Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Ubiquitin-Conjugating Enzymes

Ubiquitin-Conjugating Enzymes

Ubiquitin-Conjugating Enzymes are a class of enzymes that catalyze the covalent attachment of ubiquitin to target proteins, marking them for degradation or other cellular processes.
This AI-powered tool from PubCompare.ai helps researchers easily locate protocols from literature, pre-prints, and patents related to Ubiquitin-Conjugating Enzymes.
The powerful analysis tools enable identification of the best protocols and products to improve your experiments and enhance research reproducibility.
Leverage the AI-driven comparisons to streamline your Ubiquitin-Conjugating Enzymes research workflows.

Most cited protocols related to «Ubiquitin-Conjugating Enzymes»

1
Evaluation of Watermelon Reference Genes
Cited 25 times
A total of 15 candidate reference genes were evaluated. These genes were chosen based on their previous use in watermelon or their validation as best reference genes in other crops, including 18S ribosomal RNA (18SrRNA), β-actin (ACT), clathrin adaptor complex subunit (CAC), elongation factor 1-α (EF1α), glyceraldehy-3-phosphate-dehydrogenase (GAPDH), NADP-isocitrate dehydrogenase (IDH), leunig (LUG), protein phosphatase 2A regulatory subunit A (PP2A), polypyrimidine tract-binding protein 1 (PTB), ribosomal protein S (RPS2), SAND family protein (SAND), α-tubulin (TUA), ubiquitin-conjugating enzyme E2 (UBC2), ubiquitin carrier protein (UBCP), and yellow-leaf-specific proein8 (YLS8).
For each candidate reference gene, blastn was carried out in the Cucurbit Genomics Database (http://www.icugi.org) against watermelon coding DNA sequences (CDS) (v1) using Arabidopsis homolog as a query. The CDS of the best hit was retrieved and uploaded to Primer3Plus (http://primer3plus.com/cgi-bin/dev/primer3plus.cgi) for primer design. The product size was set at the range of 80 bp to 150 bp. The forward and reverse primers were intentionally targeted on the adjoining exons, which were separated by an intron. The generated primer pair for each gene was then aligned against all watermelon CDS to confirm its specificity in silico. The specificity of the PCR amplification product for each primer pair was further determined by electrophoresis in 2% agarose gel and melting curve analysis. Finally, the watermelon species name abbreviation of ‘Cl’ was added as a prefix to the specificity-validated gene to specify the watermelon orthologous gene. For more comparable results, the primer pair of 18SrRNA, which was previously published, was used in this study [2] (link). Data on the selected reference genes and their amplification characters are listed in Table 1.
Kong Q., Yuan J., Gao L., Zhao S., Jiang W., Huang Y, & Bie Z. (2014). Identification of Suitable Reference Genes for Gene Expression Normalization in qRT-PCR Analysis in Watermelon. PLoS ONE, 9(2), e90612.
Full text: Click here
Publication 2014
Actins Agricultural Crops alpha-Tubulin Arabidopsis Character Clathrin Adaptors EEF1A2 protein, human Electrophoresis Exons Genes Genes, vif Introns Isocitrate Dehydrogenase (NAD+) Isocitrates NADP NADPH Dehydrogenase Oligonucleotide Primers Open Reading Frames Oxidoreductase Phosphates Phosphoric Monoester Hydrolases Plant Leaves Polypyrimidine Tract-Binding Protein PPP2R4 protein, human Protein S Proteins Protein Subunits Ribosomes RNA, Ribosomal, 18S Sepharose Staphylococcal Protein A Ubiquitin-Conjugating Enzymes Watermelon
2
Fluorescent Differential PCR for GLI Gene Dosage
Cited 22 times
