Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Topoisomerase II

Topoisomerase II

Topoisomerase II is a critical enzyme involved in the regulation of DNA topology and chromatin structure.
It plays a crucial role in essential cellular processes such as DNA replication, transcription, and chromosome segregation.
This enzyme catalyzes the interconversion of various topological forms of DNA, including the relaxation of supercoiled DNA and the decatenation of interlocked DNA molecules.
Topoisomerase II is an important target for anticancer drugs, as its inhibition can lead to the accumulation of DNA damage and cell death in rapidly dividing cancer cells.
Researchers studying this enzyme can optimize their work with PubCompare.ai, a leading AI platform that enhances reproducibility and accuracy in the field.
PubCompare.ai can effortlessly help locate the best protocols from literature, preprints, and patents using AI-driven comparisons, allowing researchers to identify the most effective products and methods to take their Topoisomerase II research to the next level.

Most cited protocols related to «Topoisomerase II»

1
Construction of HygR Cassette for Cas9-Mediated Gene Deletion
A hygromycin B phosphotransferase expression cassette, referred to as here as HygR, was used as the selectable marker for Cas9-mediated gene deletion throughout this work. A 2,890-bp region, which spans 1,053 bp of the gpdA promoter, 1,020 bp of hygromycin B phosphotransferase (hph), and 817 bp of the trpC terminator, was PCR amplified from plasmid pUCGH (55 (link)) using the primers gpdA(p)-For and trpC(t)-Rev (Table 1). The resulting HygR cassette was cloned into pCR-Blunt II-TOPO using the Zero Blunt TOPO PCR cloning kit (Invitrogen) according to the manufacturer’s instructions. Positive clones were Sanger sequenced to confirm the absence of mutations, and the resulting plasmid was designated pCR-HygR. For generation of the repair templates needed for Cas9-mediated gene deletion, the HygR cassette was PCR amplified from plasmid pCR-HygR using either primer set 35 bp-pksP-HygR-F and 35 bp-pksP-HygR-R or primer set 50 bp-pksP-HygR-F and 50 bp-pksP-HygR-R. The resulting PCR fragments were purified using the GeneJET gel extraction kit (Thermo Scientific) and eluted using nuclease-free water. These purified PCR products were utilized as the completed repair templates and were composed of a 2,890-bp HygR cassette flanked by either 35 bp or 50 bp of microhomology regions targeting the pksP gene locus (Afu2g17600).
Al Abdallah Q., Ge W, & Fortwendel J.R. (2017). A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates. mSphere, 2(6), e00446-17.
Full text: Click here
Publication 2017
Clone Cells Gene Deletion Genetic Loci hygromycin-B kinase Mutation Oligonucleotide Primers Plasmids Topoisomerase II Topotecan
2
Amplification and Characterization of HERV-K Transcripts
We amplified rec and np9 mRNA representing PCR products from tissue cDNA panels employing forward primers rec-np9-for-1: 5′-ATG AAC CCA TCA GAG ATG CAA-3′; rec-np9-for-2: 5′-ATG AAT CCA TCA GAG ATG CAA-3′; rec-np9-for-3: 5′-GCG AAC CCT TCA GAG ATG CAA-3′; rec-np9-for-4: 5′-ATG AAC CCA TCG GAG ATG AAA-3′; that were combined in a ratio of 85/5/5/5, and reverse primers rec-np9-rev-1: 5′-AGC ATC TGT TTA ACA AAG CA-3′; rec-np9-rev-2: 5′-AGC ATG TTT AAC AAA GCA-3′ 5% combined in a ratio of 95/5. The various primer variants considered sequence differences of HERV-K(HML-2) loci within primer binding regions. PCR products were amplified using standard conditions with AmpliTaq Gold (Applied Biosystems/Life Technologies, Carlsbad, CA, USA) DNA polymerase and the following PCR program: 12 min 95°C; 35 cycles: 50 s 95°C, 50 s 58°C, 30 s 72°C, and final elongation 10 min 72°C. PCR products were separated by agarose gel electrophoresis; np9 and rec representing PCR products were purified from gels using NucleoSpin Gel and PCR Clean-Up Kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany). Products were cloned into pCR II-TOPO (Invitrogen/Life Technologies) and transformed into Escherichia coli DH-5α cells. Plasmid DNA from randomly selected bacterial colonies was purified and subjected to Sanger sequencing (see below).
