> Chemicals & Drugs > Amino Acid > Tensin

Tensin

Q: What are the key functions of Tensins in cells?

Tensins are a family of cytoskeletal linker proteins that play a crucial role in cell adhesion, migration, and signaling. They connect integrins to the actin cytoskeleton, which is essential for maintaining cell structure and facilitating cell movement and communication.

Q: How do Tensins differ from other cytoskeletal proteins?

Unlike many other cytoskeletal proteins, Tensins have the unique ability to link integrins to the actin filaments. This direct connection between the extracellular matrix and the internal cytoskeleton is what allows Tensins to mediate important cellular processes like adhesion and migration.

Q: What are some common applications of Tensin research?

Tensin research is widely applicable in fields such as cell biology, cancer biology, and tissue engineering. Understanding Tensin function can provide insights into cell motility, wound healing, cancer metastasis, and the development of new biomaterials and tissue scaffolds.

Q: Are there different types or variants of Tensins?

Yes, there are several distinct Tensin isoforms, including Tensin1, Tensin2, Tensin3, and Tensin4. These variants have some overlapping functions but also exhibit unique roles and localizations within the cell. Researchers may need to consider these Tensin type5 differences when designing experiments or selecting the most appropriate Tensin-related protocols.

Tensins are a family of cytoskeletal linker proteins that connect integrins to the actin cytoskeleton.
They play a crucial role in cell adhesion, migration, and signaling.
PubCompare.ai's AI-powered research platform provides comprehensive insights into Tensin optimization and comparison, helping researchers quickly locate relevant protocols from literature, preprints, and patents.
Leverage AI-driven comparisons to identify the best Tensin-related protocols and products, streamlining the research process and enabling informed decisions.
Discover the latest advancem,ents in Tensin research with PubCompare.ai's cutting-edge technology.

Most cited protocols related to «Tensin»

Antisense oligonucleotide design and synthesis

Cited 23 times

ASOs 1, 3 and 4 (sequence 5′-GCTCATACTCGTAGGCCA-3′, position 791–808) and 2 (sequence 5′-CTCATACTCGTAGGCC-3′, position 792–807) are complementary to Mus musculus TNFRSF1A-associated via death domain (TRADD) mRNA (Genbank accession no. NM_001033161). The ASO lead 1a is the murine homolog (a G to A base change at position 5) of the human TRADD lead reported previously (28 (link)). Control oligonucleotides 5 (5′-GCCCAATCTCGTTAGCGA-3′) were designed with six mismatches to 4, such that they contained ≥4 mismatches to all known mouse sequence. ASOs 6 and 7 (sequence TCTGGTACATGGAAGTCTGG, position 8232–8251) and 8 (sequence AAGTTGCCACCCACATTCAG, position 5586–5605) are complementary to Mus musculus apolipoprotein B (ApoB) mRNA (Genbank accession no. XM_137955.5). The sequences were identified by a screen of 5-10-5 MOE 20mer ASOs as described previously (29 (link)–31 (link)). ASOs 9, 10 and 11 (sequence 5′-CTGCTAGCCTCTGGATTTGA-3′, position 1931–1950) are complementary to M.musculus phosphatase and tensin homolog (PTEN), mRNA (Genbank accession no. NM_008960). ASO 9 (18 (link)) and control oligonucleotide 12 (19 (link)) have been described previously.
MOE phosphoramidites were prepared as described previously (7 ,32 ,33 (link)). LNA and 2′-deoxyribonucleoside phosphoramidites were purchased from commercial suppliers. Oligonucleotides were prepared similar to that described previously (34 (link)) on either an Amersham AKTA 10 or AKTA 100 oligonucleotide synthesizer. Modifications from the reported procedure include: a decrease in the detritylation time to ∼1 min, as this step was closely monitored by UV analysis for complete release of the trityl group; phosphoramidite concentration was 0.1 M; 4,5-dicyanoimidazole catalyst was used at 0.7 M in the coupling step; 3-picoline was used instead of pyridine for the sulfurization step, and the time decreased from 3 to 2 min. The oligonucleotides were then purified by ion-exchange chromatography on an AKTA Explorer and desalted by reverse phase HPLC to yield modified oligonucleotides in 30–40% isolated yield, based on the loading of the 3′-base onto the solid support. Oligonucleotides were characterized by ion-pair-HPLC-MS analysis (IP-HPLC-MS) with an Agilent 1100 MSD system. The purity of the oligonucleotides was ≥90% (Supplementary Table S1).