Gene dosage of GLI was analysed by Fluorescent Differential PCR employing FAM labelled oligonucleotide primers [18 (link)]. Two reference loci were also used: exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) at 7q31 and ubiquitin-conjugating enzyme pseudogene (UBE2L2) at 12q12. PCR amplification was carried out in 30 μl 10 mM Tris-HCl buffer, pH 9.0, containing 50 mM KCl, 0.1% (v/v) Triton X-100, 1.5 mM MgCl2, 0.2 mM dNTPs, 5 μM of each primer for UBE2L2 and CFTR, 100 ng of genomic DNA, 7.5 μM of the GLI primers and 2 units Taq DNA polymerase. PCR conditions consisted of an initial denaturation step of 95°C for 5 minutes, followed by 24 cycles of 95°C for 1 minute, 58°C for 1 minute and 72°C for 1 minute, with a final extension of 72°C for 10 minutes. A PCR using human genomic DNA as a control was routinely run in parallel. Moreover, experiments were performed in triplicate to ensure reproducibility of the technique. The FAM labelled products were separated through a denaturing polyacrylamide gel on an ABI 377 fragment analyser (PE Applied Biosystems). Quantitative analysis of the PCR products was performed using Genescan 672 software© (PE Applied Biosystems). GLI gene dosage was calculated by comparing the ratios of GLI to reference gene peak areas generated by control DNA with those generated by the cell line DNAs, as described [18 (link)]. Primer sequences were as follows: GLI-F-d TGA TGC AGT TCC TTT ATT ATC AGG; GLI-R-(FAM)-d AGA GTA GGG AAT CTC ATC CAT CA, giving a product of 200 bp. UB-F(FAM)-d CGA AGA GCA CAC TTA AAG ATC TG; Ub-R-d GGT CAG CCT-GAA GTG GAT GCT CA generating a 173 bp product. CFTR19-F-dCCT ACC AAG TCA ACC AAA CC; CFTR19-R(FAM)-dACA TTG CTT CAG GCT ACT GG; generating a product of 268 bp.
Ponchel F., Toomes C., Bransfield K., Leong F.T., Douglas S.H., Field S.L., Bell S.M., Combaret V., Puisieux A., Mighell A.J., Robinson P.A., Inglehearn C.F., Isaacs J.D, & Markham A.F. (2003). Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions. BMC Biotechnology, 3, 18.
Publication 2003
Cell Lines CFTR protein, human DACA, acridine DNA Exons Genes Genome Genome, Human Magnesium Chloride Oligonucleotide Primers polyacrylamide gels Pseudogenes Taq Polymerase Triton X-100 Tromethamine Ubiquitin-Conjugating Enzymes
3
Grapevine Reference Genes Selection
Cited 8 times
Eleven candidate genes were selected based on previous studies in Arabidopsis[33] (link) and grapevine [2] (link), [26] (link), [28] (link), [29] (link), [33] (link), [34] (link). Nine of these genes were formerly described as reference genes for grapevine downy mildew pathosystem in later inoculation time-points (1–7 days post-inoculation): V-type proton ATPase 16 kDa proteolipid subunit (VATP16), 60 S ribosomal protein L18 (60S), Ubiquinol-cytochrome c reductase complex chaperone (UQCC), Small nuclear ribonucleoprotein SMD3 (SMD3) from Gamm et al. [28] (link); Elongation factor 1α (EF1α) from Trouvelot et al. [34] (link), Ubiquitin-conjugating enzyme (UBQ) and SAND family protein (SAND) from Reid et al. [26] (link), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Selim et al. [29] (link) and Actin (ACT) from Figueiredo et al. [2] (link). The other two gene homologous to Arabidopis polypyrimidine tract-binding protein 1 (AT3g01150) and D1 subunit of photosystem I and II reaction centers (ATCg00340) [33] (link), were retrieved from the grapevine TIGR database v. 8 as PTB2 protein (TC109121) and PsaB (TC134081), respectively. Grapevine specific primers were designed with Primer Express software version 3.0 (Applied Biosystems, Sourceforge, USA) using the following parameters: amplicon length between 75 and 250 bp; size: 20±2 bp; melting temperature (Tm): 60±2 °C; GC content: ±50%.
Monteiro F., Sebastiana M., Pais M.S, & Figueiredo A. (2013). Reference Gene Selection and Validation for the Early Responses to Downy Mildew Infection in Susceptible and Resistant Vitis vinifera Cultivars. PLoS ONE, 8(9), e72998.
