Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > TBK1 protein, human

TBK1 protein, human

TBK1, also known as TANK-binding kinase 1, is a serine/threonine protein kinase that plays a crucial role in innate immunity and inflammatory signaling pathways.
It is involved in the activation of transcription factors such as interferon regulatory factor 3 (IRF3) and nuclear factor-kappa B (NF-κB), which regulate the expression of genes involved in the immune response.
TBK1 is an important regulator of antiviral and antibacterial defenses, and it has been implicated in the pathogenesis of various inflammatory and autoimmune disorders.
Researchers studyting TBK1 can optimize their work with PubCompare.ai, an AI-powered tool that enhances reproducibility and accuaracy by helping them easily locate protocols from literature, preprints, and patents, while using intelligent comparisons to identify the best methods and products.
Experience seamless and efficient TBK1 research with PubCompare.ai.

Most cited protocols related to «TBK1 protein, human»

1
Genome-wide RNAi Screens Identify KRAS-NF-κB Signaling
Cited 1026 times
Large-scale, arrayed format RNAi screens to identify genes essential for proliferation/viability were performed as described3 (link),14 (link). The effect of introducing each of the 5002 shRNAs (targeting 957 genes) was determined in 19 cell lines, and normalized using the B-score metric4 (link). Feature selection of shRNA B-score data was performed using the Comparative Marker Application Suite in GenePattern5 (link) and was independently analyzed using RIGER analysis6 (link) to compute NES for each gene. Secondary screen viability data was normalized using a percent of control statistic, given the biased nature of the candidate shRNA plate. Expression profiling was used to generate a signature that correlates with KRAS activation and implicated NF-κB signaling in cell lines and tumors dependent on KRAS. Regulation of NF-κB by TBK1 was shown using biochemical and cell biological approaches. Details of the analytical methods are provided in the Full Methods.
Barbie D.A., Tamayo P., Boehm J.S., Kim S.Y., Moody S.E., Dunn I.F., Schinzel A.C., Sandy P., Meylan E., Scholl C., Fröhling S., Chan E.M., Sos M.L., Michel K., Mermel C., Silver S.J., Weir B.A., Reiling J.H., Sheng Q., Gupta P.B., Wadlow R.C., Le H., Hoersch S., Wittner B.S., Ramaswamy S., Livingston D.M., Sabatini D.M., Meyerson M., Thomas R.K., Lander E.S., Mesirov J.P., Root D.E., Gilliland D.G., Jacks T, & Hahn W.C. (2009). Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1. Nature, 462(7269), 108-112.
Publication 2009
Biopharmaceuticals Cell Lines Cells Genes K-ras Genes Neoplasms RELA protein, human RNA Interference Short Hairpin RNA TBK1 protein, human
2
Genome-wide RNAi Screens Identify KRAS-NF-κB Signaling
Cited 922 times
Large-scale, arrayed format RNAi screens to identify genes essential for proliferation/viability were performed as described3 (link),14 (link). The effect of introducing each of the 5002 shRNAs (targeting 957 genes) was determined in 19 cell lines, and normalized using the B-score metric4 (link). Feature selection of shRNA B-score data was performed using the Comparative Marker Application Suite in GenePattern5 (link) and was independently analyzed using RIGER analysis6 (link) to compute NES for each gene. Secondary screen viability data was normalized using a percent of control statistic, given the biased nature of the candidate shRNA plate. Expression profiling was used to generate a signature that correlates with KRAS activation and implicated NF-κB signaling in cell lines and tumors dependent on KRAS. Regulation of NF-κB by TBK1 was shown using biochemical and cell biological approaches. Details of the analytical methods are provided in the Full Methods.
Barbie D.A., Tamayo P., Boehm J.S., Kim S.Y., Moody S.E., Dunn I.F., Schinzel A.C., Sandy P., Meylan E., Scholl C., Fröhling S., Chan E.M., Sos M.L., Michel K., Mermel C., Silver S.J., Weir B.A., Reiling J.H., Sheng Q., Gupta P.B., Wadlow R.C., Le H., Hoersch S., Wittner B.S., Ramaswamy S., Livingston D.M., Sabatini D.M., Meyerson M., Thomas R.K., Lander E.S., Mesirov J.P., Root D.E., Gilliland D.G., Jacks T, & Hahn W.C. (2009). Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1. Nature, 462(7269), 108-112.
