Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Transposase

Transposase

Transposases are enzymes that facilitate the movement of DNA sequeneces, known as transposons, within and between genomes.
These mobile genetic elemebts play a crucial role in genome evolution and can be utilized in genetic engineering techniques.
Transposases recognize specific DNA sequences and catalyze the excision and insertion of transposons, enabling their relocation.
Understanding the mechanisms and applications of transposases is essential for advancements in molecular biology, genetic manipulation, and the study of genome dynamics.

Most cited protocols related to «Transposase»

1
Nuclei Isolation for ATAC-Seq Analysis
Cited 196 times
See Supplementary
Protocol 2 for a detailed protocol. This protocol is highly similar
to the INTACT method19 (link) and
either protocol can be used for the isolation of nuclei with equivalent results.
All of the steps were carried out at 4 °C. A frozen tissue fragment ~20
mg was placed into a pre-chilled 2-ml Dounce homogenizer containing 2 ml of cold
1× homogenization buffer (320 mM sucrose, 0.1 mM EDTA, 0.1%
NP40, 5 mM CaCl2, 3 mM Mg(Ac)2, 10 mM Tris pH 7.8,
1× protease inhibitors (Roche, cOmplete), and 167 μM
β-mercaptoethanol, in water). Tissue was homogenized with approximately
ten strokes with the loose ‘A’ pestle, followed by 20 strokes
with the tight ‘B’ pestle. Connective tissue and residual debris
were precleared by filtration through an 80-μm nylon mesh filter
followed by centrifugation for 1 min at 100 r.c.f. While avoiding the pelleted
debris, 400 μl was transferred to a pre-chilled 2-ml round bottom
Lo-Bind Eppendorf tube. An equal volume (400 μl) of a 50%
iodixanol solution (50% iodixanol in 1× homogenization buffer)
was added and mixed by pipetting to make a final concentration of 25%
iodixanol. 600 μl of a 29% iodixanol solution (29%
iodixanol in 1× homogenization buffer containing 480 mM sucrose) was
layered underneath the 25% iodixanol mixture. A clearly defined
interface should be visible. In a similar fashion, 600 μl of a
35% iodixanol solution (35% iodixanol in 1×
homogenization containing 480 mM sucrose) was layered underneath the 29%
iodixanol solution. Again, a clearly defined interface should be visible between
all three layers. In a swinging-bucket centrifuge, nuclei were centrifuged for
20 min at 3,000 r.c.f. After centrifugation, the nuclei were present at the
interface of the 29% and 35% iodixanol solutions. This band with
the nuclei was collected in a 300 μl volume and transferred to a
pre-chilled tube. Nuclei were counted after addition of trypan blue, which
stains all nuclei due to membrane permeabilization from freezing. 50,000 counted
nuclei were then transferred to a tube containing 1 ml of ATAC-seq RSB with
0.1% Tween-20. Nuclei were pelleted by centrifugation at 500 r.c.f. for
10 min in a pre-chilled (4 °C) fixed-angle centrifuge. Supernatant was
removed using the two pipetting steps described above. Because the nuclei were
already permeabilized, no lysis step was performed, and the transposition mix
(25 μl 2× TD buffer, 2.5 μl transposase (100 nM final),
16.5 μl PBS, 0.5 μl 1% digitonin, 0.5 μl
10% Tween-20, 5 μl water) was added directly to the nuclear
pellet and mixed by pipetting up and down six times. Transposition reactions
were incubated at 37 °C for 30 min in a thermomixer with shaking at
1,000 r.p.m. Reactions were cleaned up with Zymo DNA Clean and Concentrator 5
columns. The remainder of the ATAC-seq library preparation was performed as
described previously18 .
Corces M.R., Trevino A.E., Hamilton E.G., Greenside P.G., Sinnott-Armstrong N.A., Vesuna S., Satpathy A.T., Rubin A.J., Montine K.S., Wu B., Kathiria A., Cho S.W., Mumbach M.R., Carter A.C., Kasowski M., Orloff L.A., Risca V.I., Kundaje A., Khavari P.A., Montine T.J., Greenleaf W.J, & Chang H.Y. (2017). An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nature methods, 14(10), 959-962.