Swayze E.E., Siwkowski A.M., Wancewicz E.V., Migawa M.T., Wyrzykiewicz T.K., Hung G., Monia B.P, & Bennett A.C. (2006). Antisense oligonucleotides containing locked nucleic acid improve potency but cause significant hepatotoxicity in animals. Nucleic Acids Research, 35(2), 687-700.

Publication 2006

Apolipoproteins B Death Domain Deoxyribonucleosides High-Performance Liquid Chromatographies Homo sapiens Ion-Exchange Chromatographies Mice, House Mus Muscle Tissue Oligonucleotides phosphoramidite Phosphoric Monoester Hydrolases Picoline PTEN protein, human pyridine RNA, Messenger Tensin TNFRSF1A protein, human

Immunofluorescence Analysis of Endothelial Proteins

Cited 7 times

Fixed samples were thawed and rehydrated with PBS containing 50mM glycine (Sigma) for 10 minutes. Cells were permeabilized with 0.1% Triton X-100 and non-specific binding sites were blocked with 0.5% bovine serum albumin (BSA). Slides were incubated for 1 hour at 37°C with primary antibodies against one of the following targets: eNOS (1:100 dilution, BD Biosciences, San Diego, CA), phosphorylated eNOS at serine 1177 (1:200 dilution, Millipore, Billerica, MA) and threonine 495 (1:100 dilution, Cell Signaling, Danvers, MA), Akt (1:100 dilution, Cell Signaling), PKCβ (1:100 dilution, Abcam, Cambridge, MA), phosphatase and tensin homolog (PTEN) (1:100, Santa Cruz Biotechnology, Santa Cruz, CA), nitrotyrosine (1:1000 dilution, Millipore, Billerica, MA), ICAM (1:150 dilution, Santa Cruz Biotechnology), IκBα (dilution, Novus, Littleton, CO), or p65 (1:375 dilution, Novus). All cells were also stained with an anti-von Willebrand Factor (vWF) antibody (1:300 dilution, Dako, Carpinteria, CA) to aid in endothelial cell identification. After incubation with the primary antibodies, the slides were washed and incubated with corresponding Alexa Fluor-488 and Alexa Fluor-594 antibodies (1:200 dilution, Invitrogen, Carlsbad, CA) and mounted under glass coverslips with Vectashield containing DAPI for nuclear identification (Vector Laboratories, Burlingame, CA). For each batch of patient-derived cells, we stained a control slide of cultured HAECs,, maintained in EGM-2 Bullet Kit medium (Lonza) at 37°C with 5% CO₂ and taken from a single index passage.
Slides were imaged with a fluorescence microscope (Nikon Eclipse TE2000-E) at 20x magnification and digital images of the cells were captured using a Photometric CoolSnap HQ2 Camera (Photometrics, Tucson, AZ). Exposure time was held constant and image intensity was corrected for background fluorescence. Fluorescent intensity was quantified by NIS Elements AR Software (Nikon Instruments Inc, Melville, NY). For each protein of interest, fluorescent intensity was quantified in 20 cells from each patient and averaged. To minimize batch-to-batch variability in staining intensity, fluorescence intensity for each patient sample was normalized to the intensity of HAEC staining performed simultaneously. Intensity is expressed in arbitrary units (au) calculated by dividing the average fluorescence intensity from the patient sample by the average fluorescence intensity of the HAEC sample and multiplying by 100. Intensity quantification was performed blinded to subject identity and diabetes status, and each batch included patients with and without diabetes.