Publication 2009
Biopharmaceuticals Cell Lines Cells Genes K-ras Genes Neoplasms RELA protein, human RNA Interference Short Hairpin RNA TBK1 protein, human
3
Autophagy-related Protein Plasmid Construction
Cited 15 times
pMXs-puro-GFP-WIPI1 and pMXs-puro-GFP-DFCP1 were a kind gift from Dr. N. Mizushima (University of Toyko, Japan) and pMXs-IP-GFP-ULK1 was purchased from Addgene (#38193). To generate pBMN-mEGFP-C1, mEGFP-C1 (Addgene #36412) was PCR amplified (together with the multiple cloning site) and cloned into pBMN-Z at BamHI/SalI sites using the Gibson Cloning kit (New England BioLabs) according to manufacturer's instructions. The BamHI and SalI sites used to insert mEGFP-C1 were not regenerated. The following GFP-tagged plasmids were generated by PCR amplification of open reading frames followed by ligation into pBMN-mEGFP-C1: OPTN, NDP52, p62, TAX1BP1, NBR1, LC3A, LC3B, LC3C, GABARAP, GABARAPL1, GABARAPL2. The Gateway Cloning (Invitrogen) system was used to generate GFP-, mCherry-, myc- and FLAG/HA-constructs. Briefly, TBK1, TBK1-K38M, NDP52, OPTN, p62, DFCP1, WIPI1 and ULK1 were cloned into pDONR2333. Mutations in cDNA sequences were introduced using PCR site directed mutagenesis in the pDONR2333 vector, (sequences of mutagenesis primers used are available upon request) then recombined into pHAGE-N-FLAG/HA, pHAGE-N-GFP, pHAGE-N-mCherry and/or pDEST-N-myc using LR Clonase (Invitrogen) as per the manufacturer's protocol. All constructs generated in this study were verified by sequencing.
To generate stably transfected cell lines, retroviruses (for pBMN-mEGFP-C1 constructs, pBMN-mCherry-Parkin, pBMN-puro-P2A-FRB-Fis1, pCHAC-mt-mKeima-IRES-MCS2) and lentiviruses (for pHAGE- and pDEST- constructs) were packaged in HEK293T cells. HeLa cells were transduced with virus for 24 h with 8 μg/ml polybrene (Sigma) then optimized for protein expression via selection (puromycin or blasticidin) or fluorescence sorting.
Lazarou M., Sliter D.A., Kane L.A., Sarraf S.A., Wang C., Burman J.L., Sideris D.P., Fogel A.I, & Youle R.J. (2015). The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature, 524(7565), 309-314.
Publication 2015
Bacteriophages Cell Lines Cells Cloning Vectors DNA, Complementary Fluorescence HeLa Cells Internal Ribosome Entry Sites Lentivirus Ligation Mutagenesis Mutagenesis, Site-Directed Mutation Oligonucleotide Primers Open Reading Frames PARK2 protein, human Plasmids Polybrene Proteins Puromycin Retroviridae TBK1 protein, human ULK1 protein, human Virus
4
Comprehensive Cell Culture and Antibody Protocol
Cited 14 times
HEK293T, HeLa and PINK1 KO35 cells were cultured in Dulbecco's modified eagle medium (Life Technologies) supplemented with 10% (v/v) Fetal Bovine Serum (Gemini Bio Products), 10 mM HEPES (Life Technologies), 1 mM Sodium Pyruvate (Life Technologies), nonessential amino acids (Life Technologies) and GlutaMAX (Life Technologies). HeLa cells were acquired from the ATCC and authenticated by the Johns Hopkins GRCF Fragment Analysis Facility using STR profiling. All cells were tested for mycoplasma contamination bimonthly using the PlasmoTest kit (InvivoGen). Transfection reagents used were: Effectene (Qiagen), Lipofectamine LTX (Life Technologies), Avalanche-OMNI (EZ Bio-systems), X-tremeGENE HP (Roche) and X-tremeGENE 9 (Roche).