Publication 2017
2-Mercaptoethanol ATAC-Seq Buffers Cell Nucleus Centrifugation Cerebrovascular Accident Connective Tissue Digitonin DNA Library Edetic Acid Filtration iodixanol isolation Nylons Protease Inhibitors Sucrose Tissue, Membrane Tissues Transposase Tromethamine Trypan Blue Tween 20
2
Semi-Automated IS Annotation Tool
Cited 134 times
ISsaga uses a semi-automatic procedure based on the methodology for identification of ISs in the public databases described in [6 (link)].
ISsaga has a semi-automatic and manual modular architecture described in detail in Figure 1, in the user manual (Additional file 1 and [20 ]) and largely in the body of this article. The modular construction allows the annotation process to be broken down into three interconnected steps: protein (IS-associated ORF identification); nucleotide; and validation steps.
For the web interface ISsaga uses PHP [21 ] in the http Apache manager (version 2.2.12). The execution procedure in each annotation module was written in BioPerl [9 (link)] and Bourne Shell languages and executed with a database implemented by MySQL (version 5.1.37). Both use a set of open source software described in the user manual.
The protein and nucleotide steps are entirely based on sequence similarity comparison using BLAST [8 (link)] software against a daily updated version of the ISfinder database. The protein step, includes determination of the IS-associated (complete/intact or partial/fragment) genes and the transposase family, optimized by the BlastP and BlastX parameters (similarity threshold of more than 97%, word size of 3, e-value 1e-5 and the complexity filter disabled). ISsaga scans the input genome annotation for IS-associated ORFs. All ORFs inside the blast threshold are considered as potential IS regions.
For unannotated genomes (fasta file input), a prior ORF prediction is automatically made with Glimmer3 using a specific IS-associated gene model constructed with the 'build-icm' program (provided by the Glimmer3 package) with the training set provided by the ISfinder protein sequence database. The results of this step are included in the annotation table (Additional file 2).
The IS ORF prediction (complete, partial or uncategorized) uses both global (Emboss stretcher) and local (Blast) alignment procedures against the ISfinder protein dataset (Figure 4).
For IS nucleotide prediction, ISsaga takes into account the characteristics of each IS family (as defined on the ISfinder website) to identify the regions that could contain an IS. For example, for an IS composed of two ORFs, ISsaga will extract the nucleotide sequence starting from the coordinates of the beginning of the first ORF to the coordinates of the end of the second. All nucleotide candidate IS regions are grouped by Blastclust program (parameters: -p F -S 90 -b F -L 0.0) to determine the number of different regions.
The nucleotide step includes identification of the IRs or IS ends, and the insertion site with DRs of each IS-associated ORF previously identified, and for putative partial ISs that do not contain ORF products, using the optimized BlastN parameters: identity threshold >95%, word size = 7, e-value = 1e-5 and complexity filter disabled. ISsaga scans the input genome fasta sequence for previously annotated ISs in the ISfinder database.
For ISs not in the ISfinder database, the user must submit the newly identified ISs so that they can subsequently be semi-automatically annotated (detailed instructions can be found in the user manual in Additional file 1. For each IS identified in this step, ISsaga creates a validation report, to be further analyzed by the annotator in the validation step.
The validation step processes the result generated by the previous steps, and exports each predicted IS identified in the nucleotide step to the annotation table. This is an entirely manual procedure, where the annotator must verify each IS prediction result. This requires some IS annotation expertise, which is detailed in the user manual.
Varani A.M., Siguier P., Gourbeyre E., Charneau V, & Chandler M. (2011). ISsaga is an ensemble of web-based methods for high throughput identification and semi-automatic annotation of insertion sequences in prokaryotic genomes. Genome Biology, 12(3), R30.
