Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > TdTomato

TdTomato

TdTomato: A Fluorescent Protein Marker for Tracking Cell Lineage and Activity.
TdTomato is a dimeric red fluorescent protein derived from the marine coral Discosoma sp.
It is widely used as a genetically-encoded fluorescent label to visualize and track specific cell populations in live tissues and organisms.
TdTomoto offers bright, photostable fluorescence and can be easily detected using standard fluorescent microscopy and imaging techniques.
Researchers leverage TdTomato to study cell fate, migration, proliferation and other dynamic biological processes with high spatiotemporal resolution.
This versitile marker has become an invaluable tool for advanceing our understanding of complex tissue architectures and cell-cell interactions.

Most cited protocols related to «TdTomato»

1
Transgenic Mouse Line Generation via Targeted Gene Insertion
Cited 67 times
Targeting constructs were generated using a combined gene synthesis (GenScript) and molecular cloning approach. ChR2(H134R)-tdTomato was synthesized based on the hChR2 sequence 26 (link), and ChR2(H134R)-EYFP was synthesized based on the ChR2 sequence 3 (link). Both fragments, as well as the ss-Arch-EGFP-ER2 6 (link) and the eNpHR3.0-EYFP 23 (link) fragments, were each cloned into a Rosa26-pCAG-LSL-WPRE-bGHpA targeting vector 9 (link), in between LSL and WPRE sequences. LSL sequence contains specifically LoxP – Stop codons – 3x SV40 polyA – LoxP.
The targeting vectors were linearized and transfected into the 129/B6 F1 hybrid ES cell line G4 44 (link). G418-resistant ES clones were first screened by PCR using primers spanning the 1.1 kb 5’ genomic arm (forward primer: 5’-gggctccggctcctcagaga-3’, reverse primer: 5’-atgccaggcgggccatttac-3’), and then confirmed by Southern blot analysis of HindIII digested DNA, which was probed with a 1.1 kb genomic fragment from immediately upstream of the 5’ arm. Positive ES clones were injected into C57BL/6J blastocysts to obtain chimeric mice following standard procedures. Chimeric mice were bred with C57BL/6J mice to obtain germline transmitted F1 mice. The reporter mice can be bred with the Rosa26-PhiC31 mice (JAX Stock # 007743) 45 (link) to delete the PGK-neo cassette in the germline of the mice.
Madisen L., Mao T., Koch H., Zhuo J.M., Berenyi A., Fujisawa S., Hsu Y.W., Garcia AJ I.I.I., Gu X., Zanella S., Kidney J., Gu H., Mao Y., Hooks B.M., Boyden E.S., Buzsáki G., Ramirez J.M., Jones A.R., Svoboda K., Han X., Turner E.E, & Zeng H. (2012). A toolbox of Cre-dependent optogenetic transgenic mice for light-induced activation and silencing. Nature neuroscience, 15(5), 793-802.
Publication 2012
Anabolism antibiotic G 418 Base Sequence Blastocyst Chimera Clone Cells Cloning Vectors Codon, Terminator Genes Genome Germ Line Hybrid Cells Mice, Inbred C57BL Mus Oligonucleotide Primers Poly A Simian virus 40 Southern Blotting tdTomato
2
Generation and Characterization of 2C::tomato ES Cells
Cited 50 times
2C∷tomato was created by digesting the MERVL LTR-Gag clone #929 with MluI and HindIII, resulting in MERVL LTR 1-730, and was ligated into pcDNA3 hygro tdtomato with CMV promoter removed. To generate 2C∷tomato ES cells, Kdm1a Fl/Fl; Cre:ERT ES cells were transfected with 2C∷tomato using Lipofectamine 2000 (Invitrogen) and selected with 150ug/ml hygromycin for 7 days. Colonies containing tomato+ cells were then picked and expanded. 2C∷ERT2-Cre-ERT2 was generated by replacing tdtomato with an ERT2-Cre-ERT2 insert using EcoR1 and Not1 sites. DNA was linearized with Mlu1 and AvrII sites before injection into embryos to generate transgenic mice. The resulting mice were mated with ROSA∷LSL-tomato mice (JAX 007905), ROSA∷LSL-DTA mice (JAX 010527), or ROSA∷LSL-LacZ mice (Gift of Anderson lab), and ES lines were derived using standard procedures. Kdm1a GT/GT, Kdm1a Fl/Fl, KAP1 ES3 Cre, and G9A TT2 ES cells were described previously29 –31 (link). RNA-Seq from oocytes and 2C embryos was performed by lysing litters of embryos (5–10 embryos) in Prelude Direct lysis buffer (Nugen) and amplifying RNA using the Ovation RNA-Seq system (Nugen) before library construction using the Tru-Seq RNA sample prep kit (Illumina). Microarray, QRT-PCR, immunostaining, and chimeric mouse injections were performed as described29 . All animal experiments we performed in accordance with the Salk Institute's IACUC guidelines.
Macfarlan T.S., Gifford W.D., Driscoll S., Lettieri K., Rowe H.M., Bonanomi D., Firth A., Singer O., Trono D, & Pfaff S.L. (2012). ES cell potency fluctuates with endogenous retrovirus activity. Nature, 487(7405), 57-63.
Publication 2012
