Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Tubulin

Tubulin

Tubulin is a key structural protein in eukaryotic cells, forming the major component of microtubules.
It plays a crucial role in cell division, intracellular transport, and cell motility.
Tubulins are heterodimeric proteins composed of alpha and beta subunits, which polymerize to create the hollow, cylindrical microtubule structures.
They are the target of many anti-cancer drugs, and understanding tubulin dynamics is an active area of research in cell biology and pharmacology.
Tubulna is essential for a wide range of cellular processes, making it an important area of study for scientists working to unravel the complexities of the cell.

Most cited protocols related to «Tubulin»

1
Centrosome Reorientation in Tumor Invasion
Cited 226 times
The reorientation of the centrosome during tumor invasion was assessed by 2D invasion assay. The two-well culture insert with 0.5 mm gap between wells (ibidi) was placed on a fibronectin-coated glass-bottom dish. SaOS2 cells transfected with the respective siRNAs were plated onto the culture insert and grown to confluent monolayers. After the inserts were removed, the monolayers were washed with PBS and overlaid with Matrigel (BD) diluted 1:20 in PBS, followed by incubation for 4 hr before addition of growth medium. Cells were then cultured for 24 hr to allow invasion toward the space between the monolayers. After fixation with 4% (w/v) paraformaldehyde, cells were stained with antibody to γ-tubulin to visualize the centrosome, and counterstained with DAPI. The percentages of the edge cells in which the centrosome was within the 120° sector emerging from the center of the nucleus and facing toward the space between the monolayers was measured.
Nishita M., Park S.Y., Nishio T., Kamizaki K., Wang Z., Tamada K., Takumi T., Hashimoto R., Otani H., Pazour G.J., Hsu V.W, & Minami Y. (2017). Ror2 signaling regulates Golgi structure and transport through IFT20 for tumor invasiveness. Scientific Reports, 7, 1.
Full text: Click here
Publication 2017
Biological Assay Centrosome Cerebellar Nuclei Culture Media DAPI FN1 protein, human Hyperostosis, Diffuse Idiopathic Skeletal Immunoglobulins matrigel Neoplasm Invasiveness paraform RNA, Small Interfering Tubulin
2
Quantifying Cell Cycle Protein Levels
Cited 186 times
Cells were grown on Histogrip (Invitrogen) coated glass coverslips and fixed using ice-cold 100% methanol (β-tubulin) or with 3.7% formaldehyde diluted in PBS with 0.5% Triton X-100 for 10 min (Mad2, pSerCdk, Lamin A/C, Plk1, cyclin B1, and securin). All cells were washed and then blocked (3% BSA, 0,1% Tween 20 in PBS) for 30 min. Cells were incubated with primary antibodies were incubated for 2 h at room temperature in blocking solution. DNA was stained with DAPI. For Lamin A/C staining a Leica DM6000 SP8 confocal with a 63× lens was used. All other images were captured using Leica DM5500 microscope coupled with a Coolsnap HQ2 camera, using a Leica 100× or 40× APO 1.4 lens, powered by Leica LAS AF v3 software. To quantify pSer-CDK, cyclin B and secruin levels in cells, a single in-focus plane was acquired. Using ImageJ (v1.48, NIH), an outline was drawn around each cell and circularity, area, mean fluorescence measured, along with several adjacent background readings. The total corrected cellular fluorescence (TCCF) = integrated density – (area of selected cell × mean fluorescence of background readings), was calculated. This TCCF was then equalized against the mean TCCF of neighboring interphase cells in the same field of view, with results presented as fold increase over interphase levels. Box plots and statistical analysis (2-sided unpaired Student t tests) were performed using GraphPad Prism 5. For all other images, 0.3 µm z-sections were taken, de-convolved, and displayed as 2D maximum projections using ImageJ. False coloring and overlays were performed using Adobe Photoshop CS5 software.
McCloy R.A., Rogers S., Caldon C.E., Lorca T., Castro A, & Burgess A. (2014). Partial inhibition of Cdk1 in G2 phase overrides the SAC and decouples mitotic events. Cell Cycle, 13(9), 1400-1412.
Publication 2014
Antibodies Cells Cold Temperature Cyclin B Cyclin B1 DAPI Fluorescence Formaldehyde Interphase Lens, Crystalline LMNA protein, human Methanol Microscopy PLK1 protein, human prisma PTTG1 protein, human Student Triton X-100 Tubulin Tween 20
3
Immunofluorescence Microscopy Antibodies
Cited 122 times
Rabbit anti-Ror2 61 (link) and anti-IFT20 31 (link) antibodies were prepared as described previously. Sheep anti-TGN46 and rabbit anti-Giantin antibodies have been described previously62 (link). Following antibodies were purchased commercially: mouse anti-GM130 (35, BD), anti-Cortactin (4F11, Millipore), anti-γ-tubulin (GTU-88, Sigma), anti-tyrosinated tubulin (TUB01A2, Sigma), anti-AKAP450 (15, BD), anti-GFP (JL-8, Clontech), anti-acetylated tubulin (6-11B-1, Sigma), anti-Myc (9E10, Santa Cruz), anti-Golgin-97 (CDF4, Thermo), and Alexa Fluor 647-conjugated anti-GM130 (5G8, MBL); rabbit anti-IFT20 (13615-1-AP, Proteintech), anti-Arl13B (ab83879, Abcam), anti-GM130 (PM061, MBL), anti-γ-tubulin (T5192, Sigma), anti-Golgin-97 (D8P2K, Cell Signaling Technology), and HRP-conjugated anti-α-tubulin (PM054-7, MBL).