Publication 2011
Genes Genome Human Body Nucleotides Open Reading Frames Patient Holding Stretchers Proteins Radionuclide Imaging Transposase
3
Generating Transgenic Worms via Mos1 Transposition
Cited 113 times
Transgenic worms were made by injection into EG4322 (ttTi5605; unc-119(ed3)) or EG4316/EG5003 (unc-119(ed3) III; cxTi10882 IV) animals 1 (link). The standard injection mix consisted of 50 ng/μl repair template, 50 ng/μl Mos1 transposase (either pJL44(Phsp-16-48::transposase) or pJL43.1(Pglh-2::transposase)), 10 ng/μl pCFJ70 (Pmyo-3::twk-18(cn110)), 5 ng/μl pGH8 (Prab-3::mCherry), 5ng/μl pCFJ104 (Pmyo-3::mCherry) and 2.5 ng/μl pCFJ90 (Pmyo-2::mCherry). In later direct insertion experiments pCFJ70 (Pmyo-3::twk-18(cn110) was omitted from the injection mix. unc-119 animals are severely paralyzed and egg-laying defective. Therefore, L1-L2 animals were manually distributed across a lawn of OP50 and very young adults were selected for injection. Injected animals were individually transferred to standard NGM plates and placed at 15°C. Plates were scored for the number of phenotypically rescued F1 animals 3 days after injection.
Frøkjær-Jensen C., Davis M.W., Hopkins C.E., Newman B., Thummel J.M., Olesen S.P., Grunnet M, & Jorgensen E.M. (2008). Single copy insertion of transgenes in C. elegans. Nature genetics, 40(11), 1375-1383.
Publication 2008
Animals Animals, Transgenic Helminths Mos1 transposase Transposase Young Adult
4
Random Transposon Mutagenesis in S. aureus
Cited 103 times
The mariner-based transposon (Tn) bursa aurealis was used to generate random Tn insertion mutations in S. aureus strain JE2 essentially as described by Bae et al. (4 (link), 43 (link)). First, bacteriophage ϕ11 was used to transduce the bursa aurealis delivery plasmid pBursa into JE2 containing the transposase-encoding plasmid pFA545, with selection on TSA medium containing chloramphenicol (Cm) (10 µg/ml) and Tet (5 µg/ml). After growth for 48 h at 30°C to allow for transposition events, one colony was resuspended in 100 µl of prewarmed 45°C water and then 10 µl was plated onto TSA plates containing erythromycin (Erm) (25 µg/ml) and grown at 45°C for 12 to 24 h. Resulting colonies, irrespective of colony size, were then screened for loss of the temperature-sensitive plasmids pBursa and pFA545 by patching them on TSA-Erm (25 µg/ml), TSA-Cm (10 µg/ml), and TSA-Tet (5 µg/ml). Those colonies that were Cm and Tet susceptible but resistant to Erm were arrayed into 1-ml deep-well plates containing 400 µl of TSB-Erm (5 µg/ml) and grown at 37°C overnight. The next day, 400 µl of 50% glycerol was added to each well and the plates were stored in a −80°C freezer.
To identify the locations of the bursa aurealis transposon insertions, 400 µl of TSB-Erm (5 µg/ml) was inoculated into 96-well plates using a 96-prong replicator. After overnight growth, the Wizard genomic DNA purification kit (Promega) was used to isolate genomic DNA from the cultures with the following modifications. Briefly, after centrifugation at 4,100 rpm for 5 min in a Sorvall (Newtown, CT) Legend tabletop centrifuge, supernatants were removed, the content of each well was resuspended in 110 µl of 50 mM EDTA (pH 8.0), and 5 µl of 10-mg/ml lysostaphin was added. After incubation at 37°C for 60 min, 600 µl of Nuclei Lysis solution was added and the genomic DNA was collected according to the manufacturer’s instructions. After resuspension in Tris-EDTA (TE) buffer, approximately 2 µg of genomic DNA was digested with 10 units of AciI (New England Biolabs) at 37°C for 4 h. AciI was then heat inactivated at 65°C for 30 min; T4 DNA ligase (200 U) (Monserate Biotechnologies, San Diego, CA) was then added to each sample and ligated overnight at 4°C, followed by heat inactivation at 65°C for 30 min. DNA fragments spanning the bursa aurealis insertion sites in each sample were amplified using the Buster (5′ GCTTTTTCTAAATGTTTTTTAAGTAAATCAAGTACC 3′) and Martn-ermR (5′ AAACTGATTTTTAGTAAACAGTTGACGATATTC 3′) primer set. PCR conditions included 30 cycles with an annealing temperature of 63°C and an extension time of 3 min. Once amplified, samples of the DNA products were separated in a 1% agarose gel by electrophoresis, and the remainder was purified for sequencing using Exo-SAP-IT (GE Healthcare) according to the manufacturer’s instructions. Finally, determination of the nucleotide sequences of the genomic DNA flanking the transposons was achieved using the Buster primer at the DNA Microarray and Sequencing Core Facility at the University of Nebraska Medical Center.