Tabit C.E., Shenouda S.M., Holbrook M., Fetterman J.L., Kiani S., Frame A.A., Kluge M.A., Held A., Dohadwala M., Gokce N., Farb M., Rosenzweig J., Ruderman N., Vita J.A, & Hamburg N.M. (2012). Protein Kinase-C Beta Contributes to Impaired Endothelial Insulin Signaling in Humans with Diabetes Mellitus. Circulation, 127(1), 86-95.

Publication 2012

3-nitrotyrosine Alexa594 alexa fluor 488 alpha, NF-KappaB Inhibitor Antibodies Antibodies, Anti-Idiotypic Argon ARID1A protein, human Binding Sites Cells Cloning Vectors DAPI Diabetes Mellitus Endothelial Cells Factor VIII-Related Antigen Fluorescence Glycine Intercellular Adhesion Molecule-1 Microscopy, Fluorescence NOS3 protein, human Novus Patients Phosphoric Monoester Hydrolases Photometry Protein Kinase C beta Proteins PTEN protein, human Serine Serum Albumin, Bovine Technique, Dilution Tensin Threonine Triton X-100

Benchmarking Protein Mutation Effects

Cited 6 times

We used several different datasets to develop, validate, and independently test the SAAFEC-SEQ method. These datasets contain experimental thermodynamic information for wild type and mutant proteins, including the change in Gibbs free energy (ΔΔG). The following datasets contain only a single chain protein and single point missense mutations.
S2648. This is our training and test dataset, the S2648, collected from the ProTherm database [28 (link)], including 2648 unique single point missense entries in 131 different proteins and the corresponding ΔΔGs.
S350. This is our validation dataset. To compare with other methods, we used the same validation dataset used by other developers [16 (link),17 (link),18 (link),19 (link)], which contains 350 mutations (taken from 67 different proteins) randomly selected from S2648.
S276. This blind data set was collected from Cao’s et al. work [29 (link)], which includes 276 unique single point missense entries in 37 different proteins. None of them is in the training or validation set.
p53. This is the second blind dataset. We used a dataset of 42 single point missense mutations within the DNA binding domain of the tumor suppressor protein p53, which thermodynamic effects have been experimentally determined [46 (link),47 (link),48 (link)]. As in the previous case, none of them appeared in our training set.
PTEN and TPMT. For the third blind data set, we collected two independent datasets for the phosphatase and tensin homologue (PTEN) and thiopurine S-methyl transferase (TPMT) proteins from the Critical Assessment of Genome Interpretation (CAGI) challenge [30 (link)]. It can be downloaded from https://genomeinterpretation.org/content/predict-effect-missense-mutations-pten-and-tpmt-protein-stability. We removed mutations with an unknown amino acid “X” (both in wild type and mutant), and then kept a total of 7363 missense mutations for the PTEN (3736) and TPMT (3627) proteins.

Li G., Panday S.K, & Alexov E. (2021). SAAFEC-SEQ: A Sequence-Based Method for Predicting the Effect of Single Point Mutations on Protein Thermodynamic Stability. International Journal of Molecular Sciences, 22(2), 606.

Full text: Click here

Publication 2021

Amino Acids Genome Missense Mutation Mutant Proteins Mutation Oncoprotein p53 Phosphoric Monoester Hydrolases Point Mutation Proteins PTEN protein, human Tensin TPMT protein, human Transferase Visually Impaired Persons