We amplified rec and np9 mRNA representing cDNA from total RNA from heart, brain, and colon tissues by RT-PCR following a previously established procedure [21 (link)]. PCR products were cloned into pGEM T-Easy (Promega GmbH, Mannheim, Germany). Plasmid DNA from randomly selected bacterial colonies was prepared as described before [32 (link)].
cDNA inserts were sequenced using vector-specific T7 primer and an Applied Biosystems 3730 DNA-Analyzer (Seq-IT GmbH, Kaiserslautern, Germany). Sequence qualities were verified by eye, and poor quality sequence reads were excluded from further analysis.
Schmitt K., Heyne K., Roemer K., Meese E, & Mayer J. (2015). HERV-K(HML-2) rec and np9 transcripts not restricted to disease but present in many normal human tissues. Mobile DNA, 6, 4.
Full text: Click here
Publication 2015
Brain Cells Cloning Vectors Colon DNA, Bacterial DNA, Complementary DNA-Directed DNA Polymerase Electrophoresis, Agar Gel Escherichia coli Gold Heart Human Endogenous Retroviruses Oligonucleotide Primers Plasmids Promega prostaglandin M Reverse Transcriptase Polymerase Chain Reaction RNA, Messenger Tissues Topoisomerase II Training Programs
3
Quantitative SARS-CoV-2 N gene detection

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2020
Base Pairing Base Sequence Biological Assay Centrifugation Cloning Vectors Coronavirus Dental Plaque Deoxyribonuclease I Genes isolation Muscle Tissue Nucleocapsid Nucleotides Oligonucleotide Primers Open Reading Frames Plasmids SARS-CoV-2 Severe Acute Respiratory Syndrome Tissues Topoisomerase II Transcription, Genetic Vero Cells zirconium oxide
4
CRISPR-Cas9 Targeting of PpAPT in Physcomitrella
The pAct‐Cas9 plasmid used in this study contains a Cas9 expression cassette containing the rice actin 1 promoter and a codon‐optimized version of Cas9 from Streptococcus pyogenes fused to a SV40 nuclear localization (Mali et al., 2013). The pAct‐Cas9 plasmid was constructed as follows: the hCas9 plasmid (plasmid#41815 from AddGene) was digested by NcoI and PmeI and the hCas9 gene was ligated to the pCOR104‐CaMVter plasmid (Proust et al., 2011) previously digested by NcoI and SmaI.
Two sgRNA expression cassettes were designed, each containing a U6 promoter from P. patens, the 5′‐G‐N(19)‐3′ sequences targeting PpAPT and the tracrRNA scaffold (Mali et al., 2013; Figures 1 and S1). P. patens genomic sequence for the U6 gene (coordinates 5050300–5050958 on chromosome 1) was identified by Basic Local Alignment Search Tool (http://www.phytozome.net/physcomitrella_er.php) using the Arabidopsis U6‐26 snRNA sequence (X52528; Li et al., 2007) as query. U6 promoter sequence coordinates used for gRNA expression are 5050300–5050621 on chromosome 1. For the design of CRISPR‐Cas targets in the PpAPT gene, both strands of the P. patens adenine phosphoribosyltransferase gene (PpAPT, Phytozome # Pp3c8_16590) were searched using the CRISPOR, free software (http://tefor.net/crispor/crispor.cgi), for sequences of the form 5′‐G‐N(18 or 19)NGG‐3′ with respect to the U6 promoter and Cas9 specificity conditions. Two target loci were selected, one in exon 5 (sgRNA#1) and one in exon 3 (sgRNA#2) of the PpAPT gene (Figure 1). The sgRNA1 and sgRNA2 cassettes were synthesized as gBlocks® by IDT (www.idtdna.com), PCR‐amplified and introduced into pCR®II‐TOPO® TA‐cloning vectors (www.lifetechnologies.com) to give the plasmids psgRNA#1 and psgRNA#2.