Rabbit monoclonal and polyclonal antibodies used: Beclin, pULK1-S317, pULK1-S757, TBK1, pTBK1-S172, NDP52, TAX1BP1, ATG5, Actin, and HA (Cell Signaling Technologies); GAPDH and LC3B (Sigma); ULK1 and Tom20 (Santa Cruz Biotechnology); Optineurin (OPTN) (Proteintech); GFP (Life Technologies); pSer65 ubiquitin (Millipore) and Mfn1 was generated previously36 (link). Mouse monoclonal antibodies used: NBR1 and p62 (Abnova), Cytochrome C oxidase subunit II (CoxII, Abcam), Parkin (Santa Cruz Biotechnology), DNA (Progen Biotechnik), ubiquitin (Cell Signaling). Chicken anti-GFP (Life Technologies) was also used. For catalog numbers see Supplementary Table 1. Human tissue panel blots were purchased (NOVUS Biologicals).
Lazarou M., Sliter D.A., Kane L.A., Sarraf S.A., Wang C., Burman J.L., Sideris D.P., Fogel A.I, & Youle R.J. (2015). The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature, 524(7565), 309-314.
Publication 2015
Actins Amino Acids Antibodies Avalanches Biological Factors Cells Chickens Culture Media cytochrome C oxidase subunit II Eagle Effectene Fetal Bovine Serum GAPDH protein, human HeLa Cells HEPES Homo sapiens Lipofectamine Monoclonal Antibodies Mus Mycoplasma Novus OPTN protein, human PARK2 protein, human Progens PTGS2 protein, human Pyruvate Rabbits Sodium TBK1 protein, human Tissues Transfection Ubiquitin ULK1 protein, human
5
Murine Models of Viral Immune Responses
Cited 13 times
C57BL/6 wild-type mice were commercially obtained (Jackson Laboratories, Bar Harbor, ME). IFN-αβ receptor (IFN-αβR)−/− congenic C57BL/6 mice were the kind gift of J. Sprent (La Jolla, CA). The congenic backcrossed IRF-3−/−[37] (link), IRF-5−/−[41] (link), and IRF-7−/−[14] (link) mice were the kind gift of T. Taniguchi (Tokyo, Japan) and provided generously by colleagues in the United States (I. Rifkin, Boston, MA and K. Fitzgerald, Worcester, MA). The IRF-1−/− mice were obtained commercially (Jackson Laboratories). The IRF-8−/− mDC were obtained from bone marrow of IRF-8−/− mice [36] (link) and were a generous gift of P. Tailor and K. Ozato (Bethesda, MD). The TRAF3−/− and TRAF6−/− MEF were kindly provided by G. Cheng (UCLA, Los Angeles, CA) and T. Mak (University of Toronto, Canada), respectively. The TBK1 MEF were obtained from B. TenOever (Mount Sinai Hospital, NY). IRF-3−/−× IRF-7−/− DKO mice were generated after large-scale crossing and recombination in the F1 generation because of the 1 cM linkage of the two loci. DKO mice were genotyped and bred in the animal facilities of the Washington University School of Medicine, and experiments were performed with approval of the Washington University Animal Studies Committee. Eight to twelve week-old age-matched mice were used for all in vivo studies. 102 PFU of WNV was diluted in Hanks balanced salt solution (HBSS) supplemented with 1% heat-inactivated fetal bovine serum (FBS) and inoculated by footpad injection in a volume of 50 µl.
Daffis S., Suthar M.S., Szretter K.J., Gale, M J.r, & Diamond M.S. (2009). Induction of IFN-β and the Innate Antiviral Response in Myeloid Cells Occurs through an IPS-1-Dependent Signal That Does Not Require IRF-3 and IRF-7. PLoS Pathogens, 5(10), e1000607.