Nishita M., Park S.Y., Nishio T., Kamizaki K., Wang Z., Tamada K., Takumi T., Hashimoto R., Otani H., Pazour G.J., Hsu V.W, & Minami Y. (2017). Ror2 signaling regulates Golgi structure and transport through IFT20 for tumor invasiveness. Scientific Reports, 7, 1.
Full text: Click here
Publication 2017
Alexa Fluor 647 alpha-Tubulin Anti-Antibodies Antibodies CTTN protein, human Domestic Sheep Golgi complex autoantigen, 97-kDa macrogolgin Mus Rabbits ROR2 protein, human Tubulin
4
Fluorescent Labeling of Live Cells
Cited 87 times
HeLa cells (ATCC) and U2OS cells (ATCC) were cultured in Dulbecco’s modified eagle medium (DMEM; Life Technologies) supplemented with 10% v/v fetal bovine serum (FBS; Life Technologies), 1 mM GlutaMax (Life Technologies), and 1 mM sodium pyruvate (Sigma) and maintained at 37 °C in a humidified 5% v/v CO2 environment. These cell lines undergo regular mycoplasma testing by the Janelia Cell Culture Facility. Cells were transfected with HaloTag–H2B, HaloTag–tubulin, SnapTag–TetR, or SnapTag–H2B using an Amaxa Nucleofector (Lonza). Before the imaging experiments, transfected cells were transferred onto a No.1 coverslip (Warner Instruments) that was cleaned by Piranha solution (3:1 v/v mixture of concentrated H2SO4 and 30% v/v hydrogen peroxide). To label live cells with the HaloTag or SnapTag ligands, compounds 9, 10, 27, 28, 29, 30, or 31 were added to the growth medium and the samples incubated for 15 min. Labeling concentrations were typically 100–500 nM for confocal, wide-field, and dSTORM experiments and 5–50 nM for single-molecule tracking experiments. Cells were then washed briefly with PBS (1×) and then incubated in DMEM–FBS for an additional 15 min. Before imaging, the cells were washed briefly with PBS (3×) and placed in fresh DMEM–FBS for imaging. All washes were omitted in the “no wash” experiments. For nuclear staining, cells were incubated in PBS for 5 min (2×), and then incubated in PBS containing 5 μM DRAQ5 (Cell Signaling) for 5 min, followed by brief wash with PBS (1×). During all imaging experiments, cells were maintained at 37 °C in a humidified 5% CO2 v/v environment supplied by a live-cell incubator (TOKAI HIT).
Grimm J.B., English B.P., Chen J., Slaughter J.P., Zhang Z., Revyakin A., Patel R., Macklin J.J., Normanno D., Singer R.H., Lionnet T, & Lavis L.D. (2015). A general method to improve fluorophores for live-cell and single-molecule microscopy. Nature methods, 12(3), 244-250.
Publication 2014
Cell Culture Techniques Cell Lines Cells Culture Media Eagle HaloTag HeLa Cells Ligands Mycoplasma Peroxide, Hydrogen Piranhas Pyruvate Sodium Tubulin
5
Fluorescent Labeling of Live Cells
Cited 82 times
HeLa cells (ATCC) and U2OS cells (ATCC) were cultured in Dulbecco’s modified eagle medium (DMEM; Life Technologies) supplemented with 10% v/v fetal bovine serum (FBS; Life Technologies), 1 mM GlutaMax (Life Technologies), and 1 mM sodium pyruvate (Sigma) and maintained at 37 °C in a humidified 5% v/v CO2 environment. These cell lines undergo regular mycoplasma testing by the Janelia Cell Culture Facility. Cells were transfected with HaloTag–H2B, HaloTag–tubulin, SnapTag–TetR, or SnapTag–H2B using an Amaxa Nucleofector (Lonza). Before the imaging experiments, transfected cells were transferred onto a No.1 coverslip (Warner Instruments) that was cleaned by Piranha solution (3:1 v/v mixture of concentrated H2SO4 and 30% v/v hydrogen peroxide). To label live cells with the HaloTag or SnapTag ligands, compounds 9, 10, 27, 28, 29, 30, or 31 were added to the growth medium and the samples incubated for 15 min. Labeling concentrations were typically 100–500 nM for confocal, wide-field, and dSTORM experiments and 5–50 nM for single-molecule tracking experiments. Cells were then washed briefly with PBS (1×) and then incubated in DMEM–FBS for an additional 15 min. Before imaging, the cells were washed briefly with PBS (3×) and placed in fresh DMEM–FBS for imaging. All washes were omitted in the “no wash” experiments. For nuclear staining, cells were incubated in PBS for 5 min (2×), and then incubated in PBS containing 5 μM DRAQ5 (Cell Signaling) for 5 min, followed by brief wash with PBS (1×). During all imaging experiments, cells were maintained at 37 °C in a humidified 5% CO2 v/v environment supplied by a live-cell incubator (TOKAI HIT).
Grimm J.B., English B.P., Chen J., Slaughter J.P., Zhang Z., Revyakin A., Patel R., Macklin J.J., Normanno D., Singer R.H., Lionnet T, & Lavis L.D. (2015). A general method to improve fluorophores for live-cell and single-molecule microscopy. Nature methods, 12(3), 244-250.
Publication 2014
Cell Culture Techniques Cell Lines Cells Culture Media Eagle HaloTag HeLa Cells Ligands Mycoplasma Peroxide, Hydrogen Piranhas Pyruvate Sodium Tubulin

