> Chemicals & Drugs > Amino Acid > UCHL1 protein, human

UCHL1 protein, human

UCHL1 (Ubiquitin Carboxyl-Terminal Hydrolase L1) is a deubiquitinating enzyme that plays a crucial role in the regulation of the ubiquitin-proteasome system.
It is primarily expressed in neurons and is involved in the recycling of ubiquitin, a process that is essential for maintaining protein homeostasis and neuronal function.
UCHL1 has been implicated in the pathogenesis of neurodegenerative disorders, such as Parkinson's disease, and is considered a potential biomarker and therapeutic target.
Researchers can streamline their UCHL1 protein analysis using PubCompare.ai, an innovative solution that optimizes research protocols by locating and comparing the best protocols from literature, pre-prints, and patents, while leveraging AI-driven comparisons to identify the most reproducible and accurate approaches.
This tool helps scientists maximize the efficiency and reliability of their UCHL1 protein research.

Most cited protocols related to «UCHL1 protein, human»

Standardized Immunohistochemistry for Tumor-Infiltrating T-cells

Cited 14 times

Tissue microarrays (TMAs) were constructed [50 (link)]. For CD3, CD8 and FOXP3, antigen retrieval was performed, and deparaffinized tissue sections in EDTA Solution (pH 8.0) (Zymed, San Francisco, CA) were treated by a microwave for 30 sec in a pressure cooker. For CD45RO (the official gene symbol PTPRC), Citrate Buffer (pH 6.0) (Zymed) was used for antigen retrieval. Tissue sections were incubated with peroxidase block (5 min); protein block (20 min); and then, primary antibody against CD3 (rabbit polyclonal anti-human CD3 antibody, clone F7.2.38, 1:250 dilution, Dako Cytomation, Carpinteria, CA), CD8 (mouse monoclonal anti-human CD8 antibody, clone C8/144B, 1:100 dilution, Dako Cytomation), CD45RO (mouse monoclonal anti-human CD45RO antibody, clone UCHL1, 1:100 dilution, Dako Cytomation) or FOXP3 (mouse monoclonal anti-human FOXP3 antibody, clone 206D, 1:50 dilution; BioLegend, San Diego, CA) for 1 hr at room temperature. Next, we applied Envision System HRP-labeled polymer anti-rabbit (for CD3) or anti-mouse (for the other markers) (Dako Cytomation) for 30 min, diaminobenzidine (5 min) and hematoxylin counterstain (1 min).
After staining for each T-cell subset, TMA slides were scanned by an automated scanning microscope and Ariol image analysis system (Genetix, San Jose, CA) (Figure 1). The software was used to count the number of positive nuclei in each tissue core. We marked neoplastic epithelial areas, to exclude non-neoplastic areas (stroma, normal mucosa, and necrotic regions). We calculated the average density (cells/mm²) of each tumour-infiltrating T-cell subset. In addition, we analysed subset T-cell density in stromal areas as well as in whole TMA core (Supplementary Tables 1-2).
Immunohistochemical evaluation of T-cell subsets in cancer tissue has been a challenge, and there has been no standardized method. Pre-analytical variables such as tissue processing may have considerable impact on antigenicity of each T-cell subset, which may be substantially influenced by a subtle difference in conditions of immunohistochemical procedure. We tried to minimize such measurement errors in a number of ways. We constructed TMA and performed the immunohistochemical procedure in a very similar condition for all specimens. We obtained two to four tumour tissue cores from each case, considering within-tumour heterogeneity.

Nosho K., Baba Y., Tanaka N., Shima K., Hayashi M., Meyerhardt J.A., Giovannucci E., Dranoff G., Fuchs C.S, & Ogino S. (2010). Tumour-infiltrating T-cell subsets, molecular changes in colorectal cancer and prognosis: cohort study and literature review. The Journal of pathology, 222(4), 350-366.

