Ubiquitin, Human

Mammalian expression and reporter constructs were generated using standard restriction enzyme-based and ligation-independent cloning methods. Components were acquired as follows: The T7 promoter-targeting TALE³⁰ was the generous gift of Feng Zhang (Broad Institute). Gaussia and Cypridina luciferases were derived from pGLuc-Basic and pCLuc-Basic, respectively (New England Biolabs). dCas9 (S. pyogenes D10A/H841A Cas9) was isolated from Addgene plasmid 47754, the EF1a promoter from Addgene plasmid 11154, mCerulean from Addgene plasmid 23244, Venus from Addgene 15753 and the human Ubiquitin C promoter (hUBCPro) used to drive expression of L7Ae~VP, PP7~VP (Supplementary Fig. 2a, bottom) and MS2~mCherry (Supplementary Fig. 13a, right) from Addgene plasmid 17627. All other components were synthesized de novo from small synthetic oligonucleotides or from gBlocks (Integrated DNA Technologies).
The backbone for Lentiviral reporter constructs was derived from pLenti6.3/TO/V5-DEST (Life Technologies), from which the Tet-reponsive promoter and Gateway cloning sites were removed. The backbone for the T7 TALE and MS2~VP constructs was derived from pcDNA3.1(+) (Life Technologies) in which the Neomycin expression cassette was removed. All other constructs were cloned into pNEB193 (New England Biolabs).
L7Ae, MS2 and PP7 were codon-optimized for expression in human cells and synthesized as gBlocks (Integrated DNA Technologies). The PP7 construct consists of two tandem copies of the non-aggregating ΔFG mutant³¹ joined by a flexible seven amino acid linker with the sequence GSTSGSG (Supplementary Fig. 2a, bottom). Similarly, the MS2 construct consists of two tandem copies of the non-aggregating V75E/A81G mutant^{40 (link)} joined by the same linker. L7Ae was designed according to a published sequence^{37 (link)}.
INT-like constructs (Figs. 3,4 and Supplementary Table 5) were cloned as follows. We first cloned an INT general-purpose cloning vector, “sgINTgpc,” containing the following pertinent sequence:
GATCTAGATACGACTCACTATGTTTAAGAGCTATGCTGCGAATACGAGAAGTCTTCTTTTTTGAAGACAATCGTATTCGCAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT
GGCACCGAGTCGGTGCTTTTTTT
…Wherein italicized nucleotides denote the GLuc-targeting protospacer sequence (Supplementary Table 2), underlined nucleotides denote an extended sgRNA stem1 (Ref. 18 (link)) and bold nucleotides denote two outward-facing BbsI restriction sites. This cassette is under expression of a human U6 promoter (not shown). Inserts cloned into this backbone had the general format: 5´–CGAG–[Insert]–CTCGT–3´, wherein underlined nucleotides denote the sticky ends used for cloning; the additional C following the insert restores base-pairing at the end of stem1. These inserts were generated by PCR and restriction digestion with BbsI, or by annealing synthetic, 5´-phosphorylated oligonucleotides (following the protocol used for the N₂₅ pool, below). Inserts were ligated into BbsI-digested, gel-purified sgINTgpc using the Quick Ligation Kit (New England Biolabs).
All sgRNAs and derivatives were initially cloned bearing a GLuc-targeting protospacer (Supplementary Table 2). ASCL1-, IL1RN-, NTF3-, TTN- and telomere-targeting constructs (Figs 1d, 3f, 4b–d; Supplementary Table 2) were derived from these parental constructs using an inverse-PCR method, using a forward primer that anneals downstream of the protospacer and a reverse primer that anneals to the 3´-end of the U6 promoter. Namely, PCR products were amplified with primers of the general format:
Forward: TAGTAGAAGACAAXXXXXXXXXXXXXGTTTAAGAGCTATGCTGCGAATACG
Reverse: TAGTAGAAGACAAYYYYYYYYYYYYGGTGTTTCGTCCTTTCCAC
…Wherein bold nucleotides denote BbsI restriction sites; X’s denote nucleotides 9–21 of the new protospacer sequence; Y’s denote the reverse complement of nucleotides 1–9 of the new protospacer; underlined nucleotides are reverse complementary to one another. PCR products were purified using the QIAgen PCR cleanup kit, digested with BbsI and DpnI, purified again and quantified by UV-vis spectroscopy. Products (25 ng, in 11 µL final) were self-ligated using the Quick Ligation Kit (New England Biolabs).
All plasmid sequences were confirmed by Sanger sequencing (GeneWiz) prior to use.