Fey P.D., Endres J.L., Yajjala V.K., Widhelm T.J., Boissy R.J., Bose J.L, & Bayles K.W. (2013). A Genetic Resource for Rapid and Comprehensive Phenotype Screening of Nonessential Staphylococcus aureus Genes. mBio, 4(1), e00537-12.
Publication 2013
Bacteriophages Cell Nucleus Centrifugation Chloramphenicol DNA Chips DNA Primers Edetic Acid Electrophoresis Erythromycin Genome Glycerin Jumping Genes Lysostaphin Microarray Analysis Obstetric Delivery Oligonucleotide Primers Plasmids Promega Sepharose Sequence Determinations, DNA Strains Synovial Bursa T4 DNA Ligase Transposase Tromethamine
5
Single-cell RNA-seq of human preimplantation embryos
Cited 96 times
Human embryos were obtained from two cohorts at the Huddinge Karolinska Hospital and Carl von Linné Clinic with ethical approval from regional ethics board (2012/1765-31/1). The first cohort was from preimplantation genetic diagnosis (PGD) testing on embryonic day (E) 4 and cultured until E7 (expanded blastocyst, just prior to implantation) under standard conditions as performed in the IVF Clinic (5% CO2/5% O2 in CCM media (Vitrolife) covered with Ovoil (Vitrolife). The second cohort was from frozen E2 embryos thawed (ThawKit Cleave, VitroLife) and cultured in G-1 Plus media (VitroLife) and from E3 in CCM media. As we are restricted to embryos cultured in vitro, we cannot exclude potential differences with their in vivo counterparts. However, we anticipate these differences to be relatively subtle as in vitro cultured embryos used in infertility treatment progress and give rise to viable offspring.
Embryos were dissociated through trituration in TrypLE, (Life Technologies) and picked with fine glass capillaries. For a subset of E5–E7 embryos, ICM cells were enriched using immunosurgery (15 embryos). Cells were dispensed in lysis buffer, and cDNA libraries were generated using Smart-seq2 (Picelli et al., 2014 (link)). Briefly, following cell lysis, PolyA(+) RNA was reverse transcribed using SuperScript II reverse transcriptase (Invitrogen) and nested primers, utilizing a strand-switch reaction to add a reverse primer for the second-strand synthesis. The cDNA was amplified by PCR (18 cycles) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) and purified using magnetic beads. The quantity and quality of the cDNA libraries were assessed using an Agilent 2100 BioAnalyzer (Agilent Technologies). cDNA (∼1 ng) was tagmented using transposase Tn5 and amplified with a dual-index (i7 and i5; Illumina; 10 cycles) and individual Nextera XT libraries were purified with magnetic beads. Indexed sequence libraries were pooled for multiplexing (∼40 samples per lane), and single-end sequencing was performed on HiSeq 2000 using TrueSeq dual-index sequencing primers (Illumina). For further details and data analysis see the Supplemental Experimental Procedures.
Petropoulos S., Edsgärd D., Reinius B., Deng Q., Panula S.P., Codeluppi S., Plaza Reyes A., Linnarsson S., Sandberg R, & Lanner F. (2016). Single-Cell RNA-Seq Reveals Lineage and X Chromosome Dynamics in Human Preimplantation Embryos. Cell, 165(4), 1012-1026.
Publication 2016
Anabolism Blastocyst Buffers Capillaries cDNA Library Cells Culture Media DNA, Complementary Embryo Freezing Homo sapiens Oligonucleotide Primers Ovum Implantation Poly A Preimplantation Diagnosis RNA-Directed DNA Polymerase Sterility, Reproductive Transposase

Most recents protocols related to «Transposase»

1
Constructing and Evaluating Antibiotic Resistance Mutants
We constructed a total of 34 mutants across the three genes consisting of 12 CAT-I mutants, 13 NDM-1 mutants, and 9 aadB mutants. We used inverse PCR to introduce the mutations. We also used inverse PCR to construct a control plasmid, pSKunk1-ΔGene, which had the coding region of the studied antibiotic resistance genes deleted.