Publication 2010

Antibodies, Anti-Idiotypic Antigens Buffers CD45RO Antigens Cell Nucleus Cells Citrates Clone Cells Edetic Acid Genes Genetic Heterogeneity Hematoxylin Homo sapiens Immunoglobulins Malignant Neoplasms Microarray Analysis Microscopy Microwaves Monoclonal Antibodies Mucous Membrane Muromonab-CD3 Mus Necrosis Neoplasms Peroxidase Polymers Pressure Proteins PTPRC protein, human Rabbits T-Lymphocyte Subsets Technique, Dilution Tissues UCHL1 protein, human

Ubiquitin cleavage and activity assays

Cited 10 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2012

Biological Assay Buffers Cytokinesis Edetic Acid Peroxide, Hydrogen SDS-PAGE SENP1 protein, human Sodium Chloride STAMBP protein, human SUMO1 protein, human Tetragonopterus Tromethamine Tween 20 Ubiquitin UCHL1 protein, human USP7 protein, human

Immunohistochemistry of Tendon Pathology

Cited 10 times

Immunohistochemical analysis was performed on flexor digitorum tendons collected from normal controls (n=12), trained controls (n = 9), and rats that had performed either the HRHF task for 3 (n = 4), 6 (n=4) or 12 weeks (n=4), or the LRNF task for 3 (n=3), 6 (n=4) or 12 weeks (n = 3). Animals were euthanized, perfused transcardially with 4% paraformaldehyde in PO₄ buffer, and forearm musculotendinous tissues were dissected as a mass off the forearm bones as shown in Figure 3K,L, and sectioned longitudinally as a soft tissue mass (en bloc) as described previously (19 (link), 23 (link)). Sections, on slides, were incubated in 3% H₂O₂ in methanol (4°C) for 30 min, washed, incubated in 4% dried milk in PBS (Blotto) for 20 min, and then overnight at rm temp with a Substance P antibody (# MAB1566, Chemicon, Temecula, CA; 1:500 dilution with 4% carnation milk in PBS). After washing, sections were incubated for 2 hrs at rm temp with goat anti-mouse peroxidase-conjugated (HRP) secondary antibody (Jackson ImmunoResearch, West Grove, PA) diluted 1:100 with PBS. HRP was visualized as a black immunoreactive stain using diaminobenzidene (DAB) with cobalt (Sigma-Aldrich, St. Louis, MO). For IL-1β and periostin like factor (PLF; labels activated fibroblasts producing this matricellular protein), sections were immunolabeled and detected with HRP-DAB as previously described (21 (link),24 (link)). Eosin and/or nuclear red were used as counterstains. A series of adjacent sections were also stained with hematoxylin and eosin (H&E) only. Sections were dehydrated and coverslipped with DPX mounting medium. For connective tissue growth factor (CTGF; a fibroblast growth factor that induces collagen production and an activated fibroblast marker), sections were immunolabeled and detected with Cy3 (red fluorescence), and coverslipped with 80% glycerol in PBS, as previously described (22 (link)). Negative control slides included omission of either the primary antibody or the secondary antibody.
Selected sections were double-labeled after Substance P immunolabeling with either anti-ED1 (detects a 90 kDa lysosomal membrane protein in monocytes/macrophages) or anti-PGP9.5 (a pan neuronal marker). After Substance P immunolabeling with secondary antibody conjugated to Cy2 (green tag; Jackson, diluted 1:100 in PBS for 2 hrs), tissue sections were washed, digested with 0.5% pepsin in 0.01 N HCl for 20 min at rm temp, and then incubated with goat serum (4%) in PBS for 30 min at rm temp. Sections were then incubated with either anti-ED1 (MAB1435, Chemicon, Temecula, CA, 1:250 dilution in 4% goat serum in PBS) or anti-PGP9.5 (ab8189, Abcam, Cambridge, MA, 1:50 dilution in 10% goat serum in PBS) overnight at rm temp. Sections were incubated with appropriate secondary antibodies conjugated to Cy3 (red tag; Jackson). Slides were coverslipped with 80% glycerol in PBS. Selected sections were also double-labeled with CTGF and collagen type I antibodies as described previously (22 (link)).

Fedorczyk J.M., Barr A.E., Rani S., Gao H., Amin M., Amin S., Litvin J, & Barbe M.F. (2010). Exposure dependent increases in IL-1beta, Substance P, CTGF and tendinosis in flexor digitorum tendons with upper extremity repetitive strain injury. Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 28(3), 298-307.