Two donor DNA cassettes were used for gene targeting experiments. The PpAPT‐KO4 knockout cassette used for gene targeting experiments bears a 715‐bp 5′ targeting fragment (coordinate 772–1486 on Pp3c8_16590 in Phytozome) and a 702‐bp 3′ targeting fragment (coordinate 1487–2188 on Pp3c8_16590 in Phytozome) of the PpAPT gene, flanking a pAct :: hygroR cassette from the pActHygR plasmid. The pActHygR carries a HPH gene for resistance to hygromycin (Bilang et al., 1991) in fusion with the rice actin 1 promoter from pCOR104 (McElroy et al., 1991) and before a NOS terminator. The 5′ and 3′ sequences of the PpAPT gene present in the PpAPT‐KO4 cassette are flanking the predicted CRISPR‐mediated DSB for target#1 sequence (coordinate 1468–1487 on Pp3c8_16590 in Phytozome). The PpAPT‐KO7 knockout cassette bears a 743‐bp 5′ targeting fragment (coordinate 156–898 on Pp3c8_16590 in Phytozome) and a 778‐bp 3′ targeting fragment (coordinate 917–1694 on Pp3c8_16590 in Phytozome) of the PpAPT gene, flanking a 35S :: neoR cassette from pBNRF for resistance to G418 (Schaefer et al., 2010) cloned in a pCR®II‐TOPO® TA‐cloning vector. The 5′ and 3′ sequences of the PpAPT gene present in the PpAPT‐KO7 cassette are flanking the predicted CRISPR‐mediated DSB for the target#2 sequence (coordinate 890–909 on Pp3c8_16590 in Phytozome).
Collonnier C., Epert A., Mara K., Maclot F., Guyon‐Debast A., Charlot F., White C., Schaefer D.G, & Nogué F. (2016). CRISPR‐Cas9‐mediated efficient directed mutagenesis and RAD51‐dependent and RAD51‐independent gene targeting in the moss Physcomitrella patens. Plant Biotechnology Journal, 15(1), 122-131.
Full text: Click here
Publication 2016
Actins Adenine Phosphoribosyltransferase antibiotic G 418 Arabidopsis Bears Chromosomes, Human, Pair 1 Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Codon crRNA, Transactivating Exons Genes Genes, vif Genome HMN (Hereditary Motor Neuropathy) Proximal Type I hygromycin A Physcomitrella Plasmids Rice Simian virus 40 Streptococcus pyogenes Tissue Donors Topoisomerase II U6 small nuclear RNA
5
Generating Kif15-Deficient HeLa Cell Lines
HeLa “Kyoto” (HeLa) cells were cultured in DMEM containing 10% FCS, penicillin, and streptomycin. K5I-resistant cell lines were generated by culturing HeLa cells in 10 µM STLC (Sigma-Aldrich). Individual clonal cell lines were isolated ∼4 wk after the initiation of selection and are continuously cultured in 10 µM STLC.
CRISPR (Mali et al., 2013 (link)) was used to generate a HeLa cell line largely lacking the Kif15 protein (KIF15Δ). The sequence 5′-CCTGCGAGTAGTCCTTCATTCTG-3′, which corresponds to nucleotides 2,406–2,428 within the KIF15 ORF, was used to target Cas9 to KIF15 because it is only represented once within the human genome (see WES and analysis), minimizing the chance of off-target genome alterations. A gBlock (IDT) containing the U6 promoter, KIF15 targeting sequence, guide RNA scaffold, and termination signal was synthesized and cloned into pCR-Blunt II-TOPO (Invitrogen). This plasmid was cotransfected with pcDNA3.3-Cas9 (Addgene) twice into HeLa cells using Lipofectamine 2000 according to the manufacturer’s recommendations. Single clones were isolated by limiting dilution, and analyzed for a lack of Kif15 protein by immunostaining.
