Protocol full text hidden due to copyright restrictions
Open the protocol to access the free full text link
THbs114 GAGGTTTTGGTGTTTATTAAA;
THbas308 TAAAATCTAATTACCTTCACTCC;
THbs566 TGTTAAGTAGGTAGAGGTTATTAT; and
THbas827 AACCTAAAAAAAACACACAC.
Example 3
Effectiveness of Newly Evolved TpH Background Strain Using Schistosoma mansoni TpH
One of the 7 evolved high 5HTP-producers was selected to further evaluate if the mutations identified were only specifically beneficial to hsTpH2 or could be widely applicable to others. The chosen evolved strain was first cured to lose the evolution plasmid (e.g. the hsTpH gene) and this was immediately followed by re-introducing the E. coli tyrA gene. Upon restoration of the strain's tyrosine auxotrophy, the resulting strain was transformed with pHM2, which is identical to pHM1 used in the earlier evolution study except that the hsTpH gene was replaced with a Schistosoma mansoni TpH gene (SEQ ID NO:9). The 5HTP production of the resulting strain was compared to a wild-type strain carrying pHM2 in the presence of 100 mg/l tryptophan. Results showed the wild-type transformants could only produce ˜0.05 mg/l 5HTP while the newly evolved background strain transformants accumulated >20 mg/l. These production results demonstrated that the mutations acquired in the evolved background strain were not only beneficial to hsTpH but also to other TpHs; possibly applicable also to other aromatic amino acid hydroxylases (e.g. tyrosine hydroxylase).
Example 5
In examples of the invention, a bisBIA-producing yeast strain, that produces bisBlAs such as those generated using the pathway illustrated in (A), is engineered by integration of a single construct into locus YDR514C. Additionally,
The construct includes expression cassettes for P. somniferum enzymes 6OMT and CNMT expressed as their native plant nucleotide sequences. A third enzyme from P. somniferum, CPR, is codon optimized for expression in yeast. The PsCPR supports the activity of a fourth enzyme, Berberis stolonifera CYP80A1, also codon optimized for expression in yeast. The expression cassettes each include unique yeast constitutive promoters and terminators. Finally, the integration construct includes a LEU2 selection marker flanked by loxP sites for excision by Cre recombinase.
A yeast strain expressing Ps6OMT, PsCNMT, BsCYP80A1, and PsCPR is cultured in selective medium for 16 hours at 30° C. with shaking. Cells are harvested by centrifugation and resuspended in 400 μL breaking buffer (100 mM Tris-HCl, pH 7.0, 10% glycerol, 14 mM 2-mercaptoethanol, protease inhibitor cocktail). Cells are physically disrupted by the addition of glass beads and vortexing. The liquid is removed and the following substrates and cofactors are added to start the reaction: 1 mM (R,S)-norcoclaurine, 10 mM S-adenosyl methionine, 25 mM NADPH. The crude cell lysate is incubated at 30° C. for 4 hours and then quenched by the 1:1 addition of ethanol acidified with 0.1% acetic acid. The reaction is centrifuged and the supernatant analyzed by liquid chromatography mass spectrometry (LC-MS) to detect bisBlA products berbamunine, guattegaumerine, and 2′-norberbamunine by their retention and mass/charge.
Notifications