The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Transferrin

Transferrin

Transferrin is a glycoprotein that transports iron throughout the body, playing a crucial role in iron homeostasis.
It binds to and delivers iron to cells, facilitating the uptake of this essential mineral.
Transferrin also has antioxidant properties and is involved in various physiological processes.
Understanding the functions and regulation of transferrin is vital for research on disorders related to iron metabolism, such as anemia and hemochromatosis.
PubCompare.ai's AI-driven protocol comparison tool can help optimize transferrin research by quickly identifying the best experimental protocols from literature, preprints, and patents, enhacing reproducibility and accuracy.

Most cited protocols related to «Transferrin»

Human myoblasts were isolated from biopsies and cultivated as described previously [19 (link)] in a growth medium consisting of 199 medium and DMEM (Invitrogen Carlsbad, CA) in a 1:4 ratio, supplemented with 20% FCS (Invitrogen), 2.5 ng/ml hepatocyte growth factor (Invitrogen), 0.1 μmol/l dexamethasone (Sigma-Aldrich, St. Louis, MO, USA) and 50 μg/ml gentamycin (Invitrogen). The myogenic purity of the populations was monitored by immunocytochemistry using desmin as marker. Enrichment of myogenic cells was performed using an immunomagnetic cell sorting system (MACS; Miltenyi Biotec, Paris, France) according to the manufacturer's instructions. Briefly, cells were labeled with anti-CD56 (a specific marker of myoblasts) microbeads, and then separated in a MACS column placed in a magnetic field. Purification was checked by immunochemistry using a desmin marker. Differentiation was induced at confluence by replacing the growth medium with DMEM supplemented with 100 μg/ml transferrin, 10 μg/ml insulin and 50 μg/ml of gentamycin (Sigma-Aldrich).
Publication 2011
Biopsy Cells Culture Media Desmin Dexamethasone Gentamicin Hepatocyte Growth Factor Homo sapiens Immunocytochemistry Insulin Magnetic Fields Microspheres Myoblasts Myogenesis Population Group Transferrin
Human ES cells (H1 and H9) were usually maintained in specific media on Matrigel-coated tissue culture plates32 (link). Cells were passaged routinely with EDTA as described previously13 (link). Briefly, cells were washed twice with PBS/EDTA medium (0.5 mM EDTA in PBS, osmolarity 340 mOsm), then incubated with PBS/EDTA for 5 minutes at 37°C. PBS/EDTA was removed, and cells were washed off swiftly with a small volume of corresponding media.
E8 media composition: Media contained DMEM/F12, L-ascorbic acid-2-phosphate magnesium (64 mg/l), sodium selenium (14 µg/l), FGF2 (100 µg/l), insulin (19.4 mg/l), NaHCO3 (543 mg/l) and transferrin (10.7 mg/l), TGFβ1(2 µg/l) or NODAL (100 µg/l). Osmolarity of all media was adjusted to 340 mOsm at pH7.4. All the media were stored at 4°C, and were used within 2 weeks of production. L-ascorbic acid-2-phosphate magnesium is the stable form of L-ascorbic acid in cell culture.
Publication 2011
Ascorbic Acid Bicarbonate, Sodium Edetic Acid Fibroblast Growth Factor 2 Human Embryonic Stem Cells Insulin L Forms magnesium ascorbate-2-phosphate matrigel Osmolarity Selenium Sodium TGF-beta1 Tissues Transferrin
A standard mixture was prepared by suspending in
200 mM ABC the proteins α-casein (bovine), β-casein (bovine),
enolase (yeast), apo-transferrin (human), carbonic
anhydrase (bovine), and ribonuclease B (bovine) to concentrations
of 6, 2, 4, 2.3, 2.5, and 2 μg/μL. Eight 400 μg