Full text: Click here
Publication 2009
Animals Bone Marrow Fetal Bovine Serum Hanks Balanced Salt Solution IRF1 protein, human IRF3 protein, human IRF5 protein, human IRF7 protein, human IRF8 protein, human Mice, Congenic Mice, Inbred C57BL Mus Recombination, Genetic TBK1 protein, human TNF Receptor-Associated Factor 3 TNF Receptor Associated Factor 6

Most recents protocols related to «TBK1 protein, human»

1
Generation of Single and Double Knockout Cell Lines
PARP1, PARP7, STING, and TBK1 single‐gene knockout cells were generated by lentiviral transfection followed by puromycin selection. The pLenti CRISPRv2 vectors inserted with specific sgRNA oligos were transfected together with psPAX2 and pMD2G to product lentiviruses. The sgRNA sequences designed for human PARP1 knockout were 5′‐CGATGCCTATTACTGCACTG‐3′, 5′‐AGCTAGGCATGATTGACCGC‐3′, and 5′‐CCGGCACCCTGACGTTGAGG‐3′; sgRNA sequence designed for human PARP7 knockout was 5′‐CACTGAAGCTCCAGAACGAG‐3′; sgRNA sequence designed for human STING knockout was 5′‐GGCTGTCACTCACAGGTACC‐3′; sgRNA sequence designed for human TBK1 knockout was 5′‐AGAGCACTTCTAATCATCTG‐3′; sgRNA sequence designed for mouse Parp1 knockout was 5′‐ CGAGTGGAGTACGCGAAGAG‐3′; sgRNA sequence designed for mouse Parp7 knockout was 5′‐AAGGATGCGCTTCTGGTAAT‐3′.
HT‐29 PARP1−/− PARP7−/− double genes knockout cells were conducted by transfecting HT29 PARP7 KO clone cells with lentiviral containing specifically edited pLX‐sgRNA followed by blasticidin selection. The sgRNA sequences designed for PARP1 knockout was 5′‐ CGATGCCTATTACTGCACTG‐3′.
Wang L., Wang P., Chen X., Yang H., Song S., Song Z., Jia L., Chen H., Bao X., Guo N., Huan X., Xi Y., Shen Y., Yang X., Su Y., Sun Y., Gao Y., Chen Y., Ding J., Lang J., Miao Z., Zhang A, & He J. (2023). Thioparib inhibits homologous recombination repair, activates the type I IFN response, and overcomes olaparib resistance. EMBO Molecular Medicine, 15(3), e16235.
Full text: Click here
Publication 2023
2',5'-oligoadenylate Cells Clone Cells Cloning Vectors Gene Knockout Techniques Genes Homo sapiens HT29 Cells Lentivirus Mice, Knockout PARP1 protein, human Parp1 protein, mouse Puromycin TBK1 protein, human Transfection
2
Western Blotting for DNA Damage Signaling
The standard western blotting protocol was conducted to detect the levels of indicated proteins as described previously (Yuan et al, 2017 (link); Li et al, 2021 (link)). Antibody against GAPDH (AF0006) was from Beyotime (Shanghai, China). Antibodies against γ‐H2AX (#2577), CDT1 (#8064), Chk1 (#2360), p‐Chk1(S317, #2344), p‐Chk2 (Thr68, #2661), caspase‐3 (#9662), caspase‐7 (#12827), caspase 9 (#9502), PARP (#9542), Bak (#12105), BID (#2002), Puma (#4976), Noxa (#14766), Bcl‐XL (#2764), XIAP (#14334), MRE11 (#4895), c‐IAP1 (#7943), c‐IAP2 (#3130), STAT1 (#14994), p‐STAT1 (Tyr701, #9167), p‐STAT1 (Ser727, #8826), STAT3 (#9139), p‐STAT3 (Ser727, #9145), STING (#13647), p‐STING (#19781), TBK1 (#3504), p‐TBK1 (#5483), IRF3 (#11904), p‐IRF3 (Ser386, #37829), p38 (#9212), p‐p38 (#9211), ERK1/2 (#9102), p‐ERK1/2 (#4370), MEK1/2 (#4694), p‐MEK1/2 (#9154), JNK (#9252), Axin2 (#2151), KU70 (#4588) and KU80 (#2753) were from Cell Signaling Technology. Antibodies against RPA32 (sc‐271578), Bax (sc‐493), MCL1 (sc‐819), PTIP (sc‐367459), Chk2 (sc‐9604), PARP2 (sc‐30622), XRCC1 (sc‐11429), XRCC3 (sc‐271714), MLH1 (sc‐581), MSH2 (sc‐494), TNKS1/2 (sc‐365897), p‐JNK (sc‐6254), PARP1 (sc‐7150) and PAR [pADPr (10H) (sc‐56198)] were from Santa Cruz Biotechnology (Santa Cruz, CA). Antibody against p‐RPA32 (PLA0071) was from Sigma (Shanghai, China). Antibody against RAD51 (ab63801), CTIP (ab70163), MCRS1/MSP58 (ab247013) and PALB2 (ab202970) were from Abcam. Antibody against MAD2L2/REV7 (BD‐612266) was from BD Biosciences. Antibody against BRCA1 (OP92) and BRCA2 (OP95) were from Millipore. Goat anti‐mouse IgG horseradish peroxidase antibody was provided by Merk/Calbiochem (Darmstadt, Germany). All of the primary antibodies, except for GAPDH, were used after 1:1,000 dilution, and GAPDH primary antibody was used after 1:5,000 dilution. Second antibodies were used following 1:2,000 dilution.
