>
Chemicals & Drugs
>
Amino Acid
>
Telomerase
Telomerase
Telomerase is a ribonucleoprotein enzyme that plays a crucial role in maintaining telomere length and genomic stability.
It is responsible for adding telomeric repeat sequences to the ends of chromosomes, counteracting the natural shortening of telomeres that occurs during cell division.
Telomerase is highly active in immortalized cells, such as stem cells and cancer cells, but is typically repressed in normal somatic cells.
Dysfunctional telomerase activity has been implicated in various human diseases, including cancer, aging, and degenerative disorders.
Understanding the complex regulation and function of telomerase is an active area of biomedical research, with potential applications in therapeutics, regenerative medicene, and longevity.
PubCompare.ai is an innovative AI-driven platform that can help researchers optimize their telomerase studies by locating the best protocols, products, and findings from literature, preprints, and patents, and avoiding potential pitfalls through precise, reproducible results.
It is responsible for adding telomeric repeat sequences to the ends of chromosomes, counteracting the natural shortening of telomeres that occurs during cell division.
Telomerase is highly active in immortalized cells, such as stem cells and cancer cells, but is typically repressed in normal somatic cells.
Dysfunctional telomerase activity has been implicated in various human diseases, including cancer, aging, and degenerative disorders.
Understanding the complex regulation and function of telomerase is an active area of biomedical research, with potential applications in therapeutics, regenerative medicene, and longevity.
PubCompare.ai is an innovative AI-driven platform that can help researchers optimize their telomerase studies by locating the best protocols, products, and findings from literature, preprints, and patents, and avoiding potential pitfalls through precise, reproducible results.
Most cited protocols related to «Telomerase»
For the isolation of hMADS cells from young donors, adipose tissue was obtained with the informed consent of the parents as surgical scraps from surgical specimen of various surgeries, as approved by the Centre Hospitalier Universitaire de Nice Review Board. We modified a previous published protocol used to isolate adipocyte precursors from adipose tissue (23 ). In brief, 200 mg/ml adipose tissue was dissociated for 5–10 min in DMEM containing antibiotics (100 U/ml of penicillin and 100 μg/ml of streptomycin), 2 mg/ml collagenase, and 20 mg/ml bovine serum-albumin. The crude SVF was separated from the adipocyte fraction by low speed centrifugation (200 g, 10 min). The adipocyte fraction was discarded and cells from the pelleted SVF were seeded onto uncoated tissue culture plates (Greiner) at 1,000–3,500 cells/cm2 in low glucose DMEM (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (D. Dutschers) and antibiotics as described before. Fast-adherent cells, termed CA cells, were separated from slow-adherent cells, termed CS cells. CA and CS cells were expanded in the same culture medium as described before. After reaching 70% confluence, cells were dissociated (0.25% trypsin EDTA; Invitrogen) and replated at 1,000–3,000 cells/cm2. Telomerase activity was determined by means of TeloTAGGG Telomerase PCR ElisaPLUS kit from Roche Diagnostic, according to the manufacturer's recommendations. SA β-galactosidase activity was determined according to Dimri et al. (24 (link)).
Adipocytes
Antibiotics
beta-Galactosidase
Cells
Cell Separation
Centrifugation
Collagenase
Culture Media
Diagnosis
Donors
Edetic Acid
Fetal Bovine Serum
Glucose
Operative Surgical Procedures
Penicillins
Serum Albumin, Bovine
Streptomycin
Telomerase
Tissue, Adipose
Tissues
Trypsin
BRCA1 protein, human
DROSHA protein, human
Gene, BRCA2
Gene, Cancer
Genes
Genetic Diversity
Germ-Line Mutation
Germ Line
Malignant Neoplasms
Multiple Endocrine Neoplasia Type 2a
Multiple Pterygium Syndrome, Autosomal Dominant
Mutation
Pathogenicity
Susceptibility, Disease
Telomerase
TERT protein, human
TP53 protein, human
Tumor Suppressor Genes
The newly constructed expression cassettes are shown in Fig. 1 a. The promoters, RU5′, BGH (bovine growth hormone) polyadenylation (polyA) signal, and a sequence for multiple cloning sites, were synthesized by IDT Inc. (Coralville, IA) and inserted into pDNR-1r promoter-less vector (Clontech, Mountain View, CA) or pIDT-SMART promoter-less vector (IDT Inc.). The RU5′ sequence (269 bp: Accession No. J02029 (374–642)) is derived from the R segment and a part of the U5 sequence of HTLV Type 1 long terminal repeat and used to enhance transcription efficiency [9 (link)]. Sequences of the promoter elements were as follows: hTERT (189 bp: Accession No. DQ264729 (1618–1806)), SV40 (319 bp: Accession No. AY864928 (2156–2474)), and CMV (479 bp: Accession No. AJ318513 (159–637)). The CAG promoter was obtained from the pCAGGS vector (a kind gift from Dr. Jun-ichi Miyazaki; Osaka University, Japan). pTracer-EF/V5-His-A and pEF6/Myc-His-A were purchased from Invitrogen. Full-length cDNAs of human S100A11, REIC/Dkk-3, CD133, LGR5 (leucine-rich repeat-containing G protein-coupled receptor 5), telomerase, erythropoietin (EPO), and green fluorescence protein (GFP) were amplified by RT-PCR.![]()
Schematic diagram of modified gene expression systems and their capabilities for gene expressions.