aliquots of this mixture were alkylated and digested as described
later (Table 1B).
Aliquots suspended
in the pH 8 reducing buffers specified in Table 1B were incubated at 50 °C with shaking for 60 min, after which
they were alkylated with 30 mM iodoacetamide (IAN) or 25 mM 4-VP,
shaking for 30 min at 37 °C.
All alkylated samples were
quenched by the addition of 200 mM DTT
to a final concentration of 22 mM and then diluted 1:1 with either
25 mM ABC or 0.1% DCA in 25 mM ABC (Table 1B). Modified, sequencing-grade trypsin (Promega) was added to each
sample (1:30 w/w). Digestion proceeded for 12 h on a 37 °C shaker.
Aliquots (10 μg) were removed for SDS-PAGE analysis.
Publication 2014
ABCA1 protein, human Bos taurus Buffers Caseins Digestion Enolase Homo sapiens Iodoacetamide Promega Proteins ribonuclease B SDS-PAGE Transferrin Trypsin Yeast, Dried
Mouse embryonic stem (ES) cells were cultured on irradiated MEFs in DMEM / 15% FBS, penicillin/streptomycin (P/S, Gibco), 2 mM glutamax (Invitrogen), nonessential amino acids, 0.1 mM β-mercaptoethanol, and 100 U/mL LIF (Peprotech). For EB differentiation, ES cells were trypsinized, and re-plated in differentiation medium (IMDM/15% FBS, 200 μg/mL transferrin (Sigma), 4.5 mM monothiolglycerol (MTG, Sigma), 50 μg/mL ascorbic acid (Sigma), and 2 mM glutamax) for 30 min to allow MEFs to adhere. Nonadherent cells (105) were plated as a cell suspension in low adherence dishes on a slowly rotating shaker. To generate A2Lox.cre ES cells, the HPRT 5′ repair/targeting plasmid [9 (link)] carrying the cassette exchange TRE-2loxP-Δneo inducible target locus [10 ] was digested with XhoI and ligated to an XhoI-SalI fragment bearing the cre transgene from pSalk-cre [11 (link)]. 20 μg of SalI-linearized DNA was electroporated into 6×106 A17 mES cells, and selection in ES medium with HAT supplement (Invitrogen) was initiated 24 hours later.
Publication 2011
2-Mercaptoethanol Amino Acids Ascorbic Acid Cells Dietary Supplements Embryo Embryonic Stem Cells Hyperostosis, Diffuse Idiopathic Skeletal Mouse Embryonic Stem Cells Penicillins Plasmids Stem, Plant Streptomycin Transferrin Transgenes
We established the Genetics of Iron Status Consortium (GISC) to coordinate our efforts in understanding the causes and consequences of genetic variation in biochemical markers for iron status, i.e. serum iron, transferrin, transferrin saturation and ferritin. Discovery samples consisted of summary data on genome-wide allelic associations between SNP genotypes and iron markers from 23,986 subjects of European ancestry gathered from 11 cohorts in 9 participating centres (Supplementary Table 1). Replication samples to confirm suggestive and significant associations were obtained from up to 24,986 subjects of European ancestry in 8 additional cohorts (also in Supplementary Table 1). There was no systematic selection whether a cohort was allocated into the discovery or replication samples. This allocation was based on the availability of data when the analyses were conducted. Information on phenotypic means, methods for phenotype measurement, and genotyping methods for each contributing cohort are shown in Supplementary Tables 2 and 3. Each participating study was approved by the appropriate human research ethics committee, as listed for each study in Supplementary Table 1, and all subjects gave informed consent.
Publication 2014
Alleles DNA Replication Ethics Committees, Research Europeans Ferritin Genetic Diversity Genome Genotype Genotyping Techniques Homo sapiens Iron Phenotype Serum Transferrin