Most recents protocols related to «Tubulin»

1
Mitochondrial Motility Regulation by Delta-2 Tubulin and Bortezomib
Not available on PMC !

EXAMPLE 4

To determine the effect bortezomib and delta-2 tubulin accumulation have on mitochondrial motility, DRG neurons were transduced with lentivirus to express wild-type tubulin or delta-2 tubulin. As shown in FIGS. 15A and B, DRG neurons that expressed delta-2 tubulin showed a significant reduction in the motility of the mitochondria in the neurons as compared to control neurons or neurons that expressed wild-type tubulin. Expression of delta-2 tubulin affected every state of mitochondrial movement analyzed except for the stationary state (STA) (FIG. 15C). The effect of CCP1 knockdown on mitochondrial movement in the presence of bortezomib was also analyzed. As shown in FIG. 15D, treatment with bortezomib greatly affected the movement of mitochondria in DRG neurons. However, the knockdown of CCP1 activity rescued the effects bortezomib had on the motility of the mitochondria (FIG. 15D-F).

US11874284B2. Delta-2-tubulin as a biomarker and therapeutic target for peripheral neuropathy (2024-01-16). THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK [US], UNIVERSITÀ DEGLI STUDI DI MILANO-BICOCCA [IT]. Inventors: Francesca Bartolini [US], Maria Elena Pero [US], Guido Cavaletti [IT].
Full text: Click here
Patent 2024
Bortezomib delta-Tubulin Lentivirus Mitochondria Mitochondrial Inheritance Motility, Cell Motor Neurons Movement Neurons Tubulin
2
CCP1 Regulates Delta-2 Tubulin in Peripheral Neuropathy
Not available on PMC !

EXAMPLE 3

CCP1 is a tubulin enzyme that participates in the generation of delta-2 tubulin (FIG. 9). To determine the importance of CCP1 in neuropathy upon treatment with a chemotherapy agent, DRGs were treated with 200 mM bortezomib in vitro for 24 hrs. DRGs were also treated with a short hairpin RNA targeting CCP1. As shown in FIG. 10 and FIG. 14, the knockdown of CCP1 activity prevented accumulation of delta-2 tubulin and prevented DRG axonopathy that occurs upon treatment with bortezomib. These data are supportive of a pathogenic role of delta-2 tubulin in chemotherapy-induced peripheral neuropathy and the important role CCP1 plays in generating delta-2 tubulin.