CCXCR1 receptor, human
Cloning Vectors
DKK3 protein, human
DNA, Complementary
Erythropoietin
Gene Expression
Genitalia
Green Fluorescent Proteins
growth hormone, bovine
HEK293 Cells
HeLa Cells
Hep G2 Cells
Homo sapiens
Leucine
Long Terminal Repeat
MCF-7 Cells
Plasmids
Polyadenylation
protein B
Proteins
Reverse Transcriptase Polymerase Chain Reaction
Simian virus 40
T-Cell Leukemia Viruses, Human
Telomerase
Transcription, Genetic
Western Blot
Adjustment Disorders
anti-IgG
Antibodies, Anti-Idiotypic
Bacteria
bacteriophage T7 RNA polymerase
Biological Assay
Chromatography, Affinity
Cytokinesis
deoxyguanosine triphosphate
Electron Microscopy
Freezing
Holoenzymes
Immunoglobulins
Peptide Hydrolases
Protein Subunits
Rabbits
Reconstructive Surgical Procedures
Resins, Plant
Strains
Synthetic Genes
Telomerase
TERT protein, human
Tetrahymena
Transcription, Genetic
uranyl formate
Blot, Southern
Cells
Donors
Gene Components
Gene Expression
Genome-Wide Association Study
Histocompatibility Testing
IL5 protein, human
Leukocytes
Reproduction
RNA-Seq
Single Nucleotide Polymorphism
Stem Cells
Stem Cell Self-Renewal
Telomerase
TERT protein, human
Tissue Donors
Tissues
Most recents protocols related to «Telomerase»
The activity of telomerase was tested based on the classical TRAP method (Kim and Wu, 1997 (link)) with minor modification. Briefly, cultured cells were washed with PBS and the cell numbers were counted. A total of 1 × 106 cells were lysed with CHAPS lysis buffer for 30 min on ice. After centrifugation at 12,000 ×g for 20 min, the supernatant was removed into a new prechilled tubes and the concentration was determined by the Pierce BCA Protein Assay Kit (Thermo Scientific). Two steps were applied for TRAP assay. The first reaction system contained 1 μl cell lysate, 1 μl dNTP (2.5 mM), 1 μmol/l TS primer (5‘-AATCCGTCGAGCAGAGTT-3’), 1 μl 10 × TRAP buffer (200 mM Tris–HCL, 15 mM MgCL2, 630 mM KCL, 0.5% Tween 20, 10 mM EGTA, and 0.1% BSA, pH 8.3), and 6.5 μl ddH2O. The mixture were incubated at 30°C for 40 min, inactivated at 95°C 5 min, and stored at 4°C. The second step was PCR reaction, each 20 μl reaction system contained 2 μl of products from the first step, 2 μl 10 × TRAP buffer, 3 μl dNTP (2.5 mM), 0.5 μmol/l TS primer, 0.5 μmol/l ACX primer (5‘-GCGCGGCTTACCCTTACCCTTACCCTAACC-3’), 0.5 μmol/l NT primer (5‘-ATCGCTTCTCGGCCTTTT-3′), 0.5 amol/μl TSNT (5‘-AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT-3′), and 11 μl ddH2O. PCR was performed at 95°C for 3 min, 30 cycles of 94°C for 30 s, 59°C for 30 s, 72°C for 1 min, and 72°C for 5 min. PCR products were separated on a 15% native-PAGE gel in TBE buffer. After electrophoresis, the gel was stained with GelRed for 30 min and the images were captured under UV light with reverse processing.