Buffers Cells Chimera Clone Cells DNA Library Embryo Embryonic Stem Cells hygromycin A Institutional Animal Care and Use Committees KDM1A protein, human LacZ Genes lipofectamine 2000 Lycopersicon esculentum Mice, Laboratory Mice, Transgenic Microarray Analysis mitogen-activated protein kinase 3, human Ovum Patient Holding Stretchers RNA-Seq Rosa tdTomato TRIM28 protein, human Vascular Access Ports
3
Generation and Characterization of 2C::tomato ES Cells
Cited 48 times
2C∷tomato was created by digesting the MERVL LTR-Gag clone #929 with MluI and HindIII, resulting in MERVL LTR 1-730, and was ligated into pcDNA3 hygro tdtomato with CMV promoter removed. To generate 2C∷tomato ES cells, Kdm1a Fl/Fl; Cre:ERT ES cells were transfected with 2C∷tomato using Lipofectamine 2000 (Invitrogen) and selected with 150ug/ml hygromycin for 7 days. Colonies containing tomato+ cells were then picked and expanded. 2C∷ERT2-Cre-ERT2 was generated by replacing tdtomato with an ERT2-Cre-ERT2 insert using EcoR1 and Not1 sites. DNA was linearized with Mlu1 and AvrII sites before injection into embryos to generate transgenic mice. The resulting mice were mated with ROSA∷LSL-tomato mice (JAX 007905), ROSA∷LSL-DTA mice (JAX 010527), or ROSA∷LSL-LacZ mice (Gift of Anderson lab), and ES lines were derived using standard procedures. Kdm1a GT/GT, Kdm1a Fl/Fl, KAP1 ES3 Cre, and G9A TT2 ES cells were described previously29 –31 (link). RNA-Seq from oocytes and 2C embryos was performed by lysing litters of embryos (5–10 embryos) in Prelude Direct lysis buffer (Nugen) and amplifying RNA using the Ovation RNA-Seq system (Nugen) before library construction using the Tru-Seq RNA sample prep kit (Illumina). Microarray, QRT-PCR, immunostaining, and chimeric mouse injections were performed as described29 . All animal experiments we performed in accordance with the Salk Institute's IACUC guidelines.
Macfarlan T.S., Gifford W.D., Driscoll S., Lettieri K., Rowe H.M., Bonanomi D., Firth A., Singer O., Trono D, & Pfaff S.L. (2012). ES cell potency fluctuates with endogenous retrovirus activity. Nature, 487(7405), 57-63.
Publication 2012
Buffers Cells Chimera Clone Cells DNA Library Embryo Embryonic Stem Cells hygromycin A Institutional Animal Care and Use Committees KDM1A protein, human LacZ Genes lipofectamine 2000 Lycopersicon esculentum Mice, Laboratory Mice, Transgenic Microarray Analysis mitogen-activated protein kinase 3, human Ovum Patient Holding Stretchers RNA-Seq Rosa tdTomato TRIM28 protein, human Vascular Access Ports
4
Optogenetic Manipulation of Neural Circuits
Cited 44 times
All procedures were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Massachusetts Institute of Technology Committee on Animal Care. C57BL/6J E16-timed pregnant mice were used for electroporation. Surgery was done under ketamine-xylazine anesthesia and buprenorphine analgesia. For cortical experiments, DNA solution containing plasmids of interest were injected into lateral ventricle of each embryo using a pulled capillary tube. Five square pulses (50ms width, 1Hz, 35V) were applied using tweezer electrode for electroporation (Harvard Apparatus, ECM 830). Direct opsin-expressing experimental mice were electroporated with pCAG-opsin-GFP plasmid. Post-synaptic experimental mice were electroporated with pCAG-FLEX-rc[Chronos-GFP] and/or pCAG-FLEX-Chrimson-mOrange2, and pCAG-Cre plasmids. pCAG-Chrimson-tdTomato was additionally used in half of the single post-synaptic experiments.
For the retinal ganglion cell-superior colliculus experiment, intravitreal virus injection was performed on P0 C57BL/6 mice with Nanoject II (Drummond) under cold anesthesia. 100 nL of rAAV2/8-Synapsin-Chronos-GFP (titer 1.4×1013 particles/mL) was injected into the eye. AAV particles were produced by the University of North Carolina Chapel Hill Vector Core.
Klapoetke N.C., Murata Y., Kim S.S., Pulver S.R., Birdsey-Benson A., Cho Y.K., Morimoto T.K., Chuong A.S., Carpenter E.J., Tian Z., Wang J., Xie Y., Yan Z., Zhang Y., Chow B.Y., Surek B., Melkonian M., Jayaraman V., Constantine-Paton M., Wong G.K, & Boyden E.S. (2014). Independent Optical Excitation of Distinct Neural Populations. Nature methods, 11(3), 338-346.
Publication 2014
Anesthesia Animals Animals, Laboratory Buprenorphine Capillaries Cloning Vectors Common Cold Cortex, Cerebral Electroporation Therapy Embryo Ketamine Management, Pain Mice, Inbred C57BL Mus Operative Surgical Procedures Plasmids Pulses Retinal Ganglion Cells Rod Opsins Synapsins tdTomato Tectum, Optic Ventricle, Lateral Virus Xylazine
5
Tracing Cre-Expressing Neuron Axons
Cited 42 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
Animals Animals, Transgenic Axon Brain Cloning Vectors Neurites tdTomato