Wang L., Wang P., Chen X., Yang H., Song S., Song Z., Jia L., Chen H., Bao X., Guo N., Huan X., Xi Y., Shen Y., Yang X., Su Y., Sun Y., Gao Y., Chen Y., Ding J., Lang J., Miao Z., Zhang A, & He J. (2023). Thioparib inhibits homologous recombination repair, activates the type I IFN response, and overcomes olaparib resistance. EMBO Molecular Medicine, 15(3), e16235.
Full text: Click here
Publication 2023
Antibodies Antibodies, Anti-Idiotypic AXIN2 protein, human BIRC2 protein, human BIRC3 protein, human BRCA1 protein, human Caspase-7 Caspase 3 Caspase 9 GAPDH protein, human Gene, BRCA2 Goat IGG-horseradish peroxidase Immunoglobulins IRF3 protein, human MAP2K1 protein, human MCL1 protein, human Mitogen-Activated Protein Kinase 3 MLH1 protein, human Mus PALB2 protein, human PARP1 protein, human PARP2 protein, human Proteins Puma RBBP8 protein, human STAT1 protein, human STAT3 protein, human TBK1 protein, human Technique, Dilution XRCC1 protein, human XRCC3 protein, human Xrcc6 protein, human
3
Immunoblotting Analysis of STING Pathway
Protein was extracted from the cells using RIPA buffer, resolved by SDS–polyacrylamide gels and then transferred to PVDF membranes. Primary antibodies against STING (1:1000; CST, 13647), Phospho-TBK1 (1:1000; CST, 5483), TBK1 (1:1000; CST, 38066), Phospho-IRF-3 (1:1000; CST, 29047), IRF-3 (1:1000; CST, 4302), Phospho-p65 (1:1000; CST, 3033), p65 (1:1000; CST, 8242), GAPDH (1:1000; CST, 5174) and β-actin (1:1000; CST, 4970) were used. Peroxidase-conjugated secondary antibody (CST, 7077/7076) was used, and the antigen–antibody reaction was visualized by enhanced chemiluminescence assay (ECL, ThermoFisher, 34580).
Liu J., Xiang J., Jin C., Ye L., Wang L., Gao Y., Lv N., Zhang J., You F., Qiao H, & Shi L. (2023). Medicinal plant-derived mtDNA via nanovesicles induces the cGAS-STING pathway to remold tumor-associated macrophages for tumor regression. Journal of Nanobiotechnology, 21, 78.
Full text: Click here
Publication 2023
Actins Antibodies Antigen-Antibody Reactions Buffers Chemiluminescent Assays GAPDH protein, human Immunoglobulins IRF3 protein, human Peroxidase polyacrylamide gels polyvinylidene fluoride Proteins Radioimmunoprecipitation Assay TBK1 protein, human Tissue, Membrane
4
Molecular Signaling Pathway Plasmids
The expression plasmids of cGAS, STING, RIG-I N, TBK1, IRF3, IRF3-5D, IκB-sr, HA-Ub-WT and HA-Ub-K0, and luciferase reporter plasmids IFNB-Luc, IRF3-Luc, TK-Luc have been described previously [44 (link),46 (link),81 (link)]. The EBV protein expression library was kindly provided by Lori Frappier from University of Toronto, and the p2089 bacmid was provided by Wolfgang Hammerschmidt from German Center for Infection Research (Munich, Germany). The expression constructs of BPLF1 mutant C61A, HA-Ub-K63, HA-Ub-K48, HA-Ub-K27, HA-Ub-K63R, HA-Ub-K48R were constructed by Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Lenti-MPHv2 and lenti-SAMv2 plasmids [45 (link)] were gifts from Feng Zhang from Broad Institute.