3-((3-cholamidopropyl)dimethylammonium)-1-propanesulfonate
Acute Monocytic Leukemia
Biological Assay
Buffers
Cells
Centrifugation
Cultured Cells
Egtazic Acid
Electrophoresis
Magnesium Chloride
Native Polyacrylamide Gel Electrophoresis
Oligonucleotide Primers
Proteins
Telomerase
Tris-borate-EDTA buffer
Tromethamine
Tween 20
Ultraviolet Rays
Human telomerase-immortalized retinal pigmented epithelial cells (hTERT-RPE1) were cultured in a 1:1 mixture of Dulbecco’s modified Eagle’s medium and Ham’s F-12 medium (FUJIFILM Wako), supplemented with 2 mM L-glutamine (FUJIFILM Wako), 10% fetal bovine serum (FBS, Thermo Fisher Scientific), and 0.375% sodium bicarbonate. NIH3T3 cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS. All cells were incubated at 37 °C in a humidified 5% CO2/95% air atmosphere.
Atmosphere
Bicarbonate, Sodium
Cells
Culture Media
Eagle
Epithelial Cells
Glutamine
Homo sapiens
NIH 3T3 Cells
Telomerase
The workflow of this study is presented in Figure 1 . The expression data including mRNA and lncRNA of PTC patients were got from TCGA database (https://www.cbioportal.org ) [24 (link)]. This dataset consisted of 507 subjects, 510 tumor samples, and 58 adjacent normal tissue samples. Only the patients with clinical data and follow-up time/PFI ≥ 30 days were included. Overall, 498 cases were finally included and were randomly split into a training cohort (n = 299) and a validation cohort (n = 199). A total 222 autophagy-related genes (ARGs) were obtained from the Human Autophagy Database (HADb, http://autophagy.lu/clustering/index.html ), which collected those genes from the literature. LncRNAs and ARGs mRNAs expression were extracted according to GENCODE annotations (https://www.gencodegenes.org ). LncRNAs with zero expression levels in more than 50% of samples were excluded. Clinical variables including age, gender, race, cancer history, thyroid gland disorder history, histological types, TNM stages, T stage, N stage, M stage, tumor location, residual tumor, American Thyroid Association (ATA) risk stratification, the distant metastasis, patient age, completeness of resection, local invasion, and tumor size (MACIS) scores were collected. The methods of assessing the tumors with ATA risk stratification and MACIS scores have been described in the previous report [24 (link)] and are introduced in the Supplementary data. We also re-evaluated the tumors based on the methods. Additionally, BRAF mutation and telomerase reverse transcriptase (TERT) promoter mutation status information were extracted, which have been reported to be associated with prognosis in TC [25 (link)]. Patients’ progression-free survival (PFS) and overall survival (OS) were also extracted.
Autophagy
BRAF protein, human
Division Phase, Cell
Gender
Gene Expression
Genes
Homo sapiens
Malignant Neoplasms
Mutation
Neoplasm Metastasis
Neoplasms
Neoplasms by Site
Patients
Prognosis
Residual Tumor
RNA, Long Untranslated
RNA, Messenger
Telomerase
Thyroid Diseases
Thyroid Gland
Tissues
DNA was obtained from PB leukocytes using the phenol–chloroform method. PB sample collection from EOCRC patients was performed at diagnosis, prior to the initiation of any type of treatment. All DNA samples were stored in Eppendorf tubes at 20 °C to prevent their progressive degradation and potential contamination. The TL of the leukocytes was measured by RT-qPCR using the Absolute Human Telomere Length Quantification qPCR Assay Kit (ScienCell, Catalog #8918, Carlsbad, CA, USA), following the manufacturer’s instructions. This technique allows the initial amount of DNA coding for telomerase (TEL) and a single copy reference gene (used as an endogenous control) to be quantified simultaneously. The difference in the amount of DNA quantified represents the relative TL of each sample. To analyze these relative changes, a reference fragment of known TL (provided by the manufacturer) was added to each assay, allowing the absolute quantification of the TL of each sample. Triplicate reactions were carried to minimize variability. The TEL and SCR fragments were amplified using 10 ng in 2 µL of DNA, 1 µL of each specific primer, and 10 µL of the FastStart SYBR Green Master Mix. The amplification program was as follows: 10 min at 95 °C followed by 40 cycles at 95 °C for 15 s, 52 °C for 30 s, and 60 °C for 1 min. Finally, the Ct (2−∆∆Ct) comparative method was used to calculate the relative DNA amount of each amplicon. This assay was performed in a 96-well plate and the detection was carried out in the Step-One Plus Real-Time PCR system (Applied Biosystems, Waltham, MA, USA).