US11874284B2. Delta-2-tubulin as a biomarker and therapeutic target for peripheral neuropathy (2024-01-16). THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK [US], UNIVERSITÀ DEGLI STUDI DI MILANO-BICOCCA [IT]. Inventors: Francesca Bartolini [US], Maria Elena Pero [US], Guido Cavaletti [IT].
Full text: Click here
Patent 2024
Bortezomib delta-Tubulin Enzymes pathogenesis Peripheral Nervous System Diseases Pharmacotherapy Short Hairpin RNA Tubulin
3
Validation of Differentially Expressed Genes in Chaetoceros socialis
Six DEGs were validated through a real-time qPCR analysis (Table S5). Three DEGs were randomly chosen, in addition to the most downregulated high-affinity nitrate transporter (NTR2:6) and one NADH-nitrate reductase, which are related to nitrate uptake, and a silicon efflux transporter (LSI3) related to the deposition of silicon in spore valves. Two genotyped strains of C. socialis, namely APC12 and MCA6 were used for this purpose: the former strain is the one used for the transcriptome experiment, while MCA6 is a freshly established strain isolated at station LTER-MC in the Gulf of Naples and for which the D1–D3 region of the nuclear-encoded large subunit ribosomal DNA (partial 28S rDNA) has been sequenced as in [70 ] to confirm its identity.
Triplicate cultures of both strains were maintained in control and low N media, with the same nutrient concentrations used for the RNA-seq experiment. Cells were harvested on day 2 in the control, when the percentage of spores was zero, and on day 3 in the treatments, when the percentage of spores was ~ 33 and ~ 38% for APC12 and MCA6, respectively, corresponding to the ones recorded at T3 of the transcriptome experiment. RNA extraction and purification were performed as illustrated above. Total RNA was reverse-transcribed using the QuantiTect® Reverse Transcription Kit (Qiagen, Venlo, Limburgo, Nederlands).
RTqPCR amplification was performed with cDNA diluted 1:10, in a 10 µl reaction containing each primer at a final concentration of 1 µM and Fast SYBR Green Master mix with ROX (Applied Biosystems) using a ViiA™ 7 Real-Time PCR System (Applied Biosystems by Life Technologies, Carlsbad, CA, USA) and the following cycling parameters: 95 °C for 20 s, 40 cycles at 95 °C for 1 s, 60 °C for 20 s, 95 °C for 15 s, 60 °C 1 min, and a gradient from 60 °C to 95 °C for 15 min. Raw results were processed using the ViiA™ 7 Software and exported into Microsoft Excel for further analyses. The reference gene used was the tubulin gamma chain (TUB G) designed using sequence information from the transcriptome and the software Primer3Plus v.2.4.2 ([71 (link)]). The sequences for the forward and reverse primers are 5’- TGCAGAGTTTGGTCGATGAG -3’and 5’-GGAAGCCAAAGAGTCTGCTG-3’, respectively, yielding a PCR product of 197 bp (Table S5). Primers for all other tested DEGs were designed using the same approach. log2(FC)s were obtained with the Relative Expression Software Tool-Multiple Condition Solver (REST-MCS) ([72 (link)]). A pairwise fixed reallocation randomisation test has been used to identify statistically significant results (P ≤ 0.05).
Pelusi A., Ambrosino L., Miralto M., Chiusano M.L., Rogato A., Ferrante M.I, & Montresor M. (2023). Gene expression during the formation of resting spores induced by nitrogen starvation in the marine diatom Chaetoceros socialis. BMC Genomics, 24, 106.
Full text: Click here
Publication 2023
Cells DNA, Complementary DNA, Ribosomal Fast Green Gamma Rays Genes Membrane Transport Proteins NADH-Nitrate Reductase Nitrates Nitrate Transporter Nutrients Oligonucleotide Primers Reverse Transcription Ribosome Subunits, Large RNA-Seq Silicon Spores Strains Transcriptome Tubulin
4
Western Blot Analysis of Caco2 Cells