Most recents protocols related to «TdTomato»

1
Slco1a4-Cre-ERT2-tdTomato Knock-In Mice
The Slco1a4-CreERT2-T2A-tdTomato (Slco1a4-CreERT2 mice) were generated via the CRISPR/Cas9 approach on the C57BL/6J background. The mouse Slco1a4 gene (NCBI Reference Sequence: NM_030687.2) is located on mouse chromosome 6. A total of 17 exons have been identified, with the ATG start codon in exon 4 and the TGA stop codon in exon 17 (Transcript: ENSMUST00000165990). The gRNA (gRNA1: GAAAGAGGTTGCAACCCATGGGG; gRNA2: TAGAGGGTCTTAAAGAATAGTGG) to mouse Slco1a4 gene, the donor vector containing the “CreERT2-T2A-tdTomato-rBG pA” cassette, and Cas9 mRNA were co-injected into fertilized mouse eggs to generate targeted knock-in offspring. The targeted insertion of the CreERT2-T2A-tdTomato cassette replaced the coding sequence starting from exon 4, ensuring CreERT2 expression under the endogenous Slco1a4 promoter. The targeting vector was designed with homology arms spanning regions flanking exon 4, synthesized from a BAC clone template, to facilitate site-specific integration. F0 pups underwent PCR screening and sequencing to confirm the precise integration of the cassette. Subsequently, founder mice with confirmed germline transmission were bred to produce F1 offspring. Successful integration in offspring was confirmed through genotyping with PCR and Southern blot analysis.
Xu C., Li S., Cai Y., Lu J., Teng Y., Yang X, & Wang J. (2024). Generation of Slco1a4-CreERT2-tdTomato Knock-in Mice for Specific Cerebrovascular Endothelial Cell Targeting. International Journal of Molecular Sciences, 25(9), 4666.
Full text: Click here
Publication 2024
2
Syt1-tdTomato Expression Vector Creation
The PiggyBac vector and UBC promoter (human ubiquitin C promoter) were chosen to construct the Syt1-tdTomato expression vector. In the PiggyBac vector, there are two PiggyBac ITRs located at the sides of the ‘UBC promoter-Kozak-Syt1-tdTomato-polyA’ cassette in order to promote transposes mediated transgene integration. The constructed vectors were co-injected with transposes into fertilized eggs from C57BL/6 J mice. The offspring were identified by PCR to select those carrying the required PiggyBac transgene. Counter-screening was performed on positive founder mice for transposes. The Cyagen Biosciences (Guangzhou) Inc conducted all of the processes.
Yang L., Zhang J., Liu S., Zhang Y., Wang L., Wang X., Wang S., Li K., Wei M, & Zhang C. (2024). Establishment of transgenic fluorescent mice for labeling synapses and screening synaptogenic adhesion molecules. eLife, 13, e81884.
Full text: Click here
Publication 2024
3
Quantifying Tdtomato Fluorescence in Cells and Clusters
