated for 15–30 min on ice and transformed by heat shock. 800 µl of liquid LB was then added to the transformation, and the cells were let to recover 45 min at 37°C. Different aliquots of the transformation were plated on LB plates containing the appropriate antibiotic. The number of colonies was counted for one or two selected plates (containing countable number of colonies), or from a section of the plates when very high number of colonies were obtained even for the lowest volume plated. The number of colonies was then extrapolated for the entire transformation.
For level 2-2 cloning, two type IIS enzymes were required, BpiI and BsaI. The same protocol was used as described above except that 10 U and 2.5 U were used for the enzymes BpiI and BsaI, respectively. To optimize efficiency of the restriction-ligation for the final construct containing 11 transcription units (cL2-13*), a variation of this protocol was used as follows. The reaction mix was set up containing 20 U ligase, 5 U BpiI and 5 U BsaI, in a total reaction volume of 20 µl. The mix was incubated in a thermocycler with the following parameters: incubation for 2 minutes at 37°C, 5 minutes at 16°C, both steps repeated 45 times, followed by incubation for 5 minutes at 50°C and 10 minutes at 80°C. The reaction mix was transformed in E. coli chemically competent cells as described above.
Weber E., Engler C., Gruetzner R., Werner S, & Marillonnet S. (2011). A Modular Cloning System for Standardized Assembly of Multigene Constructs. PLoS ONE, 6(2), e16765.
Full text: Click here
Publication 2011
Antibiotics Buffers Cells DNA Restriction Enzymes Enzymes Escherichia coli Heat-Shock Response Ligase Ligation Plasmids Promega T4 DNA Ligase Transcription, Genetic
4
Random Transposon Mutagenesis in S. aureus
Cited 103 times
The mariner-based transposon (Tn) bursa aurealis was used to generate random Tn insertion mutations in S. aureus strain JE2 essentially as described by Bae et al. (4 (link), 43 (link)). First, bacteriophage ϕ11 was used to transduce the bursa aurealis delivery plasmid pBursa into JE2 containing the transposase-encoding plasmid pFA545, with selection on TSA medium containing chloramphenicol (Cm) (10 µg/ml) and Tet (5 µg/ml). After growth for 48 h at 30°C to allow for transposition events, one colony was resuspended in 100 µl of prewarmed 45°C water and then 10 µl was plated onto TSA plates containing erythromycin (Erm) (25 µg/ml) and grown at 45°C for 12 to 24 h. Resulting colonies, irrespective of colony size, were then screened for loss of the temperature-sensitive plasmids pBursa and pFA545 by patching them on TSA-Erm (25 µg/ml), TSA-Cm (10 µg/ml), and TSA-Tet (5 µg/ml). Those colonies that were Cm and Tet susceptible but resistant to Erm were arrayed into 1-ml deep-well plates containing 400 µl of TSB-Erm (5 µg/ml) and grown at 37°C overnight. The next day, 400 µl of 50% glycerol was added to each well and the plates were stored in a −80°C freezer.