For the C26D and C26S mutants in NDM-1, we found that an IS4-like element ISVsa5 family transposase insertion would occur within the NDM-1 gene during the six hours of induced monoculture growth (supplementary Text, Supplementary Material online). We made two synonymous mutations within the 5′-GCTGAGC-3′ insertion site that fully overlapped codons 23 and 24 to reduce transposase insertion and get an accurate measure of the collateral fitness effects for the C26D and C26S mutations. The new sequence was 5′-GTTATCA-3′. Inverse PCR was used to introduce these synonymous mutations. All mutant plasmids were transformed into NEB 5-alpha LacIq electrocompetent cells.
Mehlhoff J.D, & Ostermeier M. (2023). Genes Vary Greatly in Their Propensity for Collateral Fitness Effects of Mutations. Molecular Biology and Evolution, 40(3), msad038.
Publication 2023
Antibiotic Resistance, Microbial Chloramphenicol O-Acetyltransferase Codon Genes Inverse PCR Mutation Pancreatic alpha Cells Plasmids Silent Mutation Transposase
2
Transposase-Based Single-Cell Nuclei Isolation
Cells (5 × 104) were spun at 500 × g for 5 min, followed by a wash using 50 μL of cold 1× PBS and centrifugation at 500 × g for 5 min. Cells were lysed using cold lysis buffer (10 mM Tris-Cl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 and 0.1% IGEPAL CA-630). Immediately after lysis, nuclei were spun at 500 × g for 10 min using a refrigerated centrifuge. To avoid losing cells during the nuclei preparation, we used a fixed angle centrifuge and carefully pipetted away from the pellet after centrifugations. Immediately following the centrifugation, the pellet was resuspended in the transposase reaction mix (10 μL 5× TTBL buffer, 3 μL TTE Mix V50 (Illumina) and 37 μL of nuclease free water). The transposition reaction was carried out for 30 min at 37 °C. Directly following transposition the sample was purified using a DNA Clean&Concentrator-5 kit (ZYMO RESEARCH, D4014, California, USA). Following purification, we amplified library fragments using Q5® Hot Start High-Fidelity DNA Polymerase and PCR primers N5 and N7 (TruePrep® Index Kit V2 for Illumina, Vazyme, TD202), using the following PCR conditions: 72 °C for 5 min, 98 °C for 30 s, followed by thermocycling at 98 °C for 10 s, 63 °C for 30 s and 72 °C for 1 min. We amplified the full libraries for 13 cycles, after 13 cycles we took purification to the PCR reaction by VAHTS DNA Clean Beads (Vazyme, N411-01) according to the manufacturer’s instructions. Purified DNA was analyzed by high-throughput sequencing (Novogene, Beijing, China).
Li X., Wang S., Xie Y., Jiang H., Guo J., Wang Y., Peng Z., Hu M., Wang M., Wang J., Li Q., Wang Y, & Liu Z. (2023). Deacetylation induced nuclear condensation of HP1γ promotes multiple myeloma drug resistance. Nature Communications, 14, 1290.
Publication 2023
Buffers Cell Nucleus Cells Centrifugation Cold Temperature DNA, A-Form DNA-Directed DNA Polymerase DNA Library Igepal CA-630 Magnesium Chloride Oligonucleotide Primers Sodium Chloride Transposase Tromethamine
3
Genomic Integration and Plasmid Curation
Complementation of ID40 was done as described by Choi et al.35 (link) The coding sequences of the gene of interest were amplified by PCR from genomic DNA and assembled with the plasmid pJM220 (pUC18T-miniTn7T-gm-rhaSR-PrhaBAD)36 (link) by Gibson cloning. The constructed plasmids were transformed into E. coli SM10 λ pir and mobilized by conjugation into the mutant strains as described35 (link) with some modifications. A triparental mating was conducted by combining the recipient strain together with the mini-Tn7T harboring E. coli SM10 λ pir strain and E. coli SM10 λ pir pTNS3, harboring a Tn7 transposase. Insertion of the mini-Tn7T construct into the attTn7 site was verified by PCR. Excision of the pJM220 backbone containing the Gm resistance cassette was performed by expressing Flp recombinase from a conjugative plasmid, pFLP2. Finally, sucrose resistant but gentamicin and carbenicillin sensitive colonies were verified by PCR.