Tdtomato fluorescence intensity was quantified using ImageJ/Fiji software or MATLAB scripts. All the values were subtracted with background levels. In the single cell analysis, a mask of the cell borders was either manually drawn using phase-contrast images or obtained using custom-made MATLAB scripts and used to measure the mean fluorescence of Tdtomato. In the cluster analysis, the binary mask obtained from phase-contrast images (see section cell and cluster segmentation) was used to measure the mean gray values of the focal plane located 2 µm above the gel substrate. In the analysis of cluster attachment to an endothelial monolayer, for each cluster, the mean gray value of 4 focal planes at 0, 5, 10, 15 µm from the monolayer, was calculated and reported as Tdtomato fluorescence intensity.
Conti S., Venturini V., Cañellas-Socias A., Cortina C., Abenza J.F., Stephan-Otto Attolini C., Middendorp Guerra E., Xu C.K., Li J.H., Rossetti L., Stassi G., Roca-Cusachs P., Diz-Muñoz A., Ruprecht V., Guck J., Batlle E., Labernadie A, & Trepat X. (2024). Membrane to cortex attachment determines different mechanical phenotypes in LGR5+ and LGR5- colorectal cancer cells. Nature Communications, 15, 3363.
Full text: Click here
Publication 2024
4
Profiling Serotonin Receptor Genes in Kiss1+ Neurons
Expression profiles of serotonergic receptor genes in ARC or AVPV kisspeptin neurons were analyzed using RNA-seq data reported previously67 (link). Briefly, the ARC or AVPV tissues were dissected out from Kiss1-tdTomato heterozygous female rats under OVX (n = 2) or OVX + high E2 (n = 2) conditions, respectively, because tdTomato fluorescence expression was dependent on Kiss1 expression and the tdTomato signals were only detectable in the ARC of OVX rats and the AVPV in OVX + high E2 model rats9 (link). The ARC or AVPV tissues were minced and treated with papain and then gently dispersed by repetitive pipetting, and the tdTomato-positive cells were picked up under a fluorescent microscope by pipettes (inner diameter: 20–30 μm)71 (link). Ten (for ARC) or 3 (for AVPV) tdTomato-positive cells were pooled into a polymerase chain reaction tube containing an RNase inhibitor (RNasin Plus; Promega, Madison, WI, USA). Gene expression levels were normalized by the reads per kilobase million mapped reads for each mRNA67 (link).
Nakamura S., Sasaki T., Uenoyama Y., Inoue N., Nakanishi M., Yamada K., Morishima A., Suzumura R., Kitagawa Y., Morita Y., Ohkura S, & Tsukamura H. (2024). Raphe glucose-sensing serotonergic neurons stimulate KNDy neurons to enhance LH pulses via 5HT2CR: rat and goat studies. Scientific Reports, 14, 10190.
Full text: Click here
Publication 2024
5
Quantifying Dual-Positive Human Cells
Co-stained human cells (hLDH and RFP positive) and a total of human cells (hLDH positive only) from 5 different lobes were quantified using ImageJ software (https://imagej.nih.gov/ij/).
A minimum of 2000 cells were quantified, and the results are expressed as a percentage of human cells expressing tdTomato.
Barzi M., Chen T., Gonzalez T.J., Pankowicz F.P., Oh S.H., Streff H.L., Rosales A., Ma Y., Collias S., Woodfield S.E., Diehl A.M., Vasudevan S.A., Galvan T.N., Goss J., Gersbach C.A., Bissig-Choisat B., Asokan A, & Bissig K.D. (2024). A humanized mouse model for adeno-associated viral gene therapy. Nature Communications, 15, 1955.
Full text: Click here
Publication 2024