Publication 2009

Animals Antibodies Buffers Carnation Cobalt Collagen Collagen Type I Connective Tissue Growth Factor Eosin Fibroblast Growth Factor Fibroblasts Fluorescence Forearm Glycerin Goat Immunoglobulins Interleukin-1 beta Lysosome-Associated Membrane Glycoproteins Macrophage Methanol Milk, Cow's Monocytes Mus Neurons paraform Pepsin A Peroxidase Peroxide, Hydrogen POSTN protein, human Proteins Rattus Serum Stains Substance P Technique, Dilution Tendons Tissues UCHL1 protein, human Ulna

Comprehensive Tumor Immunophenotyping Protocol

Cited 9 times

Four-micrometer-thick sequential histologic tumor sections were obtained
from a representative formalin-fixed, paraffin-embedded tumor block and used for
IHC analysis. IHC was performed using an automated staining system (BOND-MAX;
Leica Microsystems) with antibodies against PD-L1 (clone E1L3N, dilution 1:100;
Cell Signaling Technology), CD3 (T-cell lymphocytes; dilution 1:100; Dako), CD4
(helper T cell; Novocastra; clone 4B12, dilution 1:80; Leica Biosystems), CD8
(cytotoxic T cell; clone CD8/144B, dilution 1:20; Thermo Fisher Scientific),
CD57 (natural killer T cell; clone HNK-1, dilution 1:40; BD Biosciences),
granzyme B (cytotoxic lymphocytes; clone F1, ready to use; Leica Biosystems),
CD45RO (memory T cell; clone UCHL1, ready to use; Leica Biosystems), PD-1 (clone
EPR4877-2, dilution 1:250; Abcam), FOXP3 (regulatory T cell; clone 206D,
dilution 1:50; BioLegend), and CD68 (macrophages; clone PG-M1, dilution 1:450;
Dako). Expression of all of the markers in cells was detected using a Novocastra
Bond Polymer Refine Detection kit (Leica Microsystems) with a diaminobenzidine
reaction to detect antibody labeling and hematoxylin counterstaining. Positive
and negative controls were used for PD-L1 IHC expression (human embryonic kidney
293 cell line transfected and nontransfected with PD-L1 gene and human placenta
and tonsil FFPE tissues) during each run IHC staining using autostainers. For
the TAIC IHC expression, human tonsil FFPE tissues with and without primary
antibody were used as positive and negative controls, respectively, with each
run IHC staining.

Parra E.R., Behrens C., Rodriguez-Canales J., Lin H., Mino B., Blando J., Zhang J., Gibbons D.L., Heymach J.V., Sepesi B., Swisher S.G., Weissferdt A., Kalhor N., Izzo J., Kadara H., Moran C., Lee J.J, & Wistuba I.I. (2016). Image Analysis–based Assessment of PD-L1 and Tumor-Associated Immune Cells Density Supports Distinct Intratumoral Microenvironment Groups in Non–small Cell Lung Carcinoma Patients. Clinical cancer research : an official journal of the American Association for Cancer Research, 22(24), 6278-6289.

Publication 2016

Antibodies CD45RO Antigens CD57 Antigens CD274 protein, human Cell Lines Cells Clone Cells Cytotoxic T-Lymphocytes Embryo Formalin Genes GZMB protein, human Helper-Inducer T-Lymphocyte Hematoxylin Homo sapiens Immunoglobulins Lymphocyte Macrophage Memory T Cells Natural Killer T-Cells Neoplasms Palatine Tonsil Paraffin Polymers Regulatory T-Lymphocytes T-Lymphocyte Technique, Dilution Tissues UCHL1 protein, human

Molecular Profiling of GIST Subtypes

Cited 8 times

GIST48 and GIST882 cells were established in the Fletcher laboratory (DFCI). All other cells were obtained from ATCC. Etv1^−/− mice, with targeted deletion of the ETS domain, was obtained from the Jessell laboratory (Columbia) and CB17-SCID mice was from Taconic. Antibody sources are: ETV1, ANO1, PGP9.5 (Abcam), KIT for WB, P-Tyr703-KIT (Cell Signaling), P-Tyr204-ERK, GAPDH (Santa Cruz), and anti-mouse Kit for IF (clone ACK2, E-Biosciences).

Chi P., Chen Y., Zhang L., Guo X., Wongvipat J., Shamu T., Fletcher J.A., Dewell S., Maki R.G., Zheng D., Antonescu C.R., Allis C.D, & Sawyers C.L. (2010). ETV1 is a lineage-specific survival factor in GIST and cooperates with KIT in oncogenesis. Nature, 467(7317), 849-853.