Most recents protocols related to «Transferrin»

Example 6

TbpB and NMB0313 genes were amplified from the genome of Neisseria meningitidis serotype B strain B16B6. The LbpB gene was amplified from Neisseria meningitidis serotype B strain MC58. Full length TbpB was inserted into Multiple Cloning Site 2 of pETDuet using restriction free cloning ((F van den Ent, J. Löwe, Journal of Biochemical and Biophysical Methods (Jan. 1, 2006)).). NMB0313 was inserted into pET26, where the native signal peptide was replaced by that of pelB. Mutations and truncations were performed on these vectors using site directed mutagenesis and restriction free cloning, respectively. Pairs of vectors were transformed into E. coli C43 and were grown overnight in LB agar plates supplemented with kanamycin (50 μg/mL) and ampicillin (100 μg/mL).

tbpB genes were amplified from the genomes of M. catarrhalis strain 035E and H. influenzae strain 86-028NP and cloned into the pET52b plasmid by restriction free cloning as above. The corresponding SLAMs (M. catarrhalis SLAM 1, H. influenzae SLAM1) were inserted into pET26b also using restriction free cloning. A 6His-tag was inserted between the pelB and the mature SLAM sequences as above. Vectors were transformed into E. coli C43 as above.

Cells were harvested by centrifugation at 4000 g and were twice washed with 1 mL PBS to remove any remaining growth media. Cells were then incubated with either 0.05-0.1 mg/mL biotinylated human transferrin (Sigma-aldrich T3915-5 MG), α-TbpB (1:200 dilution from rabbit serum for M. catarrhalis and H. influenzae; 1:10000 dilution from rabbit serum for N. meningitidis), or α-LbpB (1:10000 dilution from rabbit serum-obtained a gift from J. Lemieux) or α-fHbp (1:5000 dilution from mouse, a gift from D. Granoff) for 1.5 hours at 4° C., followed by two washes with 1 mL of PBS. The cells were then incubated with R-Phycoerythrin-conjugated Streptavidin (0.5 mg/ml Cedarlane) or R-phycoerythrin conjugated Anti-rabbit IgG (Stock 0.5 mg/ml Rockland) at 25 ug/mL for 1.5 hours at 4° C. The cells were then washed with 1 mL PBS and resuspended in 200 uL fixing solution (PBS+2% formaldehyde) and left for 20 minutes. Finally, cells were washed with 2×1 mL PBS and transferred to 5 mL polystyrene FACS tubes. The PE fluorescence of each sample was measured for PE fluorescence using a Becton Dickinson FACSCalibur. The results were analyzed using FLOWJO software and were presented as mean fluorescence intensity (MFI) for each sample. For N. meningtidis experiments, all samples were compared to wildtype strains by normalizing wildtype fluorescent signals to 100%. Errors bars represent the standard error of the mean (SEM) across three experiments. Results were plotted statistically analysed using GraphPad Prism 5 software. The results shown in FIG. 6 for the SLPs, TbpB (FIG. 6A), LbpB. (FIG. 6B) and fHbp (FIG. 6C) demonstrate that SLAM effects translocation of all three SLP polypeptides in E. coli. The results shown in FIG. 10 demonstrate that translocation of TbpB from M. catarrhalis (FIG. 10C) and in H. influenzae (FIG. 10D) in E. coli require the co-expression of the required SLAM protein (Slam is an outer membrane protein that is required for the surface display of lipidated virulence factors in Neisseria. Hooda Y, Lai C C, Judd A, Buckwalter C M, Shin H E, Gray-Owen S D, Moraes T F. Nat Microbiol. 2016 Feb. 29; 1:16009).

Patent 2024
ADRB2 protein, human Agar Ampicillin anti-IgG Cells Centrifugation Cloning Vectors Culture Media Escherichia coli Fluorescence Formaldehyde Genes Genome Haemophilus influenzae Homo sapiens Kanamycin Lipoproteins Membrane Proteins Moraxella catarrhalis Mus Mutagenesis, Site-Directed Mutation Neisseria Neisseria meningitidis Phycoerythrin Plasmids Polypeptides Polystyrenes prisma Rabbits Serum Signaling Lymphocytic Activation Molecule Family Member 1 Signal Peptides Strains Streptavidin Technique, Dilution Transferrin Translocation, Chromosomal Virulence Factors

Example 24

For groups 1-12, see study design in FIG. 32, the 21mer Atrogin-1 guide strand was designed. The sequence (5′ to 3′) of the guide/antisense strand was UCGUAGUUAAAUCUUCUGGUU (SEQ ID NO: 14237). The guide and fully complementary RNA passenger strands were assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity. Purified single strands were duplexed to get the double stranded siRNA described in figure A. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linkers. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

For groups 13-18 see study design in FIG. 32, a 21mer negative control siRNA sequence (scramble) (published by Burke et al. (2014) Pharm. Res., 31(12):3445-60) with 19 bases of complementarity and 3′ dinucleotide overhangs was used. The sequence (5′ to 3′) of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 14228). The same base, sugar and phosphate modifications that were used for the active MSTN siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

Antibody siRNA Conjugate Synthesis Using Bis-Maleimide (BisMal) Linker

Step 1: Antibody Reduction with TCEP

Antibody was buffer exchanged with 25 mM borate buffer (pH 8) with 1 mM DTPA and made up to 10 mg/ml concentration. To this solution, 4 equivalents of TCEP in the same borate buffer were added and incubated for 2 hours at 37° C. The resultant reaction mixture was combined with a solution of BisMal-siRNA (1.25 equivalents) in pH 6.0 10 mM acetate buffer at RT and kept at 4° C. overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA. The reaction mixture was treated with 10 EQ of N-ethylmaleimide (in DMSO at 10 mg/mL) to cap any remaining free cysteine residues.