For transgenesis in HeLa and KIF15Δ cells, we used a high-efficiency and low-background RMCE system (Khandelia et al., 2011 (link)). In brief, acceptor cell lines were created by lentiviral transduction of a cassette containing the EF-1α promoter and a blasticidin-resistance gene flanked by two Cre recombinase–specific sites. Cells at 40% confluence were infected with serial dilutions of pEM584 lentivirus stock (Khandelia et al., 2011 (link); a gift from E. Makeyev, King’s College London, London, England, UK) and incubated in DMEM containing 10% FBS, penicillin, and streptomycin, and 10 µg/ml blasticidin S until single colonies emerged. Candidate acceptor clones were isolated and tested for RMCE using pEM784 and pEM791 as previously described (Khandelia et al., 2011 (link); gifts from E. Makeyev). To generate HeLa and KIF15Δ cells that express EGFP or EGFP-Kif15 in a doxycycline-inducible manner, acceptor cell lines were cotransfected in six-well plates with a 1:10 ratio (wt/wt) of pEM784 and either pEM791 or pRO1248 (see Molecular biology and baculovirus construction). 1 d after transfection, cells were cultured in the presence of 1 µg/ml puromycin for 48 h and then incubated in media containing 2 µg/ml puromycin until puromycin-sensitive cells were eliminated. Puromycin-resistant cells were then expanded in media containing 1 µg/ml puromycin and pooled. EGFP or EGFP-Kif15 expression was induced with 2 µg/ml doxycycline in DMEM containing 10% FBS, penicillin, and streptomycin.
siRNA transfections were performed using HiPerfect (QIAGEN) according to the manufacturer’s recommendations. The following siRNAs were used in this study: Kif15, 5′-GGACAUAAAUUGCAAAUAC-3′ (Dharmacon); Nuf2, 5′-AAGCATGCCGTGAAACGTATA-3′ (QIAGEN); and Eg5, 5′-CUGAAGACCUGAAGACAAUdTdT-3′ (QIAGEN; DeLuca et al., 2002 (link); Weil et al., 2002 (link); Tanenbaum et al., 2009 (link)). For control depletions, cells were transfected with All Stars siRNA (#1027280; QIAGEN) or Stealth RNAi (#12935111; Invitrogen). Kif15 depletions were analyzed ∼24 h after transfection with the exception of cell viability, which was quantified ∼48 h after transfection. Eg5 depletions were analyzed ∼24 h after transfection, and Nuf2 depletions were analyzed ∼48 h after transfection. Plasmid transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations and analyzed ∼24 h after transfection. FCPT (a gift from T. Mitchison, Harvard Medical School, Boston, MA) was used at 200 µM and DMSO at 0.1% for 30 min.
Sturgill E.G., Norris S.R., Guo Y, & Ohi R. (2016). Kinesin-5 inhibitor resistance is driven by kinesin-12. The Journal of Cell Biology, 213(2), 213-227.
Publication 2016
Baculoviridae blasticidin S Cell Lines Cells Cell Survival Clone Cells Clustered Regularly Interspaced Short Palindromic Repeats Doxycycline Genes Genome Genome, Human Gifts HeLa Cells Lentivirus lipofectamine 2000 Nucleotides Penicillins Plasmids Proteins Puromycin RNA, Small Interfering RNA Interference Site-specific recombinase Staphylococcal Protein A Stars, Celestial Streptomycin Sulfoxide, Dimethyl Technique, Dilution Topoisomerase II Transfection

Most recents protocols related to «Topoisomerase II»

1
Molecular Modeling and Docking of Potential Inhibitors
The compound was designed using ChembioDraw Professional 13.0 [56 ] and was converted to 2D by using BIOVIA Discover Studio Visualizer 17.2.0.16349 [57 ]. Structure optimization was achieved by applying the Hahn forcefield [58 (link)]. Optimized structures were used for the docking study. Crystal structure of dihydropteroate synthase, 5uoy [59 (link)], DNA topoisomerase II gyrase; 5mmn [60 (link)], and SARS-CoV-2 spike; 6vsb [61 (link)] were retrieved from protein data bank with resolutions 1.82 Å, 1.90 Å and 3.46 Å respectively. Protein editing was done by means of Discovery Studio[57 ] which included the deletion of co-crystallized ligands, multiple chains, hetero atoms, the water of crystallization, the addition of polar hydrogens, energy minimization, and structure optimization [58 (link)]. Enhanced proteins were used for molecular docking.