The transfected control Caco2 cells were lysed in RIPA buffer (150 mM NaCl; 50 mM Tris-Cl, pH 8; 1% NP-40; 0.5% deoxycholate; 0.1% SDS) (Beyotime, Shanghai, China) with Protease Inhibitor Cocktail (100×) (Thermo Scientific, MA, USA). The resulting samples were separated using 10% SDS-PAGE (Invitrogen, Carlsbad, CA, USA) and transferred to polyvinylidene fluoride (PVDF) membranes. After blocking for 1 h in 5% non-fat milk in TBST at 25°C, the membranes were incubated overnight at 4 °C with specific primary antibodies, including SMARCE1 (Abcam, Cambridge, UK, 1:1000), tfec (Santa Cruz, USA,1:500), and β-tubulin (Sigma, USA, 1:10,000). Primary antibody binding was visualized using horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse IgG (Sigma, USA, 1:10,000) for 1 h at 25°C. Signal intensities were measured using a Chemiluminescent HRP substrate (Yamei, Shanghai, China) and imaged using ImageJ v1.8.0 (NIH, Bethesda, MD, USA).
Tang C.Y., Zhang X., Xu X., Sun S., Peng C., Song M.H., Yan C., Sun H., Liu M., Xie L., Luo S.J, & Li J.T. (2023). Genetic mapping and molecular mechanism behind color variation in the Asian vine snake. Genome Biology, 24, 46.
Full text: Click here
Publication 2023
anti-IgG Antibodies Buffers Caco-2 Cells Deoxycholate Goat Immunoglobulins Milk, Cow's Mus Nonidet P-40 polyvinylidene fluoride Protease Inhibitors Rabbits Radioimmunoprecipitation Assay SDS-PAGE SMARCE1 protein, human Sodium Chloride Tissue, Membrane Tromethamine Tubulin
5
Immunolabeling of Neuronal Cytoskeleton
Neurons were seeded on poly-L-lysine-coated #1.5 coverslips (633029; Carolina Biological Supply). At indicated timepoints, coverslips were briefly washed in Dulbecco’s PBS with calcium and magnesium (PBL02; Caisson Labs), and fixed for 15 min with 4% paraformaldehyde (diluted in PBS from 16%, Electron Microscopy Services, 15710) and 4% sucrose in PBS at 37°C. For immunolabeling of fascin, coverslips were washed and fixed for 10 min with ice-cold methanol at −20°C. Subsequent steps were performed at room temperature. Autofluorescence was quenched by incubation with 50 mM NH4Cl for 10 min at room temperature. Coverslips were blocked and permeabilized using a buffer of 10% goat serum and 0.1% Triton X-100 in PBS and incubating for 30 min. Antibodies were diluted in a buffer of 3% goat serum and 0.1% Triton X-100 in PBS. Coverslips were incubated with primary antibodies for 1 h, washed three times in PBS with 0.1% Tween-20, and incubated with secondary antibodies and Alexa Fluor 488 phalloidin (A12379; Thermo Fisher Scientific, 1:40) for 30 min. Coverslips were mounted using Prolong Gold Antifade (P36930; Thermo Fisher Scientific), and allowed to cure for at least 24 h prior to imaging. Antibodies used were as follows: mouse monoclonal anti-Arp2/3 complex (#MABT95; Millipore, RRID:AB_11205567; 1:250), mouse monoclonal anti-fascin (#54545; Cell Signaling Technology, RRID:AB_2799464; 1:50), rabbit monoclonal anti-β-III-tubulin (#5568; Cell Signaling, Clone D71G9, RRID:AB_10694505; 1:100), rabbit monoclonal anti-MAP2 (#8707; Cell Signaling, Clone D5G1, RRID:AB_2722660; 1:500), goat anti-rabbit Alexa Fluor 568 (#A-11011; Molecular Probes, RRID:AB_143157; 1:1,000), goat anti-rabbit Alexa Fluor 647 (#A-21245; Thermo Fisher Scientific, RRID:AB_2535813; 1:1,000).
Parker S.S., Ly K.T., Grant A.D., Sweetland J., Wang A.M., Parker J.D., Roman M.R., Saboda K., Roe D.J., Padi M., Wolgemuth C.W., Langlais P, & Mouneimne G. (2023). EVL and MIM/MTSS1 regulate actin cytoskeletal remodeling to promote dendritic filopodia in neurons. The Journal of Cell Biology, 222(5), e202106081.
Full text: Click here
Publication 2023
Actin-Related Protein 2-3 Complex alexa 568 alexa fluor 488 Alexa Fluor 647 Antibodies Biopharmaceuticals Buffers Calcium Clone Cells Cold Temperature Electron Microscopy fascin Goat Gold Lysine Magnesium MAP2 protein, human Methanol Molecular Probes Mus Neurons paraform Phalloidine Poly-5 Rabbits Serum Sucrose Triton X-100 Tubulin Tween 20

