Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Tryptic soy broth

Tryptic soy broth

Tryptic soy broth is a commonly used microbial growth medium composed of peptones, soymeal, and other nutrients.
It provides a versatile, nutrient-rich environment that supports the growth of a wide range of bacterial and fungal species.
Tryptic soy broth is widely employed in laboratory settings for culturing, isolating, and maintaining microorganisms, as well as for various experimental procedures.
Its standardized formulation and ability to promote robust microbial growth make it an essential tool for researchers in the fields of microbiology, immunology, and biotechnology.
The broth's consistent performance and reproducible results contribute to the reliability and comparability of experimental findings.

Most cited protocols related to «Tryptic soy broth»

1
Curing Plasmids from Staphylococcus aureus Strain
The Staphylococcus aureus strains used in this study were derived from a USA300 strain isolated from a skin and soft tissue infection in a detainee from the Los Angeles County Jail (LAC) (35 (link)). S. aureus strain LAC contains two plasmids, p01 (a 3.1-kb cryptic plasmid) and p03 (a 27-kb plasmid conferring resistance to erythromycin) (36 (link)). Both p01 and p03 were removed from LAC for two reasons. First, curing of these two plasmids eliminated potential plasmid incompatibility concerns with pFA545 and pBursa (see below), and second, curing ensured that the bursa aurealis transposon did not insert preferentially into plasmid DNA. For removal of p03, strain LAC was grown overnight in Tryptic soy broth (TSB) with shaking at 37°C without antibiotics. The next day, serial dilutions were made and the cells were plated on Trypic soy agar (TSA) plates without any antibiotics. Colonies arising after overnight incubation at 37°C were then replica plated onto plates with and without erythromycin (5 µg/ml). Those colonies unable to grow on erythromycin were chosen, and the loss of the plasmid was confirmed by performing plasmid analysis (Promega, Madison, WI). After confirmation that no major genomic rearrangements had occurred by pulsed-field gel electrophoresis (PFGE) (37 (link)), one colony, designated LAC-13C, was selected for subsequent manipulation.
We next cured p01 from LAC-13C utilizing a plasmid incompatibility strategy. First, a chimeric plasmid in which pCL84 (conferring tetracycline resistance) (38 (link)) and p01 were ligated together at their unique EcoRI sites was created. This plasmid, designated pJE06, was then electroporated into Escherichia coli DH5α, purified, and subsequently electroporated into S. aureus RN4220 (39 (link)). pJE06 was then transduced from RN4220 using bacteriophage ϕ11 (40 (link)) into LAC-13C using methods as described by McNamara (41 ). Plasmid preparations of the resulting tetracycline-resistant transductants were screened for the loss of p01 due to plasmid incompatibility (42 (link)). The resulting strains were then cured of pJE06 by following the process described above for removal of pUSA03 except that the colonies were screened for tetracycline sensitivity. Multiple tetracycline-susceptible derivatives were examined by PFGE to ensure that no chromosomal rearrangements were detected; one strain was selected for subsequent use and designated JE2.
Fey P.D., Endres J.L., Yajjala V.K., Widhelm T.J., Boissy R.J., Bose J.L, & Bayles K.W. (2013). A Genetic Resource for Rapid and Comprehensive Phenotype Screening of Nonessential Staphylococcus aureus Genes. mBio, 4(1), e00537-12.
Publication 2013
Agar Antibiotics Bacteriophages Cells CFC1 protein, human Chimera Chromosomes Deoxyribonuclease EcoRI derivatives Electrophoresis, Gel, Pulsed-Field Erythromycin Escherichia coli Gene Rearrangement Genome Hypersensitivity Jumping Genes Plasmids Promega Skin Soft Tissue Infection Staphylococcus aureus Staphylococcus aureus Infection Strains Synovial Bursa Technique, Dilution Tetracycline tryptic soy broth