Full text: Click here
Publication 2013
Actins Arabidopsis EEF1A2 protein, human Electron Transport Complex III Genes Glyceraldehyde-3-Phosphate Dehydrogenases Lanugo Molecular Chaperones Oligonucleotide Primers Photosystem I Polypyrimidine Tract-Binding Protein Proteins Protein Subunits Proteolipids Protons ribosomal protein L18 Small Nuclear Ribonucleoproteins Ubiquitin-Conjugating Enzymes Vaccination Vacuolar H+-ATPase
4
Transfection and Reporter Assay for Androgen Receptor Activity
Cited 7 times
PC-3 and HEK-293T cells were transfected by using the TransIT-2020 (Mirus Bio LLC) and TurboFect reagents (Thermo Scientific), respectively, per instruction of the manufacturer. DU145, C4-2, and LNCaP cells were transfected by using the Lipofectamine 2000 and Plus reagent (Invitrogen) as described (27 (link)). Reporter gene assay was performed as previously described (28 (link)) with either an androgen-responsive element-luciferase plasmid (ARE-luc) containing three ARE regions ligated in tandem to the luciferase reporter or a luciferase construct driven by three repeats of an AR-V-specific promoter element of the ubiquitin-conjugating enzyme E2C (UBE2C) gene (UBE2C-luc). To ensure an even transfection efficiency, we conducted the transfection in bulk, and then split the transfected cells for luciferase assay.
Xu D., Zhan Y., Qi Y., Cao B., Bai S., Xu W., Gambhir S.S., Lee P., Sartor O., Flemington E.K., Zhang H., Hu C.D, & Dong Y. (2015). Androgen receptor splice variants dimerize to transactivate target genes. Cancer research, 75(17), 3663-3671.
Publication 2015
Androgens Argon Biological Assay Dietary Fiber Genes Genes, Reporter HEK293 Cells lipofectamine 2000 Luciferases Plasmids Transfection UBE2C protein, human Ubiquitin-Conjugating Enzymes
5
Spatial Expression Analysis of BraMAPK Genes
Cited 5 times
To investigate the spatial expression patterns of BraMAPK genes, the RNA-seq data were downloaded from the NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) under accession number GSE43245. The gene expression levels were quantified as FPKM (fragments per kilobase of exon per million fragments mapped) values by the TopHat/Cufflinks pipeline in the previous report [66 (link),67 (link)]. The log2-transformed (FPKM + 1) values of the 32 BraMAPK genes were used for heat map generation.
To determine the expression profiles of BraMAPK genes in the second youngest leaves sampled from treated and control plants, quantitative real-time PCR (qRT-PCR) was performed using SYBR Premix Ex Taq II (Perfect Real Time) (TaKaRa, Dalian, China) in a CFX96 real-time PCR system (Bio-Rad, USA) with the following conditions: 95°C for 2 min and then 40 cycles of 95°C for 10 s, annealing for 30 s with designated temperature listed in S2 Table, and 72°C for 20 s. Gene-specific primers were designed using Geneious Pro 4.8.5 software with previously described parameters [59 ,68 (link)]. Using gradient PCR with the cDNA as template, the highest feasible annealing temperatures of primer pairs were determined and listed in S2 Table. To ensure primer specificity a BLASTN search against the whole B. rapa genome was performed, and agarose gel electrophoresis and melting curve analysis ensured that only one product was amplified. Three technical replicate reactions were implemented at each time point. All the qRT-PCR assays were repeated three times. Two endogenous housekeeping genes, B. rapa UBC21 (ubiquitin conjugating enzyme 21) and GAPDH (glyceraldehyde-3-phosphate dehydrogenase), were used for normalization and quantification of fold changes of BraMAPK genes using the 2–ΔΔCT method [69 (link)–71 (link)]. Genes with (1) ΔΔCt values of > 1 or < -1 and (2) p-value < 0.05 (determined by two-tailed Student's t-test) were considered as being significantly regulated. The sub-functionalization of duplicated members in the same BraMAPK gene subfamily were statistically measured by two-way analysis of variance (ANOVA).