To identify the locations of the bursa aurealis transposon insertions, 400 µl of TSB-Erm (5 µg/ml) was inoculated into 96-well plates using a 96-prong replicator. After overnight growth, the Wizard genomic DNA purification kit (Promega) was used to isolate genomic DNA from the cultures with the following modifications. Briefly, after centrifugation at 4,100 rpm for 5 min in a Sorvall (Newtown, CT) Legend tabletop centrifuge, supernatants were removed, the content of each well was resuspended in 110 µl of 50 mM EDTA (pH 8.0), and 5 µl of 10-mg/ml lysostaphin was added. After incubation at 37°C for 60 min, 600 µl of Nuclei Lysis solution was added and the genomic DNA was collected according to the manufacturer’s instructions. After resuspension in Tris-EDTA (TE) buffer, approximately 2 µg of genomic DNA was digested with 10 units of AciI (New England Biolabs) at 37°C for 4 h. AciI was then heat inactivated at 65°C for 30 min; T4 DNA ligase (200 U) (Monserate Biotechnologies, San Diego, CA) was then added to each sample and ligated overnight at 4°C, followed by heat inactivation at 65°C for 30 min. DNA fragments spanning the bursa aurealis insertion sites in each sample were amplified using the Buster (5′ GCTTTTTCTAAATGTTTTTTAAGTAAATCAAGTACC 3′) and Martn-ermR (5′ AAACTGATTTTTAGTAAACAGTTGACGATATTC 3′) primer set. PCR conditions included 30 cycles with an annealing temperature of 63°C and an extension time of 3 min. Once amplified, samples of the DNA products were separated in a 1% agarose gel by electrophoresis, and the remainder was purified for sequencing using Exo-SAP-IT (GE Healthcare) according to the manufacturer’s instructions. Finally, determination of the nucleotide sequences of the genomic DNA flanking the transposons was achieved using the Buster primer at the DNA Microarray and Sequencing Core Facility at the University of Nebraska Medical Center.
Fey P.D., Endres J.L., Yajjala V.K., Widhelm T.J., Boissy R.J., Bose J.L, & Bayles K.W. (2013). A Genetic Resource for Rapid and Comprehensive Phenotype Screening of Nonessential Staphylococcus aureus Genes. mBio, 4(1), e00537-12.
Publication 2013
Bacteriophages Cell Nucleus Centrifugation Chloramphenicol DNA Chips DNA Primers Edetic Acid Electrophoresis Erythromycin Genome Glycerin Jumping Genes Lysostaphin Microarray Analysis Obstetric Delivery Oligonucleotide Primers Plasmids Promega Sepharose Sequence Determinations, DNA Strains Synovial Bursa T4 DNA Ligase Transposase Tromethamine
5
Preparation of Annealed Oligonucleotide Adapters
Cited 97 times
We obtained two HPLC-purified oligonucleotides (Sigma): A_adapter_t and A_adapter_b. We phosphorylated 40 μM oligos at the 5′ end by 1 unit / μl T4 polynucleotide kinase in 1x T4 ligase buffer (both New England Biolabs) for 30 minutes at 37 °C in a thermocycler (MJ Research). We then denatured the kinase by heating, and annealed the oligos by cooling to 20 °C by 0.1 °C every 2 seconds. We divided adapter oligos into single-use aliquots and stored them at -20 °C.
For all other methods, see Supplementary Methods
Kozarewa I., Ning Z., Quail M.A., Sanders M.J., Berriman M, & Turner D.J. (2009). Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of GC-biased genomes. Nature methods, 6(4), 291-295.
Publication 2009
2',5'-oligoadenylate Buffers High-Performance Liquid Chromatographies Neoplasm Metastasis Oligonucleotides Phosphotransferases T4 DNA Ligase

Most recents protocols related to «T4 DNA Ligase»

1
Fusion Polypeptide Library Construction
Not available on PMC !

Example 6

Each plasmid containing EBP, CalM, or a Cys-incorporated block was used to prepare genes for the fusion polypeptide libraries of EBP[G1A3F2]n-CalM-EBP[G1A3F2]n with Cys blocks at both ends. A plasmid vector harboring an EBP gene was digested and dephosphorylated with 10 U of XbaI, 10 U of BseRI and 10 U of FastAP, a thermosensitive alkaline phosphatase, in CutSmart buffer for 30 minutes at 37° C. The restricted plasmid DNA was purified using a PCR purification kit, and then was eluted in 40 μl of distilled and deionized water. A total of 4 μg of the CalM gene was digested with 10 U of XbaI and 15 U of AcuI in the CutSmart buffer for 30 minutes at 37° C. to prepare the CalM gene as an insert, followed by separation using agarose gel electrophoresis and purification using a gel extraction kit. A ligation reaction was performed by incubating 90 pmol of the purified insert with 30 pmol of the linearized vector in T4 DNA ligase buffer containing 1 U of T4 DNA ligase for 30 minutes at 16° C. The product was transformed into Top10 chemically competent cells, then the cells were plated on a SOC plate supplemented with 50 μg/ml of ampicillin. Transformants were initially screened by a diagnostic restriction digest on an agarose gel and further confirmed by DNA sequencing as described above.