2
Bacterial Strain Cultivation and Modification
The bacterial strains used in this study are described in Tables 1 and 2. Strains of Escherichia coli were grown in Luria-Bertani broth or Luria agar plates, and growth medium was supplemented with ampicillin (100 µg/ml) or chloramphenicol (10 µg/ml) as needed for maintenance of plasmids. Strains of S. aureus were grown in tryptic soy broth (TSB) or tryptic soy agar (TSA). For selection of chromosomal markers or maintenance of plasmids, S. aureus antibiotic concentrations were (in µg/ml) the following: chloramphenicol (Cam), 10; erythromycin (Erm), 10; and tetracycline (Tet), 5. All reagents were purchased from Fisher Scientific (Pittsburg, PA) and Sigma (St. Louis, MO) unless otherwise indicated.
Strain LAC was made Erm sensitive by serial passage in TSB in order to cure the strain of the native plasmid pUSA03 that confers Erm resistance [45] (link). A single colony was picked and saved as Erm sensitive strain AH1263, and hereafter this strain will be referred to as LAC*.
Boles B.R., Thoendel M., Roth A.J, & Horswill A.R. (2010). Identification of Genes Involved in Polysaccharide-Independent Staphylococcus aureus Biofilm Formation. PLoS ONE, 5(4), e10146.
Full text: Click here
Publication 2010
Agar Ampicillin Antibiotics Bacteria Chloramphenicol Chromosome Markers Culture Media Erythromycin Escherichia coli Plasmids Staphylococcus aureus Strains Tetracycline Trypsin tryptic soy broth
3
Integrative Plasmid Construction for Staphylococcus aureus
Bacterial strains and plasmids are listed in Table 1. The backbone for the integrative plasmid was the shuttle plasmid pMAD [7] (link). The kanamycin resistance gene aphA(3), originally from S. aureus[8] (link), was amplified from pSS4332 [9] (link) and inserted at the BglII site of pMAD, yielding plasmid pRP1179. Approximately 660 bp in the area of USA300HOU_1102 (annotated as a pseudogene in the sequenced USA300 strain TCH1516 [10] (link)) was amplified from the S. aureus USA300 strain NRS384 and inserted into BamHI/SalI-digested pRP1179, generating pRP1186. Next, a modified luxBADCE operon, originally from Photorhabdus luminescens[11] (link), was amplified from a derivative of pSS4530 [12] (link) such that the operon was under the control of a modified gapA promoter with consensus -35, extended -10, and -10 regions (TTGACACTGCGTAAGGTTTGTGTTATAAT) and inserted at the EagI site of pRP1186, yielding pRP1190. Separately, the chloramphenicol resistance gene cat (originally from pC194 [13] (link)) was amplified from pBT2 [14] (link), digested with KpnI, and inserted into similarly digested pMAD, generating plasmid pRP1192. Finally, a 6.8 kb BamHI-SalI fragment of pRP1190 (including the USA300HOU_1102 homology and the lux operon) was ligated with similarly digested pRP1192, generating pRP1195 (Fig. 1). Thus, pRP1190 (with aphA(3)) is suitable for use in S. aureus strains that are kanamycin-sensitive, whereas pRP1195 (with cat) is suitable for use in strains that are chloramphenicol-sensitive. Plasmids were transformed into RN4220 by electroporation as previously described [15] (link) followed by growth at 30°C. For integration into the bacterial chromosome, strains were grown at 30°C overnight in tryptic soy broth (TSB) with 10 µg/ml chloramphenicol, followed by subculture (1∶100 dilution) in TSB without antibiotics at 30°C for 1–2 h, shift to 43°C for 6–7 h, serial dilution, plating on tryptic soy agar (TSA) with 10 µg/ml chloramphenicol, and overnight incubation at 43°C. Plates were imaged, and luminescent colonies were selected for further passage and analysis. Integration at the intended site was confirmed by PCR. Freely replicating or integrated plasmids were transferred to clinical strains by phi80 phage transduction as previously described [16] .
Plaut R.D., Mocca C.P., Prabhakara R., Merkel T.J, & Stibitz S. (2013). Stably Luminescent Staphylococcus aureus Clinical Strains for Use in Bioluminescent Imaging. PLoS ONE, 8(3), e59232.