Step 2: Purification

The crude reaction mixture was purified by AKTA Pure FPLC using anion exchange chromatography (SAX) method-1. Fractions containing DAR1 and DAR2 antibody-siRNA conjugates were isolated, concentrated and buffer exchanged with pH 7.4 PBS.

Anion Exchange Chromatography Method (SAX)-1.

Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID×15 cm, 13 um

Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow Rate: 6.0 ml/min

Gradient:

a.% A% BColumn Volume
b.10001
c.81190.5
d.505013
e .40600.5
f.01000.5
g.10002

Anion Exchange Chromatography (SAX) Method-2

Column: Thermo Scientific, ProPac™ SAX-10, Bio LC™, 4×250 mm

Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow Rate: 0.75 ml/min

Gradient:

a.Time% A% B
b.0.09010
c.3.009010
d.11.004060
e.14.004060
f.15.002080
g.16.009010
h.20.009010

Step-3: Analysis of the Purified Conjugate

The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2 (Table 22).

TABLE 22
SAX retention% purity
Conjugatetime (min)(by peak area)
TfR1-Atrogin-1 DAR19.299
TfR1-Scramble DAR18.993

In Vivo Study Design

The conjugates were assessed for their ability to mediate mRNA downregulation of Atrogin-1 in muscle (gastroc) in the presence and absence of muscle atrophy, in an in vivo experiment (C57BL6 mice). Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs and doses, see FIG. 32. Seven days post conjugate delivery, for groups 3, 6, 9, 12, and 15, muscle atrophy was induced by the daily administration via intraperitoneal injection (10 mg/kg) of dexamethasone for 3 days. For the control groups 2, 5, 8, 11, and 14 (no induction of muscle atrophy) PBS was administered by the daily intraperitoneal injection. Groups 1, 4, 7, 10, and 13 were harvested at day 7 to establish the baseline measurements of mRNA expression and muscle weighted, prior to induction of muscle atrophy. At three days post-atrophy induction (or 10 days post conjugate delivery), gastrocnemius (gastroc) muscle tissues were harvested, weighed and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) is calculated and then further normalized relative to the PBS control group by taking a second difference (ΔΔCt).

Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Results

The data are summarized in FIG. 33-FIG. 35. The Atrogin-1 siRNA guide strands were able to mediate downregulation of the target gene in gastroc muscle when conjugated to an anti-TfR mAb targeting the transferrin receptor, see FIG. 33. Increasing the dose from 3 to 9 mg/kg reduced atrophy-induced Atrogin-1 mRNA levels 2-3 fold. The maximal KD achievable with this siRNA was 80% and a tissue concentration of 40 nM was needed to achieve maximal KD in atrophic muscles. This highlights the conjugate delivery approach is able to change disease induce mRNA expression levels of Atrogin-1 (see FIG. 34), by increasing the increasing the dose. FIG. 35 highlights that mRNA down regulation is mediated by RISC loading of the Atrogin-1 guide strands and is concentration dependent.

Conclusions

In this example, it was demonstrated that a TfR1-Atrogin-1 conjugates, after in vivo delivery, mediated specific down regulation of the target gene in gastroc muscle in a dose dependent manner. After induction of atrophy the conjugate was able to mediate disease induce mRNA expression levels of Atrogin-1 at the higher doses. Higher RISC loading of the Atrogin-1 guide strand correlated with increased mRNA downregulation.