To verify the consistency of expression levels of BraMAPK genes in leaves between qRT-PCR and RNA-seq methods, and compare the expression patterns of MAPK genes between B. rapa and Arabidopsis, the expression data of AtMAPK genes were obtained from AtGenExpress (http://www.weigelworld.org/resources/microarray/AtGenExpress) databases [72 (link)]. The relative expression levels of BraMAPK genes in leaves after 0 h of mock treatment in qRT-PCR analysis were calculated as Ct(IC)-Ct(X) ('Ct' stands for cycle number; 'IC' stands for two internal control genes; 'X' stands for BraMAPK genes), while those in RNA-seq analysis were calculated as Log2 (FPMK + 1) transformed expression value ((IC)-(X)). In Arabidopsis, the relative expression levels of AtMAPK genes in leaves were calculated as Log2 transformed expression value ((IC)-(X)) ('X' stands for AtMAPK genes). All the Pearson correlation coefficients were estimated by using SPSS 21 (IBM SPSS Statistics, IBM Corporation).
Lu K., Guo W., Lu J., Yu H., Qu C., Tang Z., Li J., Chai Y, & Liang Y. (2015). Genome-Wide Survey and Expression Profile Analysis of the Mitogen-Activated Protein Kinase (MAPK) Gene Family in Brassica rapa. PLoS ONE, 10(7), e0132051.
Full text: Click here
Publication 2015
Arabidopsis Biological Assay DNA, Complementary DNA Replication Electrophoresis, Agar Gel Exons Fever GAPDH protein, human Gene Expression Gene Expression Regulation Genes Genes, Housekeeping Genome Glyceraldehyde-3-Phosphate Dehydrogenases Microarray Analysis Oligonucleotide Primers Plants Quantitative Real-Time Polymerase Chain Reaction Real-Time Polymerase Chain Reaction RNA-Seq Ubiquitin-Conjugating Enzymes

Most recents protocols related to «Ubiquitin-Conjugating Enzymes»

1
Robust RNA Extraction and qPCR Analysis
Approximately 50 mg of powdered fresh tissue was weighed out for RNA extraction using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions, with an on-column DNAse I digestion. RNA concentration was determined spectrophotometrically with Nanodrop at 260 nm (ND1000, Thermo Fisher Scientific, Waltham, MA, USA) with a desired ratio of 260/280 ∼ 2.0 and 260/230 ∼ 2.0-2.3. Additionally, the quality of selected RNA samples was checked using the bioanalyzer (2100 bioanalyzer, Agilent Technologies). A RIN value of ≥ 7.3 was accepted for further usage. The cDNA was synthesized with the SuperScript III reverse transcriptase (Thermo Fisher Scientific, Waltham, MA, USA) and oligo (dT)12−18 primers as described by the manufacturer using 250 ng total RNA. Primers for target and reference genes were designed using sequences available at Phytozome or NCBI (National Center for Biotechnology Information; Table S4). The primer amplification efficiencies were determined with cDNA dilution analysis. Detailed information about primer sequences and efficiencies can be found in Table S3. The stability of selected reference genes (actin 7, ubiquitin-conjugating enzyme E2 A and elongation factor 1-alpha) was checked (M value <0.5; coefficient variance <0.25). The RT-qPCR experiments were performed in triplicates using 3 μL diluted cDNA (1:10), 5 μL 2× SensiMix SYBR Low-ROX (Bioline, Luckenwalde, Germany) and 2 μL of 2 μM primer. Experiments were conducted with a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with the following thermal cycling conditions: 95°C for 10 min, 39 cycles of 95°C for 15 s, 58°C for 15 s followed by 72°C for 30 s and a subsequent melting curve analysis. For the analysis of CCD4 and OR family genes, an adjusted annealing temperature of 60°C was used. Data were evaluated using the ΔΔCq method according to Vandesompele et al. (2002) (link); Pfaffl (2004) with the geometric mean of the three reference genes. The expression of genes of interest were calculated as n-fold changes relative to gene expression in the lettuce samples grown without polytunnels.
Harbart V., Frede K., Fitzner M, & Baldermann S. (2023). Regulation of carotenoid and flavonoid biosynthetic pathways in Lactuca sativa var capitate L. in protected cultivation. Frontiers in Plant Science, 14, 1124750.