US11866470B2. Polypeptides with phase transition, triblock polypeptides of the polypeptide-calmodulin-polypeptide with multi-stimuli responsiveness, hydrogel of the triblock polypeptides, and its uses (2024-01-09). INDUSTRY-UNIVERSITY COOPERATION FOUNDATION HANYANG UNIVERSITY ERICA CAMPUS [KR]. Inventors: Dong Woo Lim [KR], Jae Sang Lee [KR], Min Jung Kang [KR].
Full text: Click here
Patent 2024
Alkaline Phosphatase Ampicillin Buffers Cells Cloning Vectors Diagnosis Electrophoresis, Agar Gel Gene Library Genes Genes, vif Ligation Plasmids Polypeptides Sepharose T4 DNA Ligase
2
Cloning and Expression of P. canceri Genes
Full length iscu, mpgm, and pss P. canceri genes were commercially synthesized in pUC57 plasmids (Genewiz). The pDDGFP_LEUD plasmid (Addgene plasmid #58352) was used for expressing recombinant proteins in Saccharomyces cerevisiae (Parker and Newstead 2014 (link)). Plasmids containing genes of interest and the pDDGPD_LEU2D destination plasmid were recovered using the Nucleospin plasmid DNA purification kit (Macherey-Nagel) following the protocol provided by the manufacturer. Plasmids were linearized with 12 U/µl of SmaI (Promega) at 25 °C for 1 h. SmaI was inactivated at 70 °C for 15 min. Linearized plasmids were digested with 10 U/µl of BamHI (Promega) at 37 °C for 1 h and recipient pDDGPD_LEU2D was dephosphorylated with 1 µl of Thermosensitive Alkaline Phosphatase (TSAP, Promega) at 37 °C during the last 15 min of incubation with BamHI. Finally, TSAP and BamHI were inactivated at 74 °C for 15 min. Digestion products were ligated into dephosphorylated recipient plasmids at a 1:2 vector:insert ratio with 3 U of T4 DNA ligase (Promega) and at room temperature for 15 min according to the protocol of the manufacturer. Ligase was inactivated at 70 °C for 10 min. Exact protocols available upon request from the authors. P. canceri genes were cloned upstream of green fluorescent protein (gfp) encoded on the pDDGFP-LEU2D plasmid and transformed into Escherichia coli DH5α by standard methods and selected on synthetic defined media (LB plus 50 ug/ml ampicillin). Polymerase chain reactions (PCR) were performed to screen for colonies with gene insert using Gotaq Green master mix (Promega) and 10 µM of each primer (Forward primer: gal1 5′”-TCTGGGGTAATTAATCAGCGAAGCG-3′”. Reverse primers: iscu 5′”-GCTCCCGCAGCCGAAAGTCTTAAA −3′”, pss 5′”-AGGATGCGGCCTACTGAATGGACC-3′”, mpgm 5′”- GGGGCATAGGATCCATGACTCAATGGTGTGTA-3′” and gfp 5′”-AGTAGCGTCACCTTCACCTTCACC-3′”) using standard thermocycling conditions (95 °C 5 min; 30 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, final elongation temperature of 72 °C for 10 min). The insertion of P. canceri genes into the pDDGFP_LEU2D vector was confirmed by Sanger sequencing with gal1_forward and gfp_reverse primers (Eurofins).
Onuț-Brännström I., Stairs C.W., Campos K.I., Thorén M.H., Ettema T.J., Keeling P.J., Bass D, & Burki F. (2023). A Mitosome With Distinct Metabolism in the Uncultured Protist Parasite Paramikrocytos canceri (Rhizaria, Ascetosporea). Genome Biology and Evolution, 15(3), evad022.