Patent 2024
Acetate Anions Antibody Formation Antigens Atrophy Biological Assay Borates Buffers Carbohydrates Chromatography Complementary RNA Complement System Proteins Cysteine Dexamethasone Dinucleoside Phosphates DNA, Complementary Down-Regulation Ethanol Ethylmaleimide Freezing Genes Genes, Housekeeping High-Performance Liquid Chromatographies Immunoglobulins Injections, Intraperitoneal maleimide MicroRNAs Mus Muscle, Gastrocnemius Muscle Tissue Muscular Atrophy Nitrogen Obstetric Delivery Oligonucleotide Primers Pentetic Acid Phosphates Plasma PPIB protein, human Prospective Payment Assessment Commission Real-Time Polymerase Chain Reaction Retention (Psychology) Reverse Transcription RNA, Messenger RNA, Small Interfering RNA-Induced Silencing Complex RNA Interference Sodium Chloride Solvents Stem, Plant STS protein, human Sulfhydryl Compounds Sulfoxide, Dimethyl TFRC protein, human Tissues Transferrin tris(2-carboxyethyl)phosphine Tromethamine
Not available on PMC !

Example 3

The genes for Candida antartica lipases A and B, human transferrin, and the human CH2 domain from IgG were integrated into the SuperM5 genome using standard transformation methods. In all cases significant amounts of protein were produced and secreted into the medium. Transformed strains and media-containing protein were tested for glycan analysis using previously published methods. In all cases, the glycan profiles for the test proteins and for the strain glycoproteins demonstrated a mannose-5 glycan structure with no other higher mannose structures detected by the methods used.

Patent 2024
Candidiasis, Genital Genome Glycoproteins Homo sapiens Lipase Mannose Polysaccharides Proteins Strains Transferrin
Not available on PMC !

Example 4

To determine where 2F2-grafted “humanized” antibodies and antibody variants are delivered upon internalization into the cell, colocalization studies of the anti-CD79b antibodies internalized into B-cell lines may be assessed in Ramos cell lines. LAMP-1 is a marker for late endosomes and lysosomes (Kleijmeer et al., Journal of Cell Biology, 139(3): 639-649 (1997); Hunziker et al., Bioessays, 18:379-389 (1996); Mellman et al., Annu. Rev. Dev. Biology, 12:575-625 (1996)), including MHC class II compartments (MIICs), which is a late endosome/lysosome-like compartment. HLA-DM is a marker for MIICs.

Ramos cells are incubated for 3 hours at 37° C. with 1 μg/ml 2F2-grafted “humanized” antibodies and antibody variants, FcR block (Miltenyi) and 25 μg/ml Alexa647-Transferrin (Molecular Probes) in complete carbonate-free medium (Gibco) with the presence of 10 μg/ml leupeptin (Roche) and 5 μM pepstatin (Roche) to inhibit lysosomal degradation. Cells are then washed twice, fixed with 3% paraformaldehyde (Electron Microscopy Sciences) for 20 minutes at room temperature, quenched with 50 mM NH4Cl (Sigma), permeabilized with 0.4% Saponin/2% FBS/1% BSA for 20 minutes and then incubated with 1 μg/ml Cy3 anti-mouse (Jackson Immunoresearch) for 20 minutes. The reaction is then blocked for 20 minutes with mouse IgG (Molecular Probes), followed by a 30 minute incubation with Image-iT FX Signal Enhancer (Molecular Probes). Cells are finally incubated with Zenon Alexa488-labeled mouse anti-LAMP1 (BD Pharmingen), a marker for both lysosomes and MIIC (a lysosome-like compartment that is part of the MHC class II pathway), for 20 minutes, and post-fixed with 3% PFA. Cells are resuspended in 20 μl saponin buffer and allowed to adhere to poly-lysine (Sigma) coated slides prior to mounting a coverglass with DAPI-containing VectaShield (Vector Laboratories). For immunofluorescence of the MIIC or lysosomes, cells are fixed, permeabilized and enhanced as above, then co-stained with Zenon labeled Alexa555-HLA-DM (BD Pharmingen) and Alexa488-Lamp1 in the presence of excess mouse IgG as per the manufacturer's instructions (Molecular Probes).

Accordingly, colocalization of 2F2-grafted “humanized” antibodies or antibody variants with MIIC or lysosomes of B-cell lines as assessed by immunofluorescence may indicate the molecules as excellent agents for therapy of tumors in mammals, including B-cell associated cancers, such as lymphomas (i.e. Non-Hodgkin's Lymphoma), leukemias (i.e. chronic lymphocytic leukemia), and other cancers of hematopoietic cells.