Publication 2010

ANO1 protein, human Cells Clone Cells Deletion Mutation ETS Motif GAPDH protein, human Immunoglobulins Mus SCID Mice UCHL1 protein, human

Most recents protocols related to «UCHL1 protein, human»

Lyophilized Antibody Cocktail for Flow Cytometry Staining

To minimize batch to batch variability across sites during sample processing, we used a lyophilized antibody cocktail consisting of eight premixed antibodies that was fabricated and lyophilized for the flow cytometry staining panel used in this study (BioLegend, San Diego, CA). Because the final panel consisted of three antibodies containing brilliant violet technology, one of these antibodies was added in the appropriate concentration after the lyophilized cocktail was resuspended with appropriate stabilization buffers (BD Biosciences, Franklin Lake, NJ). We included a live/dead stain to allow gating on live cells in the analysis. The composition of the lyophilized cocktail was as follows: CD4 (clone OKT4) FITC, CD3 (clone SK7) Alexa Fluor700, CD45RA (clone HI100) APC/Fire760, CD127 (clone A019D6) PE, CD25 (clone BC96) PE/Cyaine7, CD194/CCR4 (cloneL291H4) APC, CD183/CXCR3 (clone G026H7) Brilliant Violet 421, CD45RO (clone UCHL1) Brilliant Violet 711, CD196 (CCR6) (clone G03E3) PE/Dazzle 594.
We also designed a separate lyophilized cocktail that we included with each sample to serve as the fluorescence minus one (FMO) control for CCR4, CCR6 and CXCR3. This cocktail included all antibodies listed above except these three chemokine receptors. The appropriate concentration of each antibody (minus one) was added to each FMO control using separate liquid reagents for CCR4, CCR6 and CXCR3.

Magallon R.E., Harmacek L.D., Arger N.K., Grewal P., Powers L., Werner B.R., Barkes B.Q., Li L., MacPhail K., Gillespie M., White E.K., Collins S.E., Brown T., Cardenas J., Chen E.S., Maier L.A., Leach S.M., Hamzeh N.Y., Koth L.L, & O’Connor B.P. (2023). Standardization of flow cytometry and cell sorting to enable a transcriptomic analysis in a multi-site sarcoidosis study. PLOS ONE, 18(3), e0281210.

Full text: Click here

Publication 2023

Antibodies Buffers CCR6 protein, human CD45RO Antigens Cells Chemokine Receptor Clone Cells Combined Antibody Therapeutics CXCR3 protein, human Flow Cytometry Fluorescein-5-isothiocyanate Fluorescence IL2RA protein, human Immunoglobulins Stains UCHL1 protein, human Viola

Cardiac Cell Immunostaining and Confocal Imaging

At 48 h post-fixation, hearts were sectioned into 200-µm slices. For staining, slices were first incubated for 10 min in blocking solution (3% normal donkey serum (NDS) in PBST), followed by primary antibody staining overnight at 4 °C using the following antibodies: anti-vimentin (ab24525), anti-cardiac troponin I (ab188877) or anti-PGP9.5 (ab108986), purchased from Abcam at 1:200 dilution in blocking solution. Slices were then washed twice in PBST, then stained with secondary antibodies (1 mg ml⁻¹) at 1:500 dilution for 3 h at room temperature using the following: F(ab’)2 anti-chicken 488 (703-546-155) and anti-rabbit 647 (711-606-152) purchased from Jackson ImmunoResearch Laboratories. The slices were then stained with DAPI and washed three times with PBST (30 min per wash). Sections were mounted onto slides and mounted with exPROTOS. Slices were imaged on a confocal microscope (Olympus FV3000).

Hsueh B., Chen R., Jo Y., Tang D., Raffiee M., Kim Y.S., Inoue M., Randles S., Ramakrishnan C., Patel S., Kim D.K., Liu T.X., Kim S.H., Tan L., Mortazavi L., Cordero A., Shi J., Zhao M., Ho T.T., Crow A., Yoo A.C., Raja C., Evans K., Bernstein D., Zeineh M., Goubran M, & Deisseroth K. (2023). Cardiogenic control of affective behavioural state. Nature, 615(7951), 292-299.