Biological Assay
Chloroform
Diagnosis
Genes
Homo sapiens
Leukocytes
Oligonucleotide Primers
One-Step dentin bonding system
Patients
Phenols
Specimen Collection
SYBR Green I
Telomerase
Telomere
THF RIG-I−/−, MDA5−/− and RIG-I−/−MDA5−/− were generated by lentivirus-mediated CRISPR-Cas9 KO and puromycin selection as described in Hare et al., 2015. FLAG-RIG-I, FLAG-RIG-IK270A and FLAG-RIG-IK888/902A in pEF-Bos plasmid (a kind gift from Michael Gale) were cloned into pLenti-blast via endonuclease digestion and ligation and used to produce lentivirus particles. THF RIG-I−/−MDA5−/− cells were reconstituted with FLAG-RIG-I by transduction and blasticidin selection.
Cell lines expressing p14 under a tetracycline-inducible promoter were generated using a transposon recombination-based PiggyBac vector system [18 (link)]. The cDNA sequence of the p14 FAST protein was amplified by PCR using the forward primer GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGGGAGTGGACCCTCT and the reverse primer GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAAATGGCTGAGACATTATCGATGTTG. A two-step recombination reaction mediated by BP and LR clonase enzymes integrated the p14 gene into the PB-TAG vector.
Three plasmids, i.e., PB-TAG (encoding the gene of interest), pCYL43 (encoding the PBase recombination enzyme) and PB-CAG rtTA (encoding the rtTA protein which initiates gene expression in the presence of doxycycline) were nucleofected into telomerase life-extended human fibroblasts (THF) [19 (link),20 (link)]. p14-positive cells were selected for with 3 μg/mL of puromycin. THF-p14 STING−/− and THF-p14 RIG-I/MDA5−/− cells were generated in the same manner, but the plasmids were inserted into the corresponding THF knock-out cell type.
Cell lines expressing p14 under a tetracycline-inducible promoter were generated using a transposon recombination-based PiggyBac vector system [18 (link)]. The cDNA sequence of the p14 FAST protein was amplified by PCR using the forward primer GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGGGAGTGGACCCTCT and the reverse primer GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAAATGGCTGAGACATTATCGATGTTG. A two-step recombination reaction mediated by BP and LR clonase enzymes integrated the p14 gene into the PB-TAG vector.
Three plasmids, i.e., PB-TAG (encoding the gene of interest), pCYL43 (encoding the PBase recombination enzyme) and PB-CAG rtTA (encoding the rtTA protein which initiates gene expression in the presence of doxycycline) were nucleofected into telomerase life-extended human fibroblasts (THF) [19 (link),20 (link)]. p14-positive cells were selected for with 3 μg/mL of puromycin. THF-p14 STING−/− and THF-p14 RIG-I/MDA5−/− cells were generated in the same manner, but the plasmids were inserted into the corresponding THF knock-out cell type.
Amino Acid Sequence
Cell Lines
Cells
Cloning Vectors
Clustered Regularly Interspaced Short Palindromic Repeats
DDX58 protein, human
Digestion
DNA, Complementary
Doxycycline
Endonuclease
Enzymes
Fibroblasts
Gene Expression
Genes
Genetic Vectors
Hares
Homo sapiens
IFIH1 protein, human
Jumping Genes
Lentivirus
Ligation
Oligonucleotide Primers
Plasmids
Proteins
Puromycin
Recombination, Genetic
Scabies
Telomerase
Tetracycline
Top products related to «Telomerase»
Sourced in United States, Germany
The TRAPeze Telomerase Detection Kit is a laboratory equipment product designed to detect the presence and activity of telomerase, an enzyme involved in the maintenance of chromosomal ends. The kit provides a standardized procedure for the quantitative analysis of telomerase activity in cell samples.
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
Sourced in Germany, Switzerland, United States
The TeloTAGGG Telomerase PCR ELISA kit is a laboratory product developed by Roche. It is designed to detect and measure telomerase activity in cell samples.
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
Sourced in Germany, France, Switzerland, United States
The TeloTAGGG Telomerase PCR ELISA PLUS kit is a laboratory product designed for the quantitative determination of telomerase activity in cell extracts. It utilizes a highly sensitive and specific method to measure telomerase activity.
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.
Sourced in United States
The TRAPeze RT Telomerase Detection Kit is a laboratory equipment product designed to detect and quantify telomerase activity in biological samples. It provides a sensitive and reliable method for the analysis of telomerase, an enzyme that plays a crucial role in cellular immortalization and cancer development.
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.