Patent 2024
Alexa Fluor 647 Anti-Antibodies Antibodies, Monoclonal, Humanized B-Lymphocytes Buffers Carbonates CD79B protein, human Cell Lines Cells Chronic Lymphocytic Leukemia Cloning Vectors DAPI Electron Microscopy Endosomes Genes, MHC Class II Hematopoietic Neoplasms Immunofluorescence Immunoglobulins Leukemia leupeptin Lymphoma Lymphoma, Non-Hodgkin Lysine lysosomal-associated membrane protein 1, human Lysosomes Malignant Neoplasms Mammals Molecular Probes Mus Neoplasms paraform pepstatin Poly A Saponin Therapeutics Transferrin

Example 7

Sepsis modeling was performed as described by Gorringe A. R., Reddin, K. M., Voet P. and Poolman J. T. (Methods Mol. Med. 66, 241 (Jan. 1, 2001)) and Johswich, K. O. et al. (Infect. Immun. 80, 2346 (Jul. 1, 2012)). Groups of 6 eight-week-old C57BL/6 mice (Charles River Laboratories) were inoculated via intraperitoneal injection with N. meningitidis strain B16B6, B16B6 Δtbpb, or B16B6 Δnmb0313 (N=2 independent experiments). To prepare inoculums, bacterial strains for infection were grown overnight on GC agar, resuspended and then grown for 4 h in 10 ml of Brain Heart Infusion (BHI) medium at 37° C. with shaking. Cultures were adjusted such that each final 500 μl inoculum contained 1×106 colony forming units and 10 mg human holo-transferrin. Mice were monitored at least every 12 h starting 48 h before infection to 48 h after infection for changes in weight, clinical symptoms and bacteremia. Mice were scored on a scale of 0-2 based on the severity of the following clinical symptoms: grooming, posture, appearance of eyes and nose, breathing, dehydration, diarrhea, unprovoked behavior, and provoked behavior. Animals reaching endpoint criteria were humanely euthanized. Animal experiments were conducted in accordance with the Animal Ethics Review Committee of the University of Toronto.

FIG. 7 shows the results obtained. FIG. 7A shows a solid phase binding assay consisting of N.men cells fixed with paraformaldehyde (PFA) or lysed with SDS and were spotted onto nitrocellulose and probed with α-TbpB antibodies. ΔSLAM/tn5 refers to the original strain of SLAM deficient cells obtained through transposon insertion. ΔSLAM describes the knockout of SLAM in Neisseria meningitidis obtained by replacing the SLAM ORF with a kanamycin resistance cassette. FIG. 7B shows a Proteinase K digestion assay showing the degradation of TbpB, LbpB and fHbp only when Nm cells are SLAM deficient (ΔSLAM). Nm cells expressing individual SLPs alone and with SLAM were incubated with proteinase K and Western blots were used to detect levels of all three SLPs levels with and without protease digestion (−/+). Flow cytometry was used to confirm that ΔSLAM cells could not display TbpB (FIG. 7C) or fHbp (FIG. 7D) on the cell surface. Antibodies against TbpB and fHbp were used to bind surface exposed SLPs followed by incubation with a α-Rabbit antibody linked to phycoerythrin to provide fluorescence. The mean fluorescent intensity (MFI) of each sample was measured using the FL2 detector of a BD FACS Calibur. The signal obtained from wildtype cells was set to 100% for comparison with signals from knockout cells. Error bars represent the standard error of the mean (SEM) from three experiments. Shown in FIG. 7E are the results of mice infections with various strains. Mice were infected via intraperitoneal injection with 1×106 CFU of wildtype N. meningitidis strain B16B6, B16B6 with a knockout of TbpB (ΔtbpB), or B16B6 with a knockout of nmb0313 Δslam and monitored for survival and disease symptoms every 12 h starting 48 hr pre-infection to 48 h post-infection and additionally monitored at 3 hr post-infection. Statistical differences in survival were assessed by a Mantel-Cox log rank test (GraphPad Prism 5) (*p<0.05, n.s. not significant). These results show a marked reduction in post-infection mortality in mice infected with the knockout of nmb0313 Δslam strain.