Top products related to «TdTomato»

1
Tamoxifen by Merck Group
Sourced in United States, Germany, Sao Tome and Principe, United Kingdom, Switzerland, Macao, China, Australia, Canada, Japan, Spain, Belgium, France, Italy, New Zealand, Denmark
Tamoxifen is a drug used in the treatment of certain types of cancer, primarily breast cancer. It is a selective estrogen receptor modulator (SERM) that can act as both an agonist and antagonist of the estrogen receptor. Tamoxifen is used to treat and prevent breast cancer in both men and women.
2
C57bl 6j by Jackson ImmunoResearch
Sourced in United States, Montenegro, Germany, United Kingdom, Japan, China, Canada, Australia, France, Colombia, Netherlands, Spain
C57BL/6J is a mouse strain commonly used in biomedical research. It is a common inbred mouse strain that has been extensively characterized.
3
B6 cg gt rosa 26sortm14 cag tdtomato hze j by Jackson ImmunoResearch
Sourced in United States
B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J is a transgenic mouse line that expresses the tdTomato fluorescent protein under the control of the CAG promoter. The tdTomato expression is targeted to the ROSA26 locus, allowing for ubiquitous and heritable expression of the reporter.
4
C57bl 6j mice by Jackson ImmunoResearch
Sourced in United States, Montenegro, Japan, Canada, United Kingdom, Germany, Macao, Switzerland, China
C57BL/6J mice are a widely used inbred mouse strain. They are a commonly used model organism in biomedical research.
5
C57bl 6 by Jackson ImmunoResearch
Sourced in United States, Montenegro, United Kingdom, Germany, Australia, China, Canada
C57BL/6 is a widely used inbred mouse strain. It is a robust, readily available laboratory mouse model.
6
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
7
B6 cg gt rosa 26sortm9 cag tdtomato hze j by Jackson ImmunoResearch
Sourced in United States
The B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J is a transgenic mouse line that expresses the tdTomato fluorescent protein under the control of the CAG promoter. The expression of tdTomato is driven by the ROSA26 locus.
8
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
9
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
10
Facsaria 2 by BD
Sourced in United States, Germany, United Kingdom, Japan, Belgium, China, Canada, Italy, France, South Sudan, Singapore, Australia, Denmark, Uruguay
The FACSAria II is a high-performance cell sorter produced by BD. It is designed for precision cell sorting and analysis. The system utilizes flow cytometry technology to rapidly identify and separate different cell populations within a sample.

More about "TdTomato"

TdTomato is a versatile fluorescent protein marker that has become an indispensable tool for researchers studying cell biology and tissue dynamics.
Derived from the marine coral Discosoma sp., this dimeric red fluorescent protein offers bright, photostable fluorescence that can be easily detected using standard fluorescent microscopy and imaging techniques.
Researchers leverage TdTomato to visualize and track specific cell populations in live tissues and organisms, enabling them to study a wide range of biological processes with high spatiotemporal resolution.
This includes investigating cell fate, migration, proliferation, and other dynamic cellular activities.
The TdTomato marker is often used in conjunction with other genetic tools, such as Tamoxifen-inducible Cre recombinase systems (e.g., B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J and B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J mouse lines), to precisely label and follow specific cell lineages over time.
To optimize TdTomato research protocols, scientists may utilize platforms like PubCompare.ai, which leverages AI-driven comparisons to help locate the best protocols from literature, preprints, and patents.
This can enhance reproducibility and accuracy, unlocking the full potential of TdTomato for advancing our understanding of complex tissue architectures and cell-cell interactions.
Common experimental techniques used with TdTomato include transfection with Lipofectamine 2000, cell culture in media supplemented with FBS and Penicillin/streptomycin, and flow cytometric analysis using a FACSAria II cell sorter.
By harnessing the power of this versatile fluorescent marker, researchers can gain invaluable insights into the dynamic behaviors of cells within their native environments.