Lui W.Y., Bharti A., Wong N.H., Jangra S., Botelho M.G., Yuen K.S, & Jin D.Y. (2023). Suppression of cGAS- and RIG-I-mediated innate immune signaling by Epstein-Barr virus deubiquitinase BPLF1. PLOS Pathogens, 19(2), e1011186.
Full text: Click here
Publication 2023
cDNA Library Chromogranin A DDX58 protein, human Genus Loris Gifts Infection Interferon, beta IRF3 protein, human Luciferases Mutagenesis, Site-Directed Plasmids Proteins TBK1 protein, human
5
Antibody Validation for Protein Signaling
Mouse anti-Myc (9E10), rabbit anti-HA (F-7), mouse anti-α-tubulin (B-7) and mouse anti-β-tubulin (3F3-G2) antibodies were purchased from Santa Cruz. Mouse anti-Flag (F3165), rabbit anti-Flag (F7425) and mouse anti-ubiquitin (P4D1) antibodies were purchased from Sigma-Aldrich. Rabbit anti-cGAS (D1D3G), rabbit anti-STING (D2P2F) and rabbit anti-TBK1 (D1B4) antibodies were from Cell Signaling Technology. Mouse anti-V5 (E10/V4RR) antibodies were from Invitrogen.
Lui W.Y., Bharti A., Wong N.H., Jangra S., Botelho M.G., Yuen K.S, & Jin D.Y. (2023). Suppression of cGAS- and RIG-I-mediated innate immune signaling by Epstein-Barr virus deubiquitinase BPLF1. PLOS Pathogens, 19(2), e1011186.
Full text: Click here
Publication 2023
alpha-Tubulin Antibodies Chromogranin A Mus Rabbits TBK1 protein, human Tubulin Ubiquitin

Top products related to «TBK1 protein, human»

1
Anti tbk1 by Cell Signaling Technology
Sourced in United States
Anti-TBK1 is a research-use-only antibody product from Cell Signaling Technology. It is designed to detect the expression of TBK1 (TANK-binding kinase 1), a serine/threonine protein kinase that plays a key role in innate immune signaling pathways.
2
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
3
P tbk1 by Cell Signaling Technology
Sourced in United States, China, United Kingdom
P-TBK1 is a phospho-specific antibody that recognizes TBK1 (TANK-binding kinase 1) when phosphorylated at Ser172. TBK1 is a serine/threonine protein kinase that plays a role in innate immune response and inflammatory signaling pathways.
4
P irf3 by Cell Signaling Technology
Sourced in United States, United Kingdom
P-IRF3 is a primary antibody that specifically recognizes the phosphorylated form of the transcription factor Interferon Regulatory Factor 3 (IRF3). IRF3 plays a key role in the activation of type I interferon genes in response to viral infection or other stimuli.
5
Anti irf3 by Cell Signaling Technology
Sourced in United States, United Kingdom, China
Anti-IRF3 is a primary antibody that targets the Interferon Regulatory Factor 3 (IRF3) protein. IRF3 is a transcription factor that plays a key role in the activation of type I interferon genes in response to viral infection or other cellular stressors. This antibody can be used to detect and quantify IRF3 expression or activation in various experimental systems.
6
β actin by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, Sweden, Netherlands, Switzerland, Italy, Belgium, Australia, France, India, Ireland
β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is an important component of the microfilament system and is involved in various cellular processes such as cell motility, structure, and integrity.
7
Anti phospho tbk1 by Cell Signaling Technology
Sourced in United States, China
Anti-phospho-TBK1 is a laboratory reagent that detects the phosphorylated form of TBK1 (TANK-Binding Kinase 1), a serine/threonine protein kinase involved in cellular signaling pathways. This product is intended for research use only.
8
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.
9
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
10
Gapdh by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, France, Netherlands, Ireland, Israel, Australia, Sweden, Macao, Switzerland
GAPDH is a protein that functions as an enzyme involved in the glycolysis process, catalyzing the conversion of glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate. It is a common reference or housekeeping protein used in various assays and analyses.

More about "TBK1 protein, human"