Full text: Click here

Publication 2023

Antibodies Chickens DAPI Equus asinus Heart Immunoglobulins Microscopy, Confocal Rabbits Serum Technique, Dilution Troponin I UCHL1 protein, human Vimentin

Adipose Innervation Microscopy in Mice

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023

Diet Females Males Mice, Laboratory Microscopy Neurons Obesity UCHL1 protein, human

Quantitative Gene Expression Analysis of PBECs

Total RNA from PBECs or cell lines was isolated using TRIzol reagent (Thermo Fisher Scientific, Carlsbad, USA) according to the manufacturer’s protocol and RNA from LCM-collected epithelium was extracted as described above. cDNA was synthesized with random hexamer primers using the Revertaid cDNA synthesis kit (Thermo Scientific Inc.). Expression of UCHL1, collagen type I alpha 1 (COL1A1), fibronectin, collagen type III alpha 1 (COL3A1), calponin 1 (CNN1), E-cadherin (CDH1), laminin alpha 1 (LAMA1), and GAPDH genes were quantified using an ABI ViiA7 real-time PCR system (Applied Biosystems, USA) with ABsolute qPCR SYBR Green (Thermo Scientific, Inc.). Gene-specific primers are listed in Table 3 and Supplemental Table 3. Three technical replicates of real-time qRT-PCR were done for each biological repeat. Fold changes in mRNA expression above the control (dCas9-NED transfected cells) were calculated by the cycle threshold (ΔΔCt) method after normalization to GAPDH expression, unless stated otherwise.Table 3.

Information of PCR and sequencing primers.

Primer	Sequence (5’-3’)	Application
UCHL1-Fw	TTCCTGTGGCACAATCGGAC	qRT-PCR primer for UCHL1
UCHL1-Rv	CATCTACCCGACATTGGCCTT	qRT-PCR primer for UCHL1
COL1A1-Fw	GGGATTCCCTGGACCTAAAG	qRT-PCR primer for COL1A1
COL1A1-Rv	GGAACACCTCGCTCTCCA	qRT-PCR primer for COL1A1
COL3A1-Fw	CTGGACCCCAGGGTCTTC	qRT-PCR primer for COL3A1
COL3A1-Rv	CATCTGATCCAGGGTTTCCA	qRT-PCR primer for COL3A1
Fibronectin-Fw	TCAACTCACAGCTTCTCCAA	qRT-PCR primer for Fibronectin
Fibronectin-Rv	TTGATCCCAAACCAAATCTT	qRT-PCR primer for Fibronectin
CNN1-Fw	CCAACCATACACAGGTGCAG	qRT-PCR primer for CNN1
CNN1-Rv	TCACCTTGTTTCCTTTCGTCTT	qRT-PCR primer for CNN1
CDH1-Fw	CATTGCCACATACACTCTCTTCT	qRT-PCR primer for CDH1
CDH1-Rv	CGGTTACCGTGATCAAAATCTC	qRT-PCR primer for CDH1
GAPDH-Fw	CCACATCGCTCAGACACCAT	qRT-PCR primer for GAPDH
GAPDH-Rv	GCGCCCAATACGACCAAAT	qRT-PCR primer for GAPDH
dCas9-Fw	AATGGCATCCGAGACAAGCA	qRT-PCR primer for dCas9
dCas9-Rv	TGTGCTCGTGAAGACTGTCC	qRT-PCR primer for dCas9
UCHL1-pyro-Fw	GGTTTTGTTTTTGTTTTTTTTGTATAGG	PCR and sequencing primer for UCHL1 pyrosequencing (lower cases reflect the universal primer, Y is the CpG sites tested, subscript number indicating the site) (Site #4 is SNP-rs577696101-C/G according to UCSC)
UCHL1-pyro-Rv	gggacaccgctgatcgtttaAATCTCCA-TCYACTTAAACTACATCTTC
Pyroseq-sequencing primer	TTGTATAGGTTTTATAGTG
Pyroseq-sequence to analyse	Y₁GTTTGGTY₂GGY₃GTTTTATAGTTGTAGTTTGGGY₄GGTTTY₅G TTAGTTGTTTTTY₆GTTTTTTTTAGGTTATTTTTGTY₇GGGYGTTTYGYGAAGATGTAGTTTAAGTYGATGGAGATT

Wu D.D., Lau A.T., Xu Y.M., Reinders-Luinge M., Koncz M., Kiss A., Timens W., Rots M.G, & Hylkema M.N. (2023). Targeted epigenetic silencing of UCHL1 expression suppresses collagen-1 production in human lung epithelial cells. Epigenetics, 18(1), 2175522.