Eggers O., Renschler F.A., Michalek L.A., Wackler N., Walter E., Smollich F., Klein K., Sonnabend M.S., Egle V., Angelov A., Engesser C., Borisova M., Mayer C., Schütz M, & Bohn E. (2023). YgfB increases β-lactam resistance in Pseudomonas aeruginosa by counteracting AlpA-mediated ampDh3 expression. Communications Biology, 6, 254.
Publication 2023
Carbenicillin Escherichia coli Exons FLP recombinase Genes Genome Gentamicin Plasmids Strains Sucrose Transposase Vertebral Column
4
Phylogenetic Analysis of Transposases Across Endosymbionts
For the phylogenetic analysis of shared transposases we first clustered all genes annotated as transposases by prokka [57 (link)] into gene families using SiLiX (v1.2.11) [65 (link)]. For each gene family that was shared by two or more endosymbionts we searched for homologous sequences using the blastp function of ISfinder [73 (link)] and created a multiple sequence alignment with MAFFT (v7.453; ‘--maxiterate 1000’) [50 (link)]. Afterwards, the alignments were manually checked and sequences showing clear signs of degradation either on the 3′ or 5′ end were removed. We took care to only remove transposase sequences that seemed degraded (i.e. pseudogenized) in comparison to otherwise highly identical genes in order to keep the dataset clear of sequences that might be under different selective pressures. Finally, the alignments were trimmed using BMGE (v1.12) [74 (link)] and used for phylogenetic reconstruction using iqtree2 (v2.1.2; ‘-bnni’ ‘-alrt 1000’ ‘-m TESTNEW’ ‘-bb 1000’ ‘-mset LG’ ‘-madd LG+C10,LG+C20,LG+C30,LG+C40,LG+C50,LG+C60’ ‘-keep-ident’ ‘-wbtl’) [55 (link)]. For transposase sequences showing a clear sister-clade relationship in the de novo trees and belonging to the same eggNOG gene family, we reconstructed phylogenetic trees using gene families based on the eggNOG database (v5.0) [60 (link)] and EggNOG-mapper (v2.1.0) [61 (link)]. For this, we added the protein sequences from the respective gene families from the eggNOG database (v5.0) [60 (link)] to the endosymbiont gene families. For each gene family we then calculated multiple sequence alignments, curated them and reconstructed phylogenies as described above.
Halter T., Köstlbacher S., Rattei T., Hendrickx F., Manzano-Marín A, & Horn M. (2023). One to host them all: genomics of the diverse bacterial endosymbionts of the spider Oedothorax gibbosus. Microbial Genomics, 9(2), mgen000943.
Publication 2023
Amino Acid Sequence Gene Order Gene Products, Protein Genes Homologous Sequences MADD protein, human Sequence Alignment Transposase Trees
5
Variant Calling from Sequencing Libraries
For calling genetic variants we used the same short-read sequencing libraries as described for the abundance estimations, but we excluded all samples from the Walenbos population as the endosymbiont genomes were reconstructed from this population, and we excluded all samples with a coverage <30. Afterwards, we applied breseq (v0.36.1) [76 (link)] to call genetic variants present in the sequencing libraries in comparison to the reference genomes. We excluded all variants with a frequency <1 and variants affecting transposases or introns from the output and calculated the total number of mutations/kb and relative abundances of variant types per sample.
Halter T., Köstlbacher S., Rattei T., Hendrickx F., Manzano-Marín A, & Horn M. (2023). One to host them all: genomics of the diverse bacterial endosymbionts of the spider Oedothorax gibbosus. Microbial Genomics, 9(2), mgen000943.
Publication 2023
Genetic Diversity Genome Introns Mutation Transposase

Top products related to «Transposase»

1
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
2
Minelute pcr purification kit by Qiagen
Sourced in Germany, United States, United Kingdom, Italy, Japan, Netherlands, China, France, Switzerland
The MinElute PCR Purification Kit is a laboratory equipment product designed for the efficient purification of PCR amplicons. It utilizes a silica-membrane-based technology to capture and purify DNA fragments from PCR reactions, allowing for the removal of primers, nucleotides, enzymes, and other impurities.