Drosophila Vinculin Aggregation Assay

Cited 6 times

Drosophila melanogaster stocks used in this study: Mef2::Gal4, Act5C::Gal4, UAS::GFP-Lamp1, UAS::eGFP-huLC3, UAS::myr-GFP, UAS::mito-GFP (all sourced from the Bloomington Drosophila Stock Center, Indiana University); ΔVinc, βPS-GFP, GFP-talin (all Klapholz et al., 2015 (link)); mys^XG43 (Jannuzi et al., 2002 (link)); pax^Δ1 (Bataille et al., 2010 (link)); talin-mCherry (Venken et al., 2011 (link)); UAS::talin (Tanentzapf et al., 2006 (link)); UAS::GFP-IBS2 (Ellis et al., 2011 (link)); paxillin-GFP (Bataille et al., 2010 (link)); UAS::paxillin (Vakaloglou et al., 2012 (link)); tensin-GFP (Torgler et al., 2004 (link)); ILK-YFP (unpublished, made as ILK-GFP in Zervas et al., 2001 (link)); PINCH-GFP (Kadrmas et al., 2004 (link)); Fermitin1-GFP (a genomic fragment, −1579 to +3942 relative to the ATG, with mGFP6 inserted following residue 228 and with three-serine linkers on each side; a gift of Danelle Devenport, The Gurdon Institute, University of Cambridge, UK). To misexpress vinculin constructs, the UAS-Gal4 system was used (Brand and Perrimon, 1993 (link)). To remove maternal and zygotic contributions of talin and paxillin, the dominant female sterile technique was used (Chou and Perrimon, 1996 (link)). To generate follicle cell clones lacking βPS and expressing Vinc-CO-RFP, the MARCM system was used (Lee and Luo, 1999 (link)). hsFlp, Tub-Gal80^ts, FRT19A; Tub-Gal4, UAS cd8GFP/CyO flies were crossed to mys^XG43, FRT19A; UAS Vinc-CO-RFP/CyO flies, pupae were heat shocked for 2 h in a 37°C water bath, and non-CyO adult females selected and dissected. rhea and pax mutant clones expressing Vinc-CO were generated in the same manner with different MARCM lines for each FRT (FRT2A and FRT40A, respectively). To test the domains of talin required for vinc-CO aggregation, we employed a series of rhea deletions as well as a null allele rescued by construct lacking the head or having the internal deletion in the rod (Klapholz et al., 2015 (link)). For controls, wild-type FRT chromosomes were used in place of mutant chromosomes. To generate Flp-out clones (Struhl and Basler, 1993 (link)) expressing Vinc-CO or Vinc-Head in the follicle cells and wing, hsFlp; arm::FRTstopf+FRTGal4 (details available upon request) flies were crossed to UAS-vinc-X flies and progeny heat shocked either as L1 larvae (for clones in the wing) or pupae (for clones in the follicle cells). Fluorescence from the vinculin constructs was used to mark clones.

Maartens A.P., Wellmann J., Wictome E., Klapholz B., Green H, & Brown N.H. (2016). Drosophila vinculin is more harmful when hyperactive than absent, and can circumvent integrin to form adhesion complexes. Journal of Cell Science, 129(23), 4354-4365.

Full text: Click here

Publication 2016

Alleles Bath Cells Chromosomes Clone Cells Deletion Mutation Diptera Drosophila Drosophila melanogaster Females Fluorescence Gene Deletion Genome Head Larva lysosomal-associated membrane protein 1, human Mitomycin Mothers Ovarian Follicle Pupa PXN protein, human Rhea Serine Sterility, Reproductive Talin Tensin VCL protein, human Woman Zygote

Cloning Tensin CDNA Fragments

Cited 5 times

RNA isolated from HFFs using RNeasy kit (Qiagen) was DNaseI treated using DNA Free (Ambion), and 1 μg of RNA was then reverse transcribed using a poly-T primer and SuperScript II (Invitrogen). Primers specific to the 5′ and 3′ ends and internal primers spanning unique restriction sites of the tensin cDNAs were designed (Table S1). These primers were used to amplify cDNA by PCR, using Platinum Pfx DNA polymerase (Invitrogen), either from the reverse transcribed RNA or from the tensin 2 cDNA clone IHS1380 (Open Biosystems). The amplified material was digested with the appropriate restriction enzymes and cloned into the pEGFP-C1 (Clontech) or pmCherry vectors using standard molecular biology techniques.

Clark K., Howe J.D., Pullar C.E., Green J.A., Artym V.V., Yamada K.M, & Critchley D.R. (2010). Tensin 2 modulates cell contractility in 3D collagen gels through the RhoGAP DLC1. Journal of cellular biochemistry, 109(4), 808-817.