Ugwu D.I., Eze F.U., Ezeorah C.J., Rhyman L., Ramasami P., Tania G., Eze C.C., Uzoewulu C.P., Ogboo B.C, & Okpareke O.C. (2023). Synthesis, Structure, Hirshfeld Surface Analysis, Non-Covalent Interaction, and In Silico Studies of 4-Hydroxy-1-[(4-Nitrophenyl)Sulfonyl]Pyrrolidine-2-Carboxyllic Acid. Journal of Chemical Crystallography.
Publication 2023
Crystallization Deletion Mutation Dihydropteroate Synthase DNA Gyrase Hydrogen Ligands Proteins SARS-CoV-2 Topoisomerase II
2
RCAS-TVA-mediated SNAIL overexpression
To overexpress SNAIL in cell lines via the RCAS-TVA system59 (link),63 (link), the murine Snail cDNA was amplified and cloned into the pCR-Blunt II-TOPO vector (Invitrogen). After AatII/NdeI digestion, Snail cDNA was ligated to a modified pENTR/D-TOPO (Invitrogen) vector carrying dsRed under the control of the EF1α promoter 3’ to the Snail insertion side. Further cloning into RCASBP(A)-Att-CCDB-Att (modified from RCASBP(A), kindly provided by Stephen H. Hughes) was performed using the GatewayR LR Clonase (Invitrogen) mix to generate the final retroviral construct.
To generate RCAS vectors, the chicken fibroblast cell line DF-1 (American Type Culture Collection # CRL-12203 (RRID:CVCL_0570) was transfected using Superfect (Qiagen) with 2.5 µg purified RCAS plasmid. Fresh virus-containing supernatant was filtered through 0.45 μm pores and added to the medium of murine tumour cells carrying the TVA receptor59 (link). Transduction with fresh supernatant was repeated daily until 80% cells showed expression of the dsRed reporter gene (Supplementary Fig. S3f).
Paul M.C., Schneeweis C., Falcomatà C., Shan C., Rossmeisl D., Koutsouli S., Klement C., Zukowska M., Widholz S.A., Jesinghaus M., Heuermann K.K., Engleitner T., Seidler B., Sleiman K., Steiger K., Tschurtschenthaler M., Walter B., Weidemann S.A., Pietsch R., Schnieke A., Schmid R.M., Robles M.S., Andrieux G., Boerries M., Rad R., Schneider G, & Saur D. (2023). Non-canonical functions of SNAIL drive context-specific cancer progression. Nature Communications, 14, 1201.
Full text: Click here
Publication 2023
Cell Lines Cells Chickens Cloning Vectors Digestion DNA, Complementary Fibroblasts Gene Expression Helix (Snails) LINE-1 Elements Mus Neoplasms Plasmids Retroviridae Topoisomerase II Topotecan Virus
3
RASSF1 Promoter Cloning and Luciferase Assay
The genomic DNA was extracted from HFFF2 cells using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD, USA) according to the supplied protocol. The RASSF1 promoter region (−930 to +38 relative to the transcription initiation site) was amplified by PCR using 100 ng genomic DNA, Q5 High‐Fidelity DNA polymerase (New England BioLabs, Ipswich, MA, USA), and the primers 1 (forward) (5′‐GCTGGAGCGAGAAAACAGAG) and 2 (reverse) (5′‐CAATGGAAACCTGGGTGCAG). The PCR product size was 969 base pairs. Following PCR, the generated fragment was subcloned into a pCR‐Blunt II‐TOPO vector (Invitrogen, Carlsbad, CA, USA). Then, the target fragment, co‐digested by KpnI and EcoRV (New England BioLabs), was subcloned into the KpnI and EcoRV sites of pBV‐Luc vector [52 (link)] (a gift from Bert Vogelstein; Addgene plasmid # 16539; http://n2t.net/addgene:16539; RRID: Addgene_16539), carrying a firefly luciferase coding sequence under the control of a minimal promoter. All constructs were confirmed by sequencing.
Zhang Y., Huynh‐Dam K., Ding X., Sikirzhytski V., Lim C., Broude E, & Kiaris H. (2023). RASSF1 is identified by transcriptome coordination analysis as a target of ATF4. FEBS Open Bio, 13(3), 556-569.