Patent 2024
Agar Animals Antibodies Bacteremia Bacterial Infections Biological Assay Brain Cells Cultured Cells Dehydration Diarrhea Digestion Endopeptidase K Eye Flow Cytometry Fluorescence Genes Heart Homo sapiens Immunoglobulins Infection Injections, Intraperitoneal Jumping Genes Kanamycin Resistance Mice, Inbred C57BL Mus Neisseria Neisseria meningitidis Nitrocellulose Nose paraform Peptide Hydrolases Phycoerythrin prisma Rabbits Rivers Sepsis Strains Transferrin Virulence Western Blot

Top products related to «Transferrin»

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States, United Kingdom, Germany, Japan, China, Canada, France, Macao, Belgium, Switzerland, Netherlands, Australia
Insulin-transferrin-selenium is a complex of insulin, transferrin, and selenium. It is used as a cell culture supplement to promote cell growth and proliferation in vitro.
Sourced in United States, Germany, France, United Kingdom, Japan, China, Austria, Macao, Israel, Italy, Switzerland, Canada, Sao Tome and Principe, Australia, Poland, Sweden, Argentina
Transferrin is a laboratory product used as a critical component in cell culture media. It is a glycoprotein that plays a key role in the transport and delivery of iron to cells. Transferrin functions to bind and carry iron ions, facilitating their uptake and utilization by cells in vitro.
Sourced in United States, Germany, United Kingdom, China, Japan, Italy, Sao Tome and Principe, Macao, France, Australia, Switzerland, Canada, Denmark, Spain, Israel, Belgium, Ireland, Morocco, Brazil, Netherlands, Sweden, New Zealand, Austria, Czechia, Senegal, Poland, India, Portugal
Dexamethasone is a synthetic glucocorticoid medication used in a variety of medical applications. It is primarily used as an anti-inflammatory and immunosuppressant agent.
Sourced in United States, Germany, United Kingdom, China, France, Canada, Italy, Sao Tome and Principe, Japan, Switzerland, Macao, Israel, Australia, Spain, Austria, Sweden, Poland, Denmark, New Zealand, Belgium, Portugal, Ireland, Netherlands, Brazil, Colombia, India, Morocco, Argentina
Insulin is a lab equipment product designed to measure and analyze insulin levels. It provides accurate and reliable results for research and diagnostic purposes.
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
Sourced in United States, United Kingdom, Germany, China, France, Japan, Canada, Australia, Italy, Switzerland, Belgium, New Zealand, Spain, Denmark, Israel, Macao, Ireland, Netherlands, Austria, Hungary, Holy See (Vatican City State), Sweden, Brazil, Argentina, India, Poland, Morocco, Czechia
DMEM/F12 is a cell culture medium developed by Thermo Fisher Scientific. It is a balanced salt solution that provides nutrients and growth factors essential for the cultivation of a variety of cell types, including adherent and suspension cells. The medium is formulated to support the proliferation and maintenance of cells in vitro.
Sourced in United States, Germany, United Kingdom, France, China, Italy, Canada, Macao, Japan, Israel, Switzerland, Australia, Sao Tome and Principe, Spain, Austria, Portugal, Belgium, Denmark, Sweden, Argentina, Brazil, Poland, New Zealand
Hydrocortisone is a laboratory-grade reagent used in various research and analytical applications. It is a synthetic corticosteroid compound with anti-inflammatory and immunosuppressant properties. Hydrocortisone is commonly utilized as a standard or reference material in analytical procedures, such as assays and chromatographic techniques, to quantify and identify related compounds.
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.

More about "Transferrin"

Transferrin is a critical glycoprotein that plays a vital role in iron transport and homeostasis throughout the body.
This serum protein binds to and delivers iron to cells, facilitating the uptake of this essential mineral.
Transferrin also possesses antioxidant properties and is involved in various physiological processes.
Understanding the functions and regulation of transferrin is crucial for research on disorders related to iron metabolism, such as anemia and hemochromatosis.
PubCompare.ai's AI-driven protocol comparison tool can help optimize transferrin research by quickly identifying the best experimental protocols from literature, preprints, and patents, enhaning reproducibility and accuracy.
This tool can be especially useful when working with related substances like FBS, Insulin-transferrin-selenium, Dexamethasone, Insulin, Penicillin/streptomycin, DMEM/F12, Hydrocortisone, and DMEM, which are commonly used in cell culture and biochemical experiments involving transferrin.
By leveraging the power of artificial intelligence, researchers can streamline their transferrin studies, comparing experimental conditions and product recommendations to ensure the highest level of reproducibility and accuracy.
Experience the benefits of AI-driven research with PubCompare.ai and take your transferrin research to new heights.