Full text: Click here
Publication 2013
Agar Antibiotics Bacteria Bacteriophages Chloramphenicol Chloramphenicol Resistance Chromosomes, Bacterial Electroporation Genes Kanamycin Kanamycin Resistance Luminescence Operon Photorhabdus luminescens Plasmids Pseudogenes Staphylococcus aureus Strains Technique, Dilution Trypsin tryptic soy broth Vertebral Column
4
Characterizing Nanoparticle Dispersions in Cell Culture Media
Titanium dioxide P25 nanoparticles were received as dry powder. After detailed size, morphology, impurity, and surface area characterization (see Supporting Information for all characterization techniques), the sample was suspended in deionzied water at a concentration of 1 mg mL−1 to form a stock solution. Six different cell culture media including Bronchial Epithelial Growth Medium (BEGM), Dulbecco’s Modified Eagle’s Medium (DMEM), Luria Bertani Broth (LB), Tryptic Soy Broth (TSB), Synthetic Defined medium (SD), and Yeast Extract Peptone Dextrose medium (YPD) were selected for TiO2 nanoparticle dispersion studies. A systematic water quality analysis was conducted for each medium. All characterization techniques were described in the Supporting information. High throughput dynamic light scattering (HT-DLS, Dynapro™ Plate Reader, Wyatt Technology) was performed to determine the particle size distribution and state of agglomeration/dispersion of the nanoparticles in water and all different cell culture media. The plate reader is operated based on the same principles as the traditional DLS instruments but in a much more rapid manner. Analysis can be done using standard 96-, 384-, 1536-well plates. Since each measurement takes only a few seconds, ten runs were collected for each well and samples were loaded in at least triplicate. Particle sizes at various nanoparticle concentrations in all six media were determined simultaneously. Agglomeration kinetics measurements in each medium were conducted using the built-in kinetics feature in the HT-DLS instrument. This instrument provides a high throughput characterization method in parallel with the high throughput nanotoxicity studies. In addition to the dispersion characterization, the stability of the nanoparticle dispersions with or without dispersing agents was also evaluated by monitoring a characteristic peak of TiO2 UV-vis absorbance spectrum as a function of time. Zeta potentials of the TiO2 nanoparticle suspensions as another indication of the particle stability were also collected.
Ji Z., Jin X., George S., Xia T., Meng H., Wang X., Suarez E., Zhang H., Hoek E.M., Godwin H., Nel A.E, & Zink J.I. (2010). Dispersion and Stability Optimization of TiO2 Nanoparticles in Cell Culture Media. Environmental science & technology, 44(19), 7309-7314.
Publication 2010
Bronchi Cell Culture Techniques Cells Eagle Glucose Kinetics Neoplasm Metastasis Peptones Powder titanium dioxide tryptic soy broth Yeast, Dried
5
Bacterial Growth Media and Reagents
Mueller Hilton broth (Becton Dickinson, Sparks, MD, USA), tryptic soy broth, and tryptic soy agar were purchased from (Bacto), petroleum ether and chloroform were purchased from Friendemann Schmidt Chemicals. Methanol and ethanol 95% were purchased from Kollin Chemicals. DMSO was purchased from R&M Marketing, Essex UK. INT (Iodonitrotetrazolium chloride), antibiotics amphotericin and ampicillin were purchased from Sigma Aldrich, Germany.
Mogana R., Adhikari A., Tzar M.N., Ramliza R, & Wiart C. (2020). Antibacterial activities of the extracts, fractions and isolated compounds from Canarium patentinervium Miq. against bacterial clinical isolates. BMC Complementary Medicine and Therapies, 20, 55.
Full text: Click here
Publication 2020
Agar Amphotericin Ampicillin Antibiotics, Antitubercular Chlorides Chloroform Ethanol iodonitrotetrazolium Methanol naphtha Sulfoxide, Dimethyl Trypsin tryptic soy broth