Full text: Click here
Publication 2023
Alkaline Phosphatase Ampicillin Cloning Vectors Digestion Escherichia coli Gene Insertion Genes Green Fluorescent Proteins HMN (Hereditary Motor Neuropathy) Proximal Type I Ligase Oligonucleotide Primers Plasmids Polymerase Chain Reaction Promega Recombinant Proteins Saccharomyces cerevisiae sulofenur T4 DNA Ligase tartrate-sensitive acid phosphatase
3
FTO Silencing in Gastric Cancer Cells
The sequence of short hairpin FTO (shFTO) was 5′-CACCAAGGAGACTGCTATTTA-3′ and that of nonsense shRNA (sh-NC) was 5′-GCUUCGCGCCGUAGUCUUA-3′. In the design of shFTO and sh-NC, restriction sites (BamHI and EcoRI) and a loop at both the 5′ and 3′ ends and in the middle of the sequence were added. For plasmid construction, the shRNA was added to a 0.2 ml centrifuge tube, placed in a PCR machine at 95°C for 5 min, and then allowed to stand at room temperature for 20 min to form a double-stranded oligo fragment. The psi-LVRU6GP vector (Guangzhou Fulengen Co., Ltd.) was digested with BamHI and EcoRI at 37°C for 1 h, fragments were separated by 0.8% agarose gel electrophoresis, and were then purified using a gel recovery kit (Tiangen Biotech Co.). The double-stranded oligo fragment was mixed with the digested vector, and the ligase reaction was carried out at 16°C overnight with T4 DNA ligase. The ligated product was transformed into competent Escherichia coli DH5α cells and positive clones were selected for using ampicillin. Plasmid DNA was extracted by DNA plasmid extraction kit (Tiangen Biotech Co.) for sequencing and identification. 293T cells were cultured until 80% confluency and then transfected with 2 µg shFTO plasmid or empty vector plasmid and lentivirus package plasmids psPASX2 (1.5 µg) and PMD2G (0.5 µg) at the ratio of 4:3:1 in the presence of 5 µl H4000 (Engreen Biosystem Ltd.). After 48 h of transfection, the virus supernatant was extracted and used to infect AGS and MKN45 cells at an MOI of 40. When the AGS and MKN45 cells reached 90% confluency, puromycin (final concentration, 1 µg/ml) was added and stable cell lines with knocked down FTO expression were isolated after 1 week.
Gui S., Wang Q., Bao L., He X., Wang Z., Liu L., Wu L., Zhao Y., Zhou J, & Xie Y. (2023). Effects of Helicobacter pylori on the expression of the FTO gene and its biological role in gastric cancer. Oncology Letters, 25(4), 143.
Publication 2023
A-Loop Ampicillin Cell Lines Cells Clone Cells Cloning Vectors Deoxyribonuclease EcoRI Electrophoresis, Agar Gel Escherichia coli HEK293 Cells Lentivirus Ligase Mutation, Nonsense Oligonucleotides Plasmids Puromycin Short Hairpin RNA T4 DNA Ligase Transfection Virus
4
Bacterial Cloning of Synthetic MTS1_03028
Both 5′ ends of the phosphorylated synthetic MTS1_03028 fragments optimized for E. coli codons were ligated with SmaI and pGEM7zf (+) and digested with T4 DNA ligase. The product was then transformed into Mach1-competent E. coli. A hundred microliters were spread onto LB agar containing 100 μg/ml ampicillin and statically incubated at 37°C overnight. The plasmids were then isolated and designated pGEM-03028.
Ishida Y., Koretsune T., Ishiuchi E., Teshima M, & Ito M. (2023). A magnesium transporter is involved in the cesium ion resistance of the high-concentration cesium ion-resistant bacterium Microbacterium sp. TS-1. Frontiers in Microbiology, 14, 1136514.