Publication 2010

Cloning Vectors DNA, Complementary DNA-Directed DNA Polymerase DNA Restriction Enzymes Oligonucleotide Primers Platinum Poly T Tensin

Most recents protocols related to «Tensin»

Talin-1 Splicing Variant Modulates Cell Adhesion

Full-length WT talin-1 plasmid containing internal GFP and RFP (Kumar et al., 2016 (link)) was used in this study. Nucleotides corresponding to the 17-residue region of the 17b splice variant were cloned into WT talin-1 by Gibson assembly. Briefly, the WT talin-1 plasmid was digested with NotI and XhoI. Primers containing overhangs of nucleotides corresponding to the 17-residue region of the splice variant were used to amplify R2. Two fragments containing nucleotides between the NotI site to R1 domain and beyond R2 domain to XhoI site were also amplified by PCR. All fragments were incubated with Gibson assembly mix (New England Biolabs) as per manufacturer’s instructions.
Talin-2 was knocked down in Tln1^−/− cells (Priddle et al., 1998 (link)) by transient transfection of Tln2 siRNA (ONTARGET-plus Smartpool siRNA, Catalog ID:L-065877-00-0005, Horizon Discovery) and scrambled siRNA (AM4636; Ambion), using Lipofectamine RNAimax, as described previously (Kumar et al., 2016 (link)). Knockdown was confirmed by immunoblotting for talin-2 using mouse anti-talin-2 antibody (AC14-0126; Abcore). These cells were transfected with full-length WT talin-1 and full-length talin-1-17b variant, using Lipofectamine 2000 (Thermo Fisher Scientific) for 24 h and trypsinized for all experiments at this time point. For early adhesion analysis, Tln1−/−transfected cells were held in suspension for 30 min and plated on fibronectin-coated glass bottom dishes for 15 min, 30 min, 1 h, and 4 h. Cells were fixed in 4% paraformaldehyde and counterstained with Alexa 405 phalloidin (Thermo Fisher Scientific) and anti-vinculin antibody (V9131; Sigma-Aldrich). Cells were imaged using a 63× objective on a Leica SP8 confocal microscope. ImageJ was used to assess cell area, focal adhesion area, focal adhesion number and mean fluorescence intensities of vinculin and talin within each adhesion. To assess substrate stiffness–dependent cell spreading, cells were trypsinized and plated on either fibronectin-coated (10 µg/ml) glass-bottom dishes or polyacrylamide gels of varying stiffness. At 6 h, cells were fixed in 4% paraformaldehyde and counterstained with Alexa 647 phalloidin (Thermo Fisher Scientific). The cell area was calculated using ImageJ.
For tensin-1 localization, cells were plated for 48 h and counter-stained with tensin-1 (SAB4200283; Sigma-Aldrich). Talin adhesions that were within 7 µm from centroid of the cell were considered central adhesions and tensin intensity was quantified within these adhesions. Mean of tensin intensity within central adhesions was divided by mean of tensin intensity of peripheral adhesions in each cell and the ratio was plotted. β-catenin staining was also performed on densely seeded cells using anti-β-catenin antibody (9562; CST).

Gallego-Paez L.M., Edwards W.J., Chanduri M., Guo Y., Koorman T., Lee C.Y., Grexa N., Derksen P., Yan J., Schwartz M.A., Mauer J, & Goult B.T. (2023). TLN1 contains a cancer-associated cassette exon that alters talin-1 mechanosensitivity. The Journal of Cell Biology, 222(5), e202209010.

Full text: Click here

Publication 2023

Antibodies, Anti-Idiotypic ARID1A protein, human Cells CTNNB1 protein, human Fluorescence FN1 protein, human Focal Adhesions Hyperostosis, Diffuse Idiopathic Skeletal Lipofectamine lipofectamine 2000 Microscopy, Confocal Mus Nucleotides Oligonucleotide Primers paraform Phalloidine Plasmids polyacrylamide gels RNA, Small Interfering Talin Tensin Tissue Adhesions Transfection Transients Vinculin

Multimodal Prostate Cancer Evaluation

The analysis will be conducted according to the guidelines [4 (link)]. Specifically, specimens are labeled by location and, if applicable, whether they were obtained by SB, PET-TB, or MR-TB. Furthermore, the number of positive cores and the highest Gleason score per prostate lobe, per biopsy method, and per suspicious area (MRI and/or PSMA-PET/CT) are determined. Moreover, the loss of the tumor suppressor gene phosphatase and tensin homolog (PTEN) and PSMA expression will be determined in tumor-bearing biopsy specimens by immunohistochemistry. PSMA expression will be rated by an institutional-established valid semi-quantitative scale ranging from 0 to 3: “none,” “low,” “intermediate,” or “high,” respectively.