Full text: Click here
Publication 2023
Actins Deoxyribonuclease I Digestion DNA, Complementary EEF1A2 protein, human Gene Expression Genes Lactuca sativa Oligonucleotide Primers Oligonucleotides RNA-Directed DNA Polymerase Technique, Dilution Tissues Ubiquitin-Conjugating Enzymes
2
RNA Extraction, Transcriptome Analysis, and qPCR Validation
Total RNA was extracted and purified using the E.Z.N.A.™ Plant RNA kit (OMEGA, Norcross, GA, USA). The purity of the extracted RNA was checked using the NanoDrop ND-1000 spectrophotometer (LabTech, Beijing, China). Only RNA samples with an A260/A280 ratio between 1.9 and 2.1 and an A260/A230 ratio greater than 2.0 were used for the subsequent analyses. Additionally, RNA integrity was assessed by 1.2% agarose gel electrophoresis. De novo transcriptome assembly and annotation (as described by Illumina) were completed by Gene Denovo Biotechnology Co., Ltd. (Guangzhou, China).
Principal component analysis (PCA) analysis is an unsupervised multi-dimensional statistical analysis method that can generally reflect the overall expression difference among samples of each group and the variation degree between samples in the group. To detect differences in gene expression patterns among samples, the “fast.prcomp” function in R (http://www.r-project.org/) was used to perform a PCA of all transcriptomic datasets of six groups (control and 1-day and 4-day LI treatments). The unigene expression levels were compared between two samples after the expression levels of all unigenes were calculated. The false discovery rate (FDR) was used to determine the threshold p-value for multiple tests. The following criteria were used to identify differentially expressed genes (DEGs): FDR ≤ 0.001 and a log2|fold-change| ≥ 1. To verify the transcription levels determined by RNA-seq, 12 unigenes were randomly selected from among the DEGs for quantitative PCR analysis, with PhUBC (encoding a P. haitanensis ubiquitin-conjugating enzyme) selected as the housekeeping gene [19 (link)]. Specific primer information is provided in Supplementary Table S1.
Ji D., Zhang Y., Zhang B., Xu Y., Xu K., Chen C, & Xie C. (2023). Investigating the Mechanisms Underlying the Low Irradiance-Tolerance of the Economically Important Seaweed Species Pyropia haitanensis. Life, 13(2), 481.
Full text: Click here
Publication 2023
Electrophoresis, Agar Gel Gene Expression Gene Expression Profiling Genes Genes, Housekeeping Oligonucleotide Primers RNA, Plant RNA-Seq Transcription, Genetic Transcriptome Ubiquitin-Conjugating Enzymes
3
Screening of Reference Genes in Garlic
The nine candidate genes that were selected for screening based on their role as reference genes in other plants were aligned with the garlic transcriptome established by our group, including ACT(Actin), EF1(elongationfactor1), UBC-E2(Ubiquitin-conjugating enzyme-E2), GAPDH(Glyceraldehyde-3-phosphatedehydrogenase), HIS3 (Histone H3), RPS5(ribosomalprotein S5), UBC(Ubiquitin-conjugating enzyme), UBQ(Polyubiquitin), 18S rRNA(18S ribosomal RNA). All RT-qPCR primers were designed with the Primer 5.0.
Wang Q., Guo C., Yang S., Zhong Q, & Tian J. (2023). Screening and Verification of Reference Genes for Analysis of Gene Expression in Garlic (Allium sativum L.) under Cold and Drought Stress. Plants, 12(4), 763.
Full text: Click here
Publication 2023
Actins GAPDH protein, human Garlic Genes Genes, Plant Glyceraldehyde Histone H3 Oligonucleotide Primers Polyubiquitin RNA, Ribosomal, 18S Transcriptome Ubiquitin-Conjugating Enzymes
4
Nanostring-based Gene Expression Analysis
Gene expression was determined using the Plexset® platform from NanoString Technologies Inc. (Seattle, WA, USA), and results were analysed using the nSolver™ 4.0 software (Seattle, WA, USA). Four reference genes and eight target genes were used for the gene expression analysis (Table S1).