Full text: Click here
Publication 2023
Agar Ampicillin Codon Escherichia coli HMN (Hereditary Motor Neuropathy) Proximal Type I Plasmids prostaglandin M T4 DNA Ligase
5
Multiomics Profiling of Clatharia bisecta
Genomic DNA was extracted from the muscle tissue of C. bisecta using QIAamp DNA Mini Kit (Qiagen), and the DNA was examined with the Agilent 4200 Bioanalyzer (Agilent Technologies). Similarly, metagenomic DNA was exacted from tissues of gill and gonad by an identical progress, respectively.
For WGS sequencing, the DNA was fragmented to 500–800 bp in size with Covaris E220 and selected using AMPure XP beads to obtain fragments around 200 bp. Then the fragments were end-repaired and A-tailed with T4 DNA polymerase (NEB), T4 polynucleotide kinase (NEB), and rTaq DNA polymerase (Takara). After that, the DNA were amplified for eight PCR cycles and sequenced on the BGISEQ-500 platform with a layout of pair-end 100 bp.
For PacBio sequencing, 8 μg of extracted genomic DNA was sheared and concentrated with AMPure PB beads. The libraries were constructed using the Pacific Biosciences SMRTbell express template prep kit 2.0, and the constructed libraries were selected on a BluePippin system for molecules longer than 20 kb. Finally, the templates were primer annealed and bound to polymerases with the DNA/Polymerase Binding Kit, and sequencing was carried out on the Pacific Biosciences Sequel II platform for 15 h.
For Hi-C library construction, gonad tissue was dissociated, and cells were collected and crosslinked with 1% formaldehyde (Sigma) and 0.2M glycine (Sigma). After that, the fixed powder was resuspended in nuclei isolation buffer and then incubated in 0.5% SDS for 10 min at 62°C. Then the reaction was quenched with 10% Triton X-100 (Sigma) and the nuclei were collected by centrifugation. Then the DNA was digested with MboI (NEB), and the overhang was filled and biotinylated before ligated by T4 DNA ligase (NEB). Before library construction, the DNA was purified using the CTAB method. The purified DNA was sheared, and biotin-containing fragments were captured on streptavidin-coated beads using Dynabeads MyOne Streptavidin T1 (Invitrogen). Then the fragments were end-repaired and linked with adaptors before eight cycles of PCR reaction with KAPA HiFi HotStart ReadyMix (Kapa Biosystem). After that, the Hi-C library was sequenced with BGISEQ-500 platform with a layout of pair-end 100 bp.
For RNA sequencing, tissue-specific total RNA was extracted from tissues of adductor muscle, mantle, foot, and gill with TRIzol (Invitrogen), and the reverse transcription was performed with HiscriptII (Vazyme) to generate cDNA. The cDNA fragments were sequenced on the BGISEQ-500 platform with a layout of pair-end 100 bp.
For metagenome sequencing, selected DNA fragments were end-repaired, A-tailed, and amplified, and the libraries were sequenced on the BGISEQ-500 platform with a layout of pair-end 100 bp. In addition, DNA of gill tissues for Oxford Nanopore Technologies (ONT) long-read sequencing was extracted from gill tissues of a third individual with the Blood & Cell Culture DNA Midi Kit (Qiagen), and the library were prepared and sequenced with the Oxford Nanopore Ligation Sequencing Kits SQK-LSK109 according to the manufacturer’s instructions.
Guo Y., Meng L., Wang M., Zhong Z., Li D., Zhang Y., Li H., Zhang H., Seim I., Li Y., Jiang A., Ji Q., Su X., Chen J., Fan G., Li C, & Liu S. (2023). Hologenome analysis reveals independent evolution to chemosymbiosis by deep-sea bivalves. BMC Biology, 21, 51.