Krausewitz P., Bundschuh R.A., Gaertner F.C., Essler M., Attenberger U., Luetkens J., Kristiansen G., Muders M., Ohlmann C.H., Hauser S., Ellinger J, & Ritter M. (2023). DEPROMP Trial: the additive value of PSMA-PET/CT-guided biopsy for prostate cancer management in biopsy naïve men—study protocol for a randomized trial. Trials, 24, 167.

Full text: Click here

Publication 2023

Biopsy Immunohistochemistry Neoplasms Phosphoric Monoester Hydrolases Prostate PTEN protein, human Scan, CT PET Tensin Tumor Suppressor Genes

Immunohistochemical Profiling of CTEN in Canine Squamous Cell Carcinoma

The immunohistochemical (IHC) technique was performed in 45 canine SCC sections (3 μm thick) from formalin-fixed paraffin-embedded (FFPE) tissues to investigate CTEN’s expression. The protocol was divided into two parts and included the usage of the kit NovolinkTM Polymer Detection Systems (Leica Biosystems^®, Newcastle, UK).
In the first part, the samples were dewaxed in xylene for 15 min, followed by hydration in graded alcohols (100%, 95%, 80%, and 70%), for 5 min each. For antigen retrieval, the samples were submersed in citrate buffer solution (10 mM, pH 6.0 ± 0.2) and heated in a 750 W microwave for 3 cycles, 5 min each. For peroxidase inhibition, we applied 3% hydrogen peroxide (H₂O₂) for 30 min and, after washing with PBS, the sections were incubated with Protein Block for 5 min. The first part of this procedure ended with the incubation of the antibody tensin-4 (Thermofisher^®, Waltham, MA, United States), clone SP83, rabbit anti-human, Invitrogen MA516355), diluted 1:100 in PBS for 24 h at 4 °C. In the second part of the protocol, we applied post-primary reagent, followed by Novolink Polymer, each for 30 min. After several washings with PBS, the samples were revealed, by incubation of 3,3-diaminobenzidine (DAB) (Novocastra^®, kit NovolinkTM Polymer Detection Systems, Leica Biosystems^®, Newcastle, UK) for 10 min and counterstained with Gill’s hematoxylin for 1 min. After washing with water, the sections were dehydrated in graded alcohols (95%, 95%, 100%, 100%) for 3 min each, diaphanized in xylene, and then mounted with the aqueous mounting medium Entellan (Merck^®, Rahway, NJ, United States).
We performed two different types of control tissues, namely positive and negative control. As a positive control, we chose a tissue that was collected from a canine prostate tumor, since CTEN expression in normal tissues is restricted to the prostate and placenta in humans [1 (link)]. For the negative control, one SCC sample was treated with PBS instead of using the antibody, to demonstrate that the staining was a result of the interaction between the target cell and CTEN.

Monteiro A., Delgado L., Monteiro L., Pires I., Prada J, & Raposo T. (2023). Immunohistochemical Expression of Tensin-4/CTEN in Squamous Cell Carcinoma in Dogs. Veterinary Sciences, 10(2), 86.

Full text: Click here

Publication 2023

Alcohols Antigens Buffers Canis familiaris Cells Citrates Clone Cells entellan Ethanol Formalin Gills Hematoxylin Histocompatibility Testing Homo sapiens Immunoglobulins Microwaves Paraffin Peroxidase Peroxide, Hydrogen Placenta Polymers Prostate Prostatic Neoplasms Proteins Psychological Inhibition Rabbits Tensin Tissues Xylene

Western Blot Analysis of PPARγ, PTEN, β-Actin

Total protein extracts (50 μg) were subjected to SDS-PAGE as described [29 (link)]. After blocking, proteins were probed with anti-PPARγ (PA3-821A), anti-phosphatase and tensin homolog PTEN (sc25778) and anti-β-Actin (sc69879) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) antibodies, overnight, and images were acquired using Odyssey FC (Licor, Lincoln, NB, USA).