Full text: Click here
Publication 2023
BLOOD Cloning Vectors DNA-Directed DNA Polymerase Genome Luciferases, Firefly Oligonucleotide Primers Open Reading Frames Plasmids Tissues Topoisomerase II Transcription Initiation Site
4
Arabidopsis Promoter-GFP Fusion Constructs
The fusion gene constructs with various lengths of GLN1;2 (At1g66200), GLT1 (At5g53460) and GLU2 (At2g41220) promoters were generated as follows. The 5’-intergenic regions upstream of coding sequences of GLN1;2, GLT1 and GLU2 were amplified by polymerase chain reaction (PCR) from genomic DNA of Arabidopsis Col-0 accession and cloned as promoter fragments to generate the GFP reporter fusion constructs. PCR was carried out using KOD plus DNA polymerase (Toyobo, Osaka, Japan) and pairs of forward and reverse oligonucleotide (Table 1). The forward primers were designed for amplification of promoter fragments starting 3,583-bp upstream of the translation initiation site of GLN1;2, 2,814-bp, 2,200-bp, 2,100-bp, 2,000-bp, 1,930-bp, 1,730-bp, and 1,050-bp upstream of GLT1, and 1,358-bp upstream of GLU2. Among these forward primers, GLN1;2P3583L_F designed for the amplification of GLN1;2 promoter region has an overhang of a HindIII site (AAGCTT) at the 5’-end. The rest of the forward primers designed for the amplification of GLT1 and GLU2 promoter regions have an overhang of a BamHI site (GGATCC) at the 5’-end. The reverse primers were designed to have the complementary sequences with the 5’-untranslated regions immediately upstream of the translation initiation sites of GLN1;2, GLT1 and GLU2. These reverse primers have an overhang of an NcoI site (CCATGG) at the 5’-end. The ATG in the NcoI site is the translation initiation site for GFP. The amplified PCR products were subcloned into pCR-Blunt II-TOPO (Thermo Fisher Scientific K.K., Tokyo, Japan), and fully sequenced to confirm the identity. These promoter fragments were then cut out as a HindIII-NcoI fragment (for GLN1;2) or BamHI-NcoI fragments (for GLT1 and GLU2) and cloned into respective restriction sites of pTH-10KI, replacing the cauliflower mosaic virus (CaMV) 35S promoter, to obtain the promoter:GFP:teminator cassettes. pTH-10KI is the modified version of CaMV35S-synthetic GFP (sGFP, S65T) vector(Chiu et al., 1996 (link); Niwa et al., 1999 (link)) and has a full EGFP coding sequence (Takara Bio Inc. Shiga, Tokyo) between the 35S promoter and the nopaline synthase terminator (NosT). Finally, the promoter:GFP : NosT cassettes created in pTH-10KI were cut out as a HindIII-EcoRI fragment (for GLN1;2) or BamHI-EcoRI fragments (for GLT1 and GLU2) and cloned into pBI101 (Takara Bio Inc.). These binary vector plasmids were introduced into Agrobacterium tumefaciens GV3101 (pMP90) by freeze-thaw method as previously described (Ishiyama et al., 2004a (link)). Arabidopsis plants were transformed according to the floral dip method (Clough and Bent, 1998 (link)). Transgenic plants were selected on GM medium (Valvekens et al., 1988 (link)) containing 50 mg/L kanamycin sulfate. Kanamycin-resistant T2 progenies were used for analyses.
Kojima S., Minagawa H., Yoshida C., Inoue E., Takahashi H, & Ishiyama K. (2023). Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply. Frontiers in Plant Science, 14, 1127006.