Top products related to «Tubulin»

1
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
2
Tubulin by Merck Group
Sourced in United States, United Kingdom, Germany, China, Canada, Israel, Italy, Switzerland
Tubulin is a protein that is a major component of the cytoskeleton in eukaryotic cells. It is the building block of microtubules, which play a crucial role in cellular structure and function.
3
Anti tubulin by Merck Group
Sourced in United States, United Kingdom, Germany, Italy, China, France, Switzerland, Canada, Japan, Sao Tome and Principe
Anti-tubulin is a laboratory reagent used to study the structure and function of microtubules, which are essential components of the cytoskeleton in eukaryotic cells. It functions by binding to tubulin, the structural protein that makes up microtubules, and inhibiting their polymerization or depolymerization, depending on the specific anti-tubulin compound used.
4
β tubulin by Cell Signaling Technology
Sourced in United States, United Kingdom, Germany, Sweden, Canada, Macao, Japan, China
β-tubulin is a structural protein that is a key component of microtubules, which are important cytoskeletal structures within cells. It plays a crucial role in cellular processes such as cell division, intracellular transport, and cell motility.
5
β tubulin by Merck Group
Sourced in United States, United Kingdom, Germany, Canada, Macao, China, Spain, Sao Tome and Principe, Morocco, New Zealand, Sweden
β-tubulin is a structural protein that plays a crucial role in the formation of microtubules. Microtubules are cytoskeletal filaments essential for various cellular processes, such as cell division, intracellular transport, and cell motility. β-tubulin is a key component of the microtubule structure and is widely used in research applications to study and analyze these cellular functions.
6
Protease inhibitor cocktail by Roche
Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel
Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.
7
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
8
4 6 diamidino 2 phenylindole (dapi) by Merck Group
Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore
DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.
9
β actin by Merck Group
Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Macao, Italy, Sao Tome and Principe, Israel, Spain, Denmark, France, Finland, Australia, Morocco, Ireland, Czechia, Sweden, Uruguay, Switzerland, Netherlands, Senegal
β-actin is a protein that is found in all eukaryotic cells and is involved in the structure and function of the cytoskeleton. It is a key component of the actin filaments that make up the cytoskeleton and plays a critical role in cell motility, cell division, and other cellular processes.
10
Tubulin by Cell Signaling Technology
Sourced in United States, China, United Kingdom
Tubulin is a structural protein that forms the cytoskeleton of cells. It is a key component of microtubules, which are essential for cellular processes such as cell division, intracellular transport, and cell motility.

More about "Tubulin"

Tubulin is a critical structural protein found in the cytoskeleton of eukaryotic cells.
It is the major component of microtubules, which play a crucial role in various cellular processes such as cell division, intracellular transport, and cell motility.
Tubulins are heterodimeric proteins composed of alpha and beta subunits, which polymerize to create the hollow, cylindrical microtubule structures.
Tubulin is an essential protein for a wide range of cellular activities, making it an important area of study for scientists working to unravel the complexities of cell biology.
Researchers have been actively investigating the dynamics of tubulin and its interactions with other cellular components, as it is the target of many anti-cancer drugs.
In addition to tubulin, other important proteins and materials are often utilized in cell biology research.
PVDF membranes are commonly used for protein detection and Western blotting analysis. β-tubulin is a specific isoform of the tubulin protein that is frequently used as a reference or housekeeping protein in experiments.
Protease inhibitor cocktails help preserve the integrity of cellular proteins, while TRIzol reagent is a popular tool for RNA extraction.
DAPI, a fluorescent dye, is often used to stain and visualize the cell nucleus, and β-actin is another common housekeeping protein used in cellular studies.
By understanding the role of tubulin and its related proteins and materials, researchers can gain valuable insights into the intricate workings of the cell, which may ultimately lead to advancements in areas such as cell biology, pharmacology, and cancer research.
The AI-driven platform PubCompare.ai can assist scientists in optimizing their tubulin research by providing access to a wealth of scientific protocols and resources, enabling them to identify the best experimental approaches and products for their studies.