Augimeri G., Fiorillo M., Morelli C., Panza S., Giordano C., Barone I., Catalano S., Sisci D., Andò S, & Bonofiglio D. (2023). The Omega-3 Docosahexaenoyl Ethanolamide Reduces CCL5 Secretion in Triple Negative Breast Cancer Cells Affecting Tumor Progression and Macrophage Recruitment. Cancers, 15(3), 819.

Full text: Click here

Publication 2023

Actins Antibodies Cardiac Arrest Phosphoric Monoester Hydrolases PPAR gamma PTEN protein, human SDS-PAGE Tensin

Quantitative Analysis of Circular RNAs and miRNAs

Total RNA was isolated from HBMVECs and brain infarct tissues using TRIzol reagent (Themo Fisher). Total RNA was reversely transcribed using a one-step method RT-qPCR kit (Sangon Biotech, Shanghai, China) and then amplified with PCR primers on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Inc., Hercules, CA, USA). Expression of the target genes were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 using the 2^−ΔΔCt method. The primer sequences are shown in Table 1.

Table 1

PCR primers sequences for gene

Gene name	Primers
hsa-Circ VRK1	Forward:5′-TACCAACGAGCTGCAAAACC-3′
hsa-Circ VRK1	Reverse: 5′-TCACTCCCAAAGCGATCCAT-3′
mmu-Circ VRK1	Forward:5′-GGCGGACACAAATTCTTCCA-3′
mmu-Circ VRK1	Reverse: 5′-ACTCCCAAAGCGGTCCATTA-3′
hsa-miR-17	Forward:5′-TGCTTACAGTGCAGGTAG-3′
hsa-miR-17	Reverse: 5′-GAACATGTCTGCGTATCTC-3′
mmu-miR-17	Forward:5′-AAGTGCTTACAGTGCAGGT-3′
mmu-miR-17	Reverse: 5′-GAACATGTCTGCGTATCTC-3′
(hsa and mmu) PTEN	Forward:5′-CATGTTGCAGCAATTCACTG-3′
(hsa and mmu) PTEN	Reverse: 5′-CTTGTGAAACAACAGTGCCA-3′
(hsa and mmu)VEGF	Forward: 5′-TTGCCTTGCTGCTCTACCTCCA − 3′
(hsa and mmu)VEGF	Reverse: 5′-GATGGCAGTAGCTGCGCTGATA − 3′
(hsa and mmu) U6	Forward:5′-CTCGCTTCGGCAGCACATA-3′
(hsa and mmu) U6	Reverse: 5′-AACGCTTCACGAATTTGCG-3′
(hsa and mmu) GAPDH	Forward: 5′-CATCACTGCCACCCAGAAGACTG-3′
(hsa and mmu) GAPDH	Reverse: 5′-ATGCCAGTGAGCTTCCCGTTCAG-3′

hsa homo sapiens; mmu mus musculus; circRNAs circular RNAs; miRNA microRNA; PTEN phosphatase and tensin homolog; VEGF vascular endothelial growth factor; GAPDH glyceraldehyde-3-phosphate dehydrogenase

Yang L., Du H., Zhang X., Gao B., Zhang D., Qiao Z., Su X., Bao T, & Han S. (2023). Circ VRK1/microRNA-17/PTEN axis modulates the angiogenesis of human brain microvascular endothelial cells to affect injury induced by oxygen-glucose deprivation/reperfusion. BMC Neuroscience, 24, 8.