Full text: Click here

Publication 2023

Anabolism Biopharmaceuticals calponin Cell Lines Cells COL1A1 protein, human Collagen Type I DNA, Complementary E-Cadherin Epithelium Fibronectins GAPDH protein, human Genes laminin A Oligonucleotide Primers Real-Time Polymerase Chain Reaction RNA, Messenger SYBR Green I trizol UCHL1 protein, human

CRISPR Activation and Methylation Plasmid Construction

Plasmid MLM3636, expressing single-guide RNAs in mammalian cells, was a kind gift from Keith Joung (Addgene plasmid # 43860). Plasmid pMLM2.0 was constructed from MLM3636 by replacing the sgRNA expression cassette with the sgRNA2.0 expression cassette of the lentiviral plasmid sgRNA (MS2)_zeo backbone (Addgene plasmid # 61427) [26 (link)]. Stretches of 20 bp sgRNA to target UCHL1 were designed using the online tool (http://crispr.mit.edu/). Double-stranded oligonucleotides containing these targeting sites (listed in Supplemental Table 2) were cloned into BsmBI-digested pMLM2.0.
The plasmid containing the gene of the mammalian codon-optimized dCas9-VP64 activator (a tetramer of the viral VP16 transcriptional activator) was a kind gift from Keith Joung (Addgene; pMLM3705, #47754). An additional multiple-cloning site was inserted by replacing the VP64 coding sequence in dCas9-VP64 with a sequence containing a PacI restriction site, the new plasmid was referred to as No Effector Domain, pdCas9-NED (Addgene #109358) [53 (link)].
Plasmids expressing C-terminally mCherry-tagged dCas9-MSssI (Q147L/E186A) in mammalian cells were constructed as follows [54 (link)]: to create in-frame fusion between dCas9-MSssI and the P2A-mCherry-tag, the double-stranded oligonucleotide AK473-AK474 (5’-CGCGCCCAT ATGTTAATTAACAATTAA/5’-CCGGTTAATTGTTAATTAACATATGGG) was inserted between the SgsI (AscI) and BshTI (AgeI) restriction sites of pSYC-187 (Addgene#74,794). Insertion of AK473-AK474 preserved the flanking restriction sites, introduced a unique PacI site (underlined) and an in-frame stop codon. To abolish the stop codon, a short oligo-duplex (AK481-AK482, 5’-TAAGGTACCGA/5’-CCGGTCGGTACCTTAAT) was cloned between the PacI and the BshTI (AgeI) sites to obtain the plasmid pMCS-P2A-mCherry. (MCS stands for a sequence containing several restriction sites.) The SgsI (AscI) and Eco105I (SnaBI) fragment encoding the ‘MCS-P2A-mChery’ fragment was excised from pMCS-P2A-mCherry and cloned between the SgsI (AscI) and MssI (PmeI) sites of pdCas9-NED. The resulting plasmid pM-dCas9-(NED)-P2A_mCherry encodes a dCas9-P2A-mCherry fusion. The coding sequences of the MSssI (Q147L) and MSssI (E186A) variants were inserted, on SgsI-PacI fragments, between the SgsI and PacI sites of pdCas9-(NED)-P2A_mCherry. The new plasmids named pM-dCas9-MsssI (Q147L)-P2A-mCherry and pM-dCas9-MsssI (E186A)-P2A-mCherry express the respective dCas9-MSssI variant carrying the self-cleavable mCherry-tag. The catalytic domain of H3K27 histone methyltransferase enhancer of zeste homolog 2 (EZH2) was amplified with overhangs containing AscI and PacI restriction sites by PCR from pdCas9-EZH2. The EZH2 catalytic domain was subcloned into the pM-dCas9-NED-P2A-mCherry plasmid to yield pM-dCas9-EZH2-P2A-mCherry. The P2A-mCherry coding sequence was from the plasmid pSYC-187 [55 (link)], which was a kind gift from Seok-Yong Choi (Addgene plasmid # 74794). The catalytic domain of PRDM9 and DOT1L from dCas9-PRDM9 and dCas9-DOT1L, constructed as previously described [47 (link)], were subcloned into the pM-dCas9-NED-P2A-mCherry plasmid.
UCHL1 full-length cDNA (669 bp) was amplified from BEAS-2B cells and inserted into pcDNA4/HisMaxA between the BamHI and XbaI sites to generate the pcDNA4-UCHL1. Structure of the recombinant plasmids was confirmed by sequencing.