The eukaryotic small ribosomal subunit 40S (40S), ubiquitin-conjugating enzyme (UBC), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and the protein phosphatase 2 (PP2A) genes were used as reference genes. The pathogenesis-related protein family 1 (PR1), APETALA2 ethylene responsive factor 2 (AP2_ERF2), Glucan endo-1,3-β-glucosidase (PR2), thaumatin-like protein TG4 (PR5), NIM-interacting protein 2 (NIMIN2), downy mildew resistance 6 (DMR6), WRKY transcription factor 70 (WRKY70i), and benzyl alcohol dehydrogenase (BAD) were used as target genes. The two 50 bp long probes needed for each gene when using the Nanostring technologies were described previously [8 (link)]) (Table S1) except for DMR6 and WRKY70i, for which the capture probes were:
ACGCCCTCACAATTTTGCTTCAGGACCTCCAAGTCTCAGGCCTACAAGTC and TGGAGGAAATATGGACAAAAGGAGATCCTCAATGCCAAATTTCCAAGGTG and the reporter probes were:
CTCAAGGACGGCAAGTGGATGGCCGTCAAACCCCATCCCAATGCCTTTGT and CTACTTTAGGTGCACACACAAGCCTGATCAAGGTTGCCTAGCAACAAAGC, respectively.
All the probes were synthesised by Integrated DNA Technologies Limited (IDT, Singapore). Total RNA was prepared from approximately 100 mg of ground kiwifruit tissue using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, Auckland, New Zealand), following the supplier’s recommendations. Sample purity and RNA concentrations were determined using a Nanophotometer® (Implen, CA, USA). RNA samples were sent at −80 °C to the Grafton Clinical Genomics of the School of Medical Science, University of Auckland, for processing.
Reglinski T., Vanneste J.L., Schipper M.M., Cornish D.A., Yu J., Oldham J.M., Fehlmann C., Parry F, & Hedderley D. (2023). Postharvest Application of Acibenzolar-S-Methyl Activates Salicylic Acid Pathway Genes in Kiwifruit Vines. Plants, 12(4), 833.
Full text: Click here
Publication 2023
Actinidia deliciosa benzyl alcohol dehydrogenase beta-Glucosidase endometriosis protein-1 Ethylenes Eukaryotic Cells Gene Expression Gene Expression Profiling Genes Glucans Glyceraldehyde-3-Phosphate Dehydrogenases Lanugo pathogenesis Protein Phosphatase 2A Proteins Ribosome Subunits, Small RNA, Plant Tissues Transcription Factor Ubiquitin-Conjugating Enzymes
5
Quantifying Relative Gene Expression Using RT-qPCR
Total RNA was isolated with an RNAprep Pure Plant Plus kit (Tiangen Biotech, China) and used as the template for reverse transcription with a PrimeScript RT reagent kit (TaKaRa, Japan). The RT-qPCR assays were performed using the UltraSYBR Mixture (Cwbio, China). The cotton GhSSU (small subunit ribosomal rRNA) gene, the Arabidopsis AtUBC21 (Ubiquitin-Conjugating Enzyme 21) gene, and the N. benthamiana and V. dahliaeEF-1α (Elongation Factor-1α) genes were used as internal controls. The setting of thermal cycler was: predenaturation at 95°C for 10 min, followed by 40 cycles of denaturing at 95°C for 15 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. A final reaction at 72°C for 10 min was applied. Melt curves were analyzed to ensure there was not nonspecific amplification. Relative transcript levels among various samples were determined using the 2–ΔΔCT method, with three independent determinations (58 (link)). The sequences of primers used in this study are listed in Table S4.
Li C., Qin J., Huang Y., Shang W., Chen J., Klosterman S.J., Subbarao K.V, & Hu X. (2023). Verticillium dahliae Effector VdCE11 Contributes to Virulence by Promoting Accumulation and Activity of the Aspartic Protease GhAP1 from Cotton. Microbiology Spectrum, 11(1), e03547-22.
Publication 2023
Arabidopsis Biological Assay EEF1A2 protein, human Genes Gossypium Oligonucleotide Primers Plants Protein Subunits Reverse Transcription Ribosomal RNA Genes Ribosomes Ubiquitin-Conjugating Enzymes

Top products related to «Ubiquitin-Conjugating Enzymes»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Rneasy plant mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, China, Japan, Canada, Spain, France, Australia, Italy, India, Sweden
The RNeasy Plant Mini Kit is a laboratory equipment designed for the isolation and purification of total RNA from plant tissues and cells. It utilizes a silica-membrane-based technology to efficiently capture and purify RNA molecules, enabling subsequent analysis and downstream applications.