3
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.
4
Nextseq 500 by Illumina
Sourced in United States, Germany, China, United Kingdom, Australia, France, Italy, Canada, Japan, Austria, India, Spain, Switzerland, Cameroon, Netherlands, Czechia, Sweden, Denmark
The NextSeq 500 is a high-throughput sequencing system designed for a wide range of applications, including gene expression analysis, targeted resequencing, and small RNA discovery. The system utilizes reversible terminator-based sequencing technology to generate high-quality, accurate DNA sequence data.
5
Minelute kit by Qiagen
Sourced in Germany, United States
The MinElute kit is a laboratory equipment used for DNA and RNA purification. It facilitates the efficient extraction and concentration of nucleic acids from various sample types.
6
Hiseq 2500 by Illumina
Sourced in United States, China, Germany, United Kingdom, Canada, Switzerland, Sweden, Japan, Australia, France, India, Hong Kong, Spain, Cameroon, Austria, Denmark, Italy, Singapore, Brazil, Finland, Norway, Netherlands, Belgium, Israel
The HiSeq 2500 is a high-throughput DNA sequencing system designed for a wide range of applications, including whole-genome sequencing, targeted sequencing, and transcriptome analysis. The system utilizes Illumina's proprietary sequencing-by-synthesis technology to generate high-quality sequencing data with speed and accuracy.
7
Endotoxin free maxi prep kit by Merck Group
Sourced in United States
The Endotoxin free Maxi prep kit is a laboratory product designed for the purification of high-quality plasmid DNA from bacterial cultures. The kit utilizes a modified alkaline lysis method and anion-exchange chromatography to efficiently remove endotoxins, ensuring the resulting plasmid DNA is free from this contaminant.
8
Puromycin by Thermo Fisher Scientific
Sourced in United States, Germany, China, United Kingdom, France, Canada, Japan, Australia, Switzerland, Belgium, Italy, Macao
Puromycin is a laboratory reagent used for selection of mammalian cells expressing a puromycin resistance gene. It acts as an antibiotic that inhibits protein synthesis, leading to cell death in cells that do not express the resistance gene.
9
Mmessage mmachine sp6 kit by Thermo Fisher Scientific
Sourced in United States, Netherlands, Switzerland
The MMessage mMachine SP6 kit is a tool used for in vitro transcription of RNA. It enables the synthesis of capped and polyadenylated mRNA from DNA templates using the T7 RNA polymerase. The kit provides the necessary reagents and protocols to perform this process.

More about "Transposase"

Transposases are remarkable enzymes that facilitate the relocation of DNA sequences, known as transposons, within and across genomes.
These mobile genetic elements play a pivotal role in genome evolution and have become invaluable tools in genetic engineering techniques.
Transposases recognise specific DNA sequences and catalyze the excision and insertion of transposons, enabling their dynamic repositioning.
The mechanisms and applications of transposases are crucial for advancements in molecular biology, genetic manipulation, and the study of genome dynamics.
Lipofectamine 2000 and Lipofectamine 3000 are widely used transfection reagents that can be employed in conjunction with transposase-based systems for efficient gene delivery and expression.
The MinElute PCR Purification Kit and MinElute kit provide effective methods for purifying DNA fragments, including transposon-containing sequences, prior to downstream applications.
The NextSeq 500 and HiSeq 2500 are high-throughput sequencing platforms that can be leveraged to study genome-wide transposon integration patterns and dynamics.
Puromycin, a selection marker, can be used to identify cells successfully transfected with transposase-encoding constructs.
The MMessage mMachine SP6 kit enables the in vitro transcription of transposase mRNA for use in various experimental setups.
Endotoxin-free Maxi prep kits are crucial for producing high-quality, endotoxin-free plasmid DNA carrying transposase genes, ensuring optimal performance in cell-based assays and animal studies.
By understanding and optimizing these complementary techniques, researchers can harness the power of transposases to unlock new frontiers in genetic engineering, genome editing, and the exploration of genome dynamics.