Most recents protocols related to «Tryptic soy broth»

1
Leaf Mold Agar Medium Preparation
Not available on PMC !
This medium was prepared by dissolving 30g of Tryptic Soy Broth powder (BD 211825) in 1L of RO water and autoclaving at 121°C for 15 minutes. Leaf mold medium: Additionally, to investigate the effect on the growth of bacteria cultivated on leaf mold agar media, 10% leaf mold extract was prepared (leaf mold exrract : Milli-Q water = 1:9).
Miyashita A., Mikami K., Ishii M., Miyauchi M., & Tabuchi F. (2024). Advancing microbial isolation: The impact of leaf mold extract agar on soil samples.
Publication 2024
2
Nutrient Effects on Bacterial Growth
To evaluate the effect of nutrient content on growth kinetics, S. Inverness and S. Enteritidis cultured in distilled water at initial (T0), 30 (T30), and 160 days (T160), were adjusted to optical density (OD600) 0.1 with the Synergy MX spectrophotometer from BioTek Instruments, Inc. (Winooski, VT). A volume of 20-μL of each suspension was transferred to a 96-well plate containing 180 μL per well of 1/10 × TSB. The plate was incubated at 25°C and kinetics of growth was monitored by the Synergy MX spectrophotometer programmed to measure the absorbance at 600 nm every 2 h for 24 h with 10 s of intermittent shaking (Ahn et al., 2014 (link)). Growth curves were fitted using DMFit based on the model of Baranyi and Roberts (1994) (link) to calculate the parameters of maximum growth rate (μmax) and lag phase duration (λ).2
Williams A., Gaoh S.D., Savenka A., Paredes A., Alusta P., Ahn Y, & Buzatu D.A. (2024). A flow cytometric assay to detect viability and persistence of Salmonella enterica subsp. enterica serotypes in nuclease-free water at 4 and 25°C. Frontiers in Microbiology, 15, 1342478.
Full text: Click here
Publication 2024
3
Salmonella Recovery Effectiveness Evaluation
To assess the recovery effectiveness of Universal Pre-enrichment Broth (UP) and 1/10 × TSB (Ahn et al., 2014 (link)), the Salmonella serotypes cultured in distilled water for 160 days at both 4 and 25°C were used. Briefly, a 500 μL volume of culture from each strain was added to 12 individual 2 mL microcentrifuge tubes, containing 1.5 mL each of UP broth and 1/10 × TSB, and incubated at 37°C for 24 h under gentle shaking (110 rpm). Following the 24-h incubation period, 10 μL aliquots for each strain culture using UP and 1/10 × TSB were plated in triplicate, respectively, onto TSA and 1/10 × TSA plates which were subsequently incubated at 37°C for 24 h to determine viability of cells. On the following day, the presence (+) or absence (−) of colonies was noted.
Williams A., Gaoh S.D., Savenka A., Paredes A., Alusta P., Ahn Y, & Buzatu D.A. (2024). A flow cytometric assay to detect viability and persistence of Salmonella enterica subsp. enterica serotypes in nuclease-free water at 4 and 25°C. Frontiers in Microbiology, 15, 1342478.
Full text: Click here
Publication 2024
4
Biofilm Cultivation in Nutrient-Rich Media
For culturing of biofilms, a mixture of 2.5% tryptic soy broth (Merck Millipore, Darmstadt, Germany) and 2.5% malt extract broth (Merck Millipore, Darmstadt, Germany) was used. tryptic soy broth and malt extract broth were prepared according to the manufacturer’s instructions. The resulting media (100%) were each mixed to 2.5% in sterilized tap water of 5.43°e (Clark degree), which corresponds to 0.77 mmol/L CaCO3. The final pH was 6.8.
Lucassen R., van Leuven N, & Bockmühl D. (2024). Biological and Synthetic Surfactants Increase Class I Integron Prevalence in Ex Situ Biofilms. Microorganisms, 12(4), 712.
Full text: Click here
Publication 2024
5
Quantifying Bacterial Biofilm Formation
Not available on PMC !
Bacterial colonies from the fresh cultures of all isolates on MacConkey agar were inoculated with tubes containing tryptic soy broth (Accumix) with 0.25% glucose and incubated overnight at 37°C. 190 μL of tryptic soy broth containing inoculated bacteria, and 10 μL of tryptic soy broth containing glucose were mixed, then this bacterial suspension was diluted to 1/20 with tryptic soy broth. 200 μL from the diluted bacterial suspension was dispensed into each 96-well flat-bottomed microplate. C5 well was the negative control with only broth containing glucose. The MTP was incubated for 24 h at 37°C. The contents of the wells were emptied and the plates were rinsed three times with 200 μL of sterile distillate water while shaking and inverted to eliminate any non-stick bacteria. After fixating the bacteria that had adhered to the wells for 15 min with 200 μL of 99% methanol, they were subsequently rinsed 3 times with 200 μL of sterile distilled water, shaken, and inverted. Following a 5-min staining period with 200 μL of crystal violet, the wells were rinsed to eliminate any residual stain. Finally, the wells were air-dried. The dye bound to the wells was solubilized with 200 μL of glacial acetic acid. The optical density (OD) of each well was measured at 490 nm using an ELISA auto reader.
Hussein A.M., Jameel M.I., Majeed N.R., Noori A.Y., Mohammed M., Hamad W.N., & Mohammedsaeed A.A. (2024). Correlation between Klebsiella Species’ Biofilm Formation and Antibiotic Resistance from Erbil Hospital Patients. Cihan University-Erbil Scientific Journal, 8(2), 56-64.
Publication 2024

Top products related to «Tryptic soy broth»