Full text: Click here

Publication 2023

5-mercaptomethyluracil Brain Infarction Gene Expression Glyceraldehyde-3-Phosphate Dehydrogenases Homo sapiens Mice, House MicroRNAs Oligonucleotide Primers PTEN Phosphohydrolase RNA, Circular Tensin Tissues Touch trizol Vascular Endothelial Growth Factors

Top products related to «Tensin»

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Cleaved caspase 3 by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Germany, Canada, Japan, Morocco, Denmark, Switzerland, France, Netherlands, Macao

Cleaved caspase-3 is an antibody that detects the activated form of caspase-3 protein. Caspase-3 is a key enzyme involved in the execution phase of apoptosis, or programmed cell death. The cleaved caspase-3 antibody specifically recognizes the active, cleaved form of the enzyme and can be used to monitor and quantify apoptosis in experimental systems.

β actin by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, Sweden, Netherlands, Switzerland, Italy, Belgium, Australia, France, India, Ireland

β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is an important component of the microfilament system and is involved in various cellular processes such as cell motility, structure, and integrity.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

P akt by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Germany, Canada, Japan, Netherlands, France, Sao Tome and Principe, Hong Kong, Italy, Australia

P-AKT is a phosphorylated form of the AKT protein, a key signaling molecule involved in various cellular processes. The product is used for the detection and quantification of phosphorylated AKT in biological samples.

Trizol by Thermo Fisher Scientific

Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines

TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

Gapdh by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, France, Netherlands, Ireland, Israel, Australia, Sweden, Macao, Switzerland

GAPDH is a protein that functions as an enzyme involved in the glycolysis process, catalyzing the conversion of glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate. It is a common reference or housekeeping protein used in various assays and analyses.

Pvdf membrane by Merck Group

Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria

PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.

Bcl 2 by Cell Signaling Technology

Sourced in United States, China, United Kingdom, Germany, Canada, Japan, Italy, India

Bcl-2 is a protein that plays a key role in regulating apoptosis, or programmed cell death. It functions as an anti-apoptotic protein, helping to prevent cell death by inhibiting the activity of pro-apoptotic proteins.

P pten by Cell Signaling Technology

Sourced in United States

P-PTEN is a phosphorylated form of the PTEN protein, which is a crucial phosphatase involved in the regulation of the PI3K/Akt signaling pathway. This product can be used to detect and study the phosphorylation state of PTEN in various biological samples.

What are the key functions of Tensins in cells?

How do Tensins differ from other cytoskeletal proteins?

What are some common applications of Tensin research?

How can PubCompare.ai help with Tensin-related research?

PubCompare.ai's AI-powered research platform can assist with Tensin research in several ways. It allows you to screen protocol literature more efficiently, leverage AI to pinpoint critical insights, and help researchers identify the most effective protocols related to Tensin for their specific research goals. The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy.

Are there different types or variants of Tensins?

More about "Tensin"

Tensins are a family of cytoskeletal linker proteins that connect integrins to the actin cytoskeleton.
These versatile proteins play a crucial role in cell adhesion, migration, and signaling, making them an essential component of the cellular framework.
By leveraging PubCompare.ai's AI-powered research platform, researchers can gain comprehensive insights into Tensin optimization and comparison, rapidly identifying relevant protocols from literature, preprints, and patents.
Utilizing cutting-edge AI-driven comparisons, researchers can pinpoint the most effective Tensin-related protocols and products, streamlining the research process and enabling informed decisions.
This powerful tool allows for the discovery of the latest advancements in Tensin research, empowering researchers to stay at the forefront of this dynamic field.
Tensin optimization and comparison can be further enhanced by exploring related techniques and tools, such as Lipofectamine 2000 for efficient transfection, Cleaved caspase-3 as a marker of apoptosis, β-actin for normalization, FBS for cell culture, P-AKT for signaling pathways, TRIzol for RNA extraction, GAPDH as a housekeeping gene, PVDF membranes for Western blotting, and Bcl-2 and P-PTEN for cellular processes.
By integrating these complementary approaches, researchers can gain a deeper understanding of Tensin-related mechanisms and develop innovative solutions to address their research objectives.
PubCompare.ai's advanced technology provides a seamless and efficient way to explore the latest advancements in Tensin research, empowering scientists to make informed decisions and drive their projects forward with confidence.
Embark on your Tensin exploration with the support of this cutting-edge platform and unlock new possibilities in your field of study.