Full text: Click here
Publication 2023
Agrobacterium tumefaciens Arabidopsis Cauliflower Mosaic Virus Cloning Vectors Decompression Sickness Deoxyribonuclease EcoRI DNA-Directed DNA Polymerase Exons Freezing Genes Genome Intergenic Region Kanamycin Kanamycin Sulfate nopaline dehydrogenase Oligonucleotide Primers Oligonucleotides Open Reading Frames Plants Plants, Transgenic Plasmids Topoisomerase II Transcription Initiation Site Untranslated Regions
5
Amplification and Cloning of Receptor Genes
To amplify Arc/Arg3.1, we used the following primers: for: 5′-CGA AGT GTC CAA GCA GGT G-3′; and rev: 5′-TGA TGG CAT AGG GGC TAA CA-3′. To amplify NO-GC, we used the following primers: for: 5′-ATC CTC TTC AGC GGC ATT GTG-3′ and rev: 5′-TGC ATT GGT TCC TTC TTG CCC-3′. To amplify GC-A, we used the following primers: for: 5′-TGT GAA ACG TGT GAA CCG GA-3′ and rev: 5′-AGG CGG ATC GTT GAA AGG G-3′. To amplify GR, we used the following primers: for: 5′-TCC CCC TGG TAG AGA CGA AG-3′ and rev: 5′-GGC TGG TCG ACC TAT TGA GG-3′. To amplify MR, we used the following primers: for: 5′-GAG ATG AGG CTT CTG GGT GT-3′ and rev: 5′-CAG GAT CAT GGA CGG GGA TG-3′. These fragments were cloned into the pCR II Topo vector (Invitrogen, Karlsruhe, Germany) and their nucleotide sequences were verified by an automated sequencer. Plasmids were isolated using QIAprep Spin Miniprep Kit from Qiagen (Hilden, Germany). Complementary strands for sense and antisense riboprobes were transcribed from either Sp6 or T7 RNA polymerases and labeled using rNTP mix containing digoxigenin labeled uridine triphosphates. All restriction enzymes, RNA polymerases and digoxigenin-labeled rNTP were purchased from Roche Diagnostics (Mannheim, Germany).
Calis D., Hess M., Marchetta P., Singer W., Modro J., Nelissen E., Prickaerts J., Sandner P., Lukowski R., Ruth P., Knipper M, & Rüttiger L. (2023). Acute deletion of the central MR/GR steroid receptor correlates with changes in LTP, auditory neural gain, and GC-A cGMP signaling. Frontiers in Molecular Neuroscience, 16, 1017761.
Full text: Click here
Publication 2023
5'-chloroacetamido-5'-deoxythymidine bacteriophage T7 RNA polymerase Base Sequence Cloning Vectors Diagnosis Digoxigenin DNA-Directed RNA Polymerase DNA Restriction Enzymes Oligonucleotide Primers Plasmids Topoisomerase II Uridine Triphosphate

Top products related to «Topoisomerase II»

1
Pcr blunt 2 topo vector by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom
The PCR-Blunt II-TOPO vector is a cloning vector designed for the direct cloning of blunt-ended PCR products. It contains a TOPO cloning site, which allows for the rapid insertion of PCR products without the need for separate ligation steps. The vector also includes an ampicillin resistance gene for selection of transformed cells.
2
Pcr blunt 2 topo by Thermo Fisher Scientific
Sourced in United States, Japan, United Kingdom, France
The PCR-Blunt II-TOPO is a cloning vector used for the direct insertion of blunt-ended PCR products. It provides a simple and efficient method for the cloning of PCR amplicons without the need for additional processing steps. The vector contains the pUC origin of replication and an ampicillin resistance marker for selection and propagation in E. coli.
3
Zero blunt topo pcr cloning kit by Thermo Fisher Scientific
Sourced in United States, France
The Zero Blunt TOPO PCR Cloning Kit is a laboratory tool designed for the direct cloning of blunt-ended PCR products. It provides a fast and efficient method for the insertion of PCR amplicons into a vector without the need for ligation or restriction enzyme digestion. The kit includes a linearized vector, competent cells, and other necessary reagents to facilitate the cloning process.
4
Pcrii topo vector by Thermo Fisher Scientific
Sourced in United States, Germany
The PCRII-TOPO vector is a plasmid used for the cloning and expression of recombinant proteins. It contains a T7 promoter for high-level protein expression and a TOPO cloning site for the rapid and efficient insertion of DNA sequences. The vector also includes antibiotic resistance genes for selection in bacteria.