Full text: Click here
Publication 2023
Biotin BLOOD Blood Cells Blood Culture BP 100 Buffers Cell Culture Techniques Cell Nucleus Cells Centrifugation Cetrimonium Bromide DNA, A-Form DNA, Complementary DNA-Directed DNA Polymerase DNA Library Foot Formaldehyde Genome Gills Glycine Gonads isolation Ligation Metagenome Muscle Tissue Oligonucleotide Primers Polynucleotide 5'-Hydroxyl-Kinase Powder Reverse Transcription Streptavidin T4 DNA Ligase Tissues Triton X-100 trizol

Top products related to «T4 DNA Ligase»

1
T4 dna ligase by New England Biolabs
Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Morocco, Switzerland, Australia
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in DNA. It is commonly used in molecular biology for the joining of DNA fragments.
2
T4 dna ligase by Thermo Fisher Scientific
Sourced in United States, Germany, China, Lithuania, Canada, Spain, France, United Kingdom, Denmark, Netherlands, India, Switzerland, Hungary
T4 DNA ligase is an enzyme used in molecular biology and genetics to join the ends of DNA fragments. It catalyzes the formation of a phosphodiester bond between the 3' hydroxyl and 5' phosphate groups of adjacent nucleotides, effectively sealing breaks in double-stranded DNA.
3
T4 dna ligase by Takara Bio
Sourced in China, Japan, United States
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate ends in double-stranded DNA. It is commonly used in various molecular biology techniques, such as DNA cloning and DNA repair.
4
T4 dna ligase by Promega
Sourced in United States, Germany, China, United Kingdom, Switzerland, France, Japan, Portugal, Ireland
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in double-stranded DNA molecules. It is commonly used in molecular biology applications, such as DNA cloning and DNA repair.
5
Qiaquick gel extraction kit by Qiagen
Sourced in Germany, United States, Netherlands, United Kingdom, Japan, Canada, France, Spain, China, Italy, India, Switzerland, Austria, Lithuania, Sweden, Australia
The QIAquick Gel Extraction Kit is a product designed for the purification of DNA fragments from agarose gels. It efficiently extracts and purifies DNA from gel slices after electrophoresis.
6
Restriction enzyme by New England Biolabs
Sourced in United States, China, United Kingdom, Germany, Japan, Canada, Morocco, France, Australia
Restriction enzymes are specialized proteins that recognize and cleave specific DNA sequences, known as restriction sites, within a DNA molecule. These enzymes are essential tools in molecular biology and genetic engineering, enabling the manipulation and analysis of DNA sequences.
7
Restriction endonuclease by New England Biolabs
Sourced in United States, China, Germany, United Kingdom, Morocco
Restriction endonucleases are enzymes that cleave DNA at specific recognition sequences, known as restriction sites. These enzymes are widely used in molecular biology and genetic engineering applications.
8
Qiaprep spin miniprep kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Netherlands, Canada, Japan, France, Norway, China, Switzerland, Denmark, Australia, Italy
The QIAprep Spin Miniprep Kit is a laboratory product designed for the rapid and efficient purification of plasmid DNA from bacterial cultures. It is a versatile tool used in various molecular biology applications.
9
Qiaquick pcr purification kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, France, Japan, China, Canada, Italy, Australia, Switzerland, Singapore, Sweden, India, Malaysia
The QIAquick PCR Purification Kit is a lab equipment product designed for the rapid purification of PCR (Polymerase Chain Reaction) amplicons. It utilizes a silica-membrane technology to efficiently capture and purify DNA fragments from PCR reactions, removing unwanted primers, nucleotides, and enzymes.
10
T4 polynucleotide kinase by New England Biolabs
Sourced in United States, Germany, United Kingdom, China, Morocco, Japan
T4 polynucleotide kinase is an enzyme that catalyzes the transfer of the gamma-phosphate from ATP to the 5' hydroxyl terminus of DNA, RNA, or oligonucleotides. This enzyme is commonly used in molecular biology for labeling nucleic acids with radioactive or fluorescent tags.

More about "T4 DNA Ligase"