3
Sybr premix ex taq kit by Takara Bio
Sourced in Japan, China, United States, Germany, Switzerland, United Kingdom, Australia, Canada, France
The SYBR Premix Ex Taq kit is a real-time PCR reagent designed for sensitive and reliable quantification of DNA or cDNA targets. It contains a hot-start DNA polymerase, SYBR Green I dye, and optimized buffer components for efficient amplification and detection.
4
Reverse transcription system by Promega
Sourced in United States, China, Germany, Spain, Japan, United Kingdom, France, Netherlands
The Reverse Transcription System is a laboratory tool designed to convert RNA into complementary DNA (cDNA) for various downstream applications. This system provides the necessary components, including reverse transcriptase enzyme, buffer, and other essential reagents, to facilitate the reverse transcription process.
5
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
6
Superscript 3 by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Australia, Canada, China, France, Spain, Netherlands, Lithuania, Switzerland, Belgium, Italy
Superscript III is a reverse transcriptase enzyme produced by Thermo Fisher Scientific. It is designed for cDNA synthesis from RNA templates during the process of reverse transcription.
7
Revertaid reverse transcriptase by Thermo Fisher Scientific
Sourced in United States, Germany, Lithuania, United Kingdom, Canada, China, Brazil, France, Denmark, Japan, Australia, Poland
RevertAid Reverse Transcriptase is an enzyme used in the process of reverse transcription, which involves the conversion of RNA into complementary DNA (cDNA). It catalyzes the synthesis of first-strand cDNA from an RNA template.
8
Ubiquitin activating enzyme e1 by R&D Systems
Ubiquitin-activating enzyme E1 is a laboratory product that plays a crucial role in the ubiquitin-proteasome system. It catalyzes the first step in the ubiquitination process, which is the covalent attachment of ubiquitin to target proteins, marking them for degradation by the proteasome.
9
High capacity cdna reverse transcription kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia
The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.
10
Iq sybr green supermix by Bio-Rad
Sourced in United States, Germany, Italy, Canada, France, China, United Kingdom, Belgium, Switzerland, Singapore, Australia, Spain, Netherlands, Japan, Denmark, Sweden, Austria
IQ SYBR Green Supermix is a ready-to-use solution for real-time quantitative PCR (qPCR) analysis. It contains all the necessary components, including SYBR Green I dye, for the detection and quantification of DNA targets.

More about "Ubiquitin-Conjugating Enzymes"

Ubiquitin-Conjugating Enzymes (E2s) are a class of enzymes that play a crucial role in the ubiquitin-proteasome system.
They catalyze the covalent attachment of the small protein ubiquitin to target proteins, marking them for degradation or other cellular processes.
This process is essential for regulating protein levels, quality control, and signal transduction within cells.
The ubiquitination pathway involves three main steps: activation of ubiquitin by the ubiquitin-activating enzyme (E1), transfer of ubiquitin to the E2 enzyme, and finally, the E2 enzyme working in conjunction with a ubiquitin-protein ligase (E3) to attach ubiquitin to the target protein.
E2 enzymes are often studied in the context of various biological systems and disease states, such as cancer, neurodegenerative disorders, and immune function.
Researchers may utilize techniques like TRIzol reagent, RNeasy Plant Mini Kit, and SYBR Premix Ex Taq kit to isolate and analyze the expression of E2 enzymes and their associated genes.
Reverse transcription is a common method used to convert messenger RNA (mRNA) into complementary DNA (cDNA) for further analysis, such as qPCR (quantitative Polymerase Chain Reaction) using IQ SYBR Green Supermix.
The Reverse Transcription System, including enzymes like Superscript III and RevertAid Reverse Transcriptase, are often employed in these workflows.
By leveraging the power of PubCompare.ai's AI-driven analysis, researchers can easily locate protocols related to Ubiquitin-Conjugating Enzymes from literature, pre-prints, and patents.
This tool enables the identification of the best protocols and products to improve experiments and enhance research reproducibility, streamlining the Ubiquitin-Conjugating Enzymes research workflow.