5
Qiaquick gel extraction kit by Qiagen
Sourced in Germany, United States, Netherlands, United Kingdom, Japan, Canada, France, Spain, China, Italy, India, Switzerland, Austria, Lithuania, Sweden, Australia
The QIAquick Gel Extraction Kit is a product designed for the purification of DNA fragments from agarose gels. It efficiently extracts and purifies DNA from gel slices after electrophoresis.
6
Topo ta cloning kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, France, Italy, Switzerland, China, Singapore, Canada
The TOPO TA Cloning Kit is a fast and efficient system for the direct insertion of Taq polymerase-amplified PCR products into a plasmid vector. It provides a simple, one-step cloning strategy for the direct insertion of Taq polymerase-amplified PCR products into a plasmid vector.
7
E coli top10 cells by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany
E. coli TOP10 cells are a strain of Escherichia coli bacteria commonly used in molecular biology and genetic engineering applications. They are designed for the cloning and propagation of plasmid DNA. The cells have specific genetic modifications that enhance their ability to maintain and replicate plasmids, making them suitable for various DNA manipulation and expression experiments.
8
Phusion high fidelity dna polymerase by New England Biolabs
Sourced in United States, Germany, United Kingdom, China, France, Canada, Japan, Morocco, Switzerland
Phusion High-Fidelity DNA Polymerase is a thermostable DNA polymerase with proofreading activity, designed for high-fidelity DNA amplification. It has an error rate significantly lower than Taq DNA Polymerase, making it suitable for applications requiring accurate DNA replication.
9
Topoisomerase 2 drug screening kit by TopoGEN
Sourced in United States
The Topoisomerase II Drug Screening Kit is a laboratory tool designed to facilitate the evaluation of drug compounds for their ability to inhibit the activity of Topoisomerase II, an enzyme essential for DNA replication and transcription. The kit provides the necessary components and protocols to conduct Topoisomerase II activity assays in a controlled laboratory setting.
10
Topoisomerase 2 assay kit by TopoGEN
Sourced in United States
The Topoisomerase II assay kit is a laboratory tool used to measure the activity of the Topoisomerase II enzyme. Topoisomerase II is an essential enzyme involved in DNA replication and transcription. The kit provides the necessary components to perform an in vitro assay to quantify the catalytic activity of Topoisomerase II.

More about "Topoisomerase II"

Topoisomerase II is a critical enzyme that plays a vital role in regulating DNA topology and chromatin structure.
It is involved in essential cellular processes such as DNA replication, transcription, and chromosome segregation.
This enzyme catalyzes the interconversion of various topological forms of DNA, including the relaxation of supercoiled DNA and the decatenation of interlocked DNA molecules.
Topoisomerase II is an important target for anticancer drugs, as its inhibition can lead to the accumulation of DNA damage and cell death in rapidly dividing cancer cells.
Researchers studying Topoisomerase II can optimize their work with PubCompare.ai, a leading AI platform that enhances reproducibility and accuracy in the field.
PubCompare.ai can effortlessly help locate the best protocols from literature, preprints, and patents using AI-driven comparisons, allowing researchers to identify the most effective products and methods to take their Topoisomerase II research to the next level.
When it comes to Topoisomerase II research, there are several related tools and techniques that can be utilized.
The PCR-Blunt II-TOPO vector and the Zero Blunt TOPO PCR Cloning Kit are commonly used for cloning and sequencing Topoisomerase II-related DNA fragments.
The PCRII-TOPO vector and the TOPO TA cloning kit are also popular choices for Topoisomerase II-related cloning projects.
Additionally, the QIAquick Gel Extraction Kit can be used to purify Topoisomerase II-related DNA fragments from agarose gels.
Furthermore, E. coli TOP10 cells are often used as a host for Topoisomerase II-related plasmid constructs, while Phusion High-Fidelity DNA Polymerase is a popular choice for amplifying Topoisomerase II-related DNA sequences with high fidelity.
Researchers can also utilize the Topoisomerase II Drug Screening Kit and the Topoisomerase II assay kit to evaluate the activity and inhibition of this critical enzyme.
By leveraging these tools and techniques, along with the insights provided by PubCompare.ai, researchers can elevate their Topoisomerase II research to new heights, driving advancements in our understanding of this crucial enzyme and its role in various biological processes.