Full text: Click here

Publication 2023

Catalytic Domain Cells Clustered Regularly Interspaced Short Palindromic Repeats Codon Codon, Terminator DNA, Complementary DOT1L protein, human Exons EZH2 protein, human Genes Mammals Methyltransferase, Histone Oligonucleotides Open Reading Frames Paramyotonia Congenita Plasmids Reading Frames RNA, Single Guide Tetrameres UCHL1 protein, human Vertebral Column Viral Transcription VP-16

Top products related to «UCHL1 protein, human»

Facscanto 2 by BD

Sourced in United States, Germany, United Kingdom, Belgium, China, Australia, France, Japan, Italy, Spain, Switzerland, Canada, Uruguay, Netherlands, Czechia, Jersey, Brazil, Denmark, Singapore, Austria, India, Panama

The FACSCanto II is a flow cytometer instrument designed for multi-parameter analysis of single cells. It features a solid-state diode laser and up to four fluorescence detectors for simultaneous measurement of multiple cellular parameters.

Lsrfortessa by BD

Sourced in United States, United Kingdom, Germany, France, Canada, Australia, Belgium, China, Uruguay, Japan, Sweden, Switzerland, Cameroon

The LSRFortessa is a flow cytometer designed for multiparameter analysis of cells and other particles. It features a compact design and offers a range of configurations to meet various research needs. The LSRFortessa provides high-resolution data acquisition and analysis capabilities.

Alexa fluor 488 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Japan, France, Italy, Canada, China, Spain, Switzerland, Denmark, Australia, Hungary, Belgium, Ireland, Israel, Netherlands, Moldova, Republic of, India, Austria, Czechia, Poland

Alexa Fluor 488 is a fluorescent dye used in various biotechnological applications. It has an excitation maximum at 495 nm and an emission maximum at 519 nm, producing a green fluorescent signal. Alexa Fluor 488 is known for its brightness, photostability, and pH-insensitivity, making it a popular choice for labeling biomolecules in biological research.

Lsrii flow cytometer by BD

Sourced in United States, Germany, United Kingdom, Canada, France, Australia, Switzerland, Uruguay

The BD LSRII flow cytometer is a multi-parameter instrument designed for advanced flow cytometry applications. It features a modular design that allows for customization to meet specific research needs. The LSRII utilizes laser excitation and sensitive detectors to analyze the physical and fluorescent properties of individual cells or particles passing through a fluid stream.

Triton x 100 by Merck Group

Sourced in United States, Germany, United Kingdom, Italy, China, Japan, France, Canada, Sao Tome and Principe, Switzerland, Macao, Poland, Spain, Australia, India, Belgium, Israel, Sweden, Ireland, Denmark, Brazil, Portugal, Panama, Netherlands, Hungary, Czechia, Austria, Norway, Slovakia, Singapore, Argentina, Mexico, Senegal

Triton X-100 is a non-ionic surfactant commonly used in various laboratory applications. It functions as a detergent and solubilizing agent, facilitating the solubilization and extraction of proteins and other biomolecules from biological samples.

4 6 diamidino 2 phenylindole (dapi) by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand

DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.

Ab8189 by Abcam

Sourced in United Kingdom, United States

Ab8189 is a monoclonal antibody produced in mouse. It is specific for the human protein encoded by the ACTA2 gene, which is involved in the regulation of cell motility and structure.

Ab108986 by Abcam

Sourced in United States, United Kingdom

Ab108986 is a primary antibody that specifically targets the human CD44 protein. It is a rabbit monoclonal antibody that can be used for various applications, including immunohistochemistry and Western blotting.

4 6 diamidino 2 phenylindole (dapi) by Merck Group

Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore

DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

More about "UCHL1 protein, human"

UCHL1, also known as Ubiquitin Carboxyl-Terminal Hydrolase L1, is a crucial enzyme in the ubiquitin-proteasome system, primarily expressed in neurons.
This deubiquitinating enzyme plays a vital role in the recycling of ubiquitin, a process essential for maintaining protein homeostasis and neuronal function.
Researchers investigating UCHL1 can leverage PubCompare.ai, an innovative AI-powered solution, to streamline their protein analysis workflows.
This tool helps scientists locate and compare the best protocols from literature