1
Tryptic soy broth (tsb) by BD
Sourced in United States, Germany, Canada, France, United Kingdom, China, Poland, Japan, Denmark, Cameroon, Switzerland, Italy
Tryptic soy broth is a general-purpose microbiological culture medium used for the cultivation and growth of a wide range of bacteria. It provides the necessary nutrients, including peptones, glucose, and salts, to support the growth of a variety of bacterial species.
2
Tryptic soy broth (tsb) by Merck Group
Sourced in Germany, United States, United Kingdom, Spain, France, Canada, Poland, Italy, Switzerland, Saudi Arabia
Tryptic soy broth is a general-purpose, nutrient-rich culture medium used for the growth and maintenance of a wide variety of microorganisms, including bacteria, fungi, and yeasts. It provides a balanced source of amino acids, carbohydrates, and other essential nutrients to support microbial growth and proliferation.
3
Tryptic soy broth (tsb) by Thermo Fisher Scientific
Sourced in United Kingdom, United States, Italy, Australia, Germany, Canada, France, Denmark
TSB is a general-purpose growth medium used for the cultivation of a wide range of aerobic bacteria. It provides essential nutrients and growth factors required for the optimal growth of microorganisms in a laboratory setting.
4
Tryptic soy broth tsb by BD
Sourced in United States, United Kingdom, Germany, Belgium, Japan, Italy, Canada
Tryptic Soy Broth (TSB) is a general-purpose microbiological growth medium. It provides the necessary nutrients to support the growth of a wide range of microorganisms.
5
Tryptic soy agar by BD
Sourced in United States, Canada, Cameroon, France, China
Tryptic soy agar is a type of culture medium used in microbiology laboratories. It provides nutrients necessary for the growth of a wide range of microorganisms.
6
Tryptic soy agar by Merck Group
Sourced in Germany, United States, United Kingdom, Spain, Brazil, Italy
Tryptic soy agar is a general-purpose microbiological culture medium used for the growth and isolation of a wide variety of bacteria. It is composed of tryptone, soy peptone, sodium chloride, and agar. The medium provides nutrients necessary for the cultivation of various bacterial species.
7
Tryptic soy broth tsb by Merck Group
Sourced in United States, Germany, Canada, United Kingdom, Italy
Tryptic Soy Broth (TSB) is a general-purpose culture medium used for the growth and cultivation of a wide range of microorganisms, including bacteria, yeasts, and fungi. It provides the necessary nutrients and growth factors to support the proliferation of these microorganisms in a laboratory setting.
8
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
9
Tryptic soy agar by Thermo Fisher Scientific
Sourced in United Kingdom, United States, Italy
Tryptic soy agar is a general-purpose microbiological growth medium used for the cultivation and isolation of a wide variety of aerobic and facultative anaerobic bacteria. It provides nutrients and growth factors required for the cultivation of a diverse range of microorganisms.
10
Tryptic soy broth (tsb) by HiMedia
Sourced in India, United States
Tryptic soy broth is a general-purpose microbiological culture medium used for the growth and cultivation of a wide variety of bacteria. It provides the necessary nutrients and growth factors for the propagation of both aerobic and anaerobic bacterial species.

More about "Tryptic soy broth"

Tryptic soy broth (TSB) is a widely used microbial growth medium that supports the cultivation of a diverse range of bacterial and fungal species.
Composed of peptones, soy meal, and other essential nutrients, TSB provides a versatile, nutrient-rich environment for culturing, isolating, and maintaining microorganisms in laboratory settings.
Its standardized formulation and ability to promote robust microbial growth make it an indispensable tool for researchers in fields such as microbiology, immunology, and biotechnology.
The broth's consistent performance and reproducible results contribute to the reliability and comparability of experimental findings.
Tryptic soy agar (TSA) is another commonly used medium that is often employed in conjunction with TSB.
TSA is a solid growth medium that allows for the isolation and enumeration of individual microbial colonies, making it useful for various experimental procedures and diagnostic applications.
In addition to TSB and TSA, other related terms and products include fetal bovine serum (FBS), which is sometimes used in cell culture media to support the growth and proliferation of eukaryotic cells.
The combination of TSB or TSA with FBS can create a nutrient-rich environment that supports the growth of both prokaryotic and eukaryotic cells, enabling researchers to study various biological systems and processes.
Overall, tryptic soy broth and its related products are essential tools for researchers, providing a standardized and reliable platform for the cultivation, isolation, and maintenance of microorganisms, as well as for a wide range of experimental procedures in the fields of microbiology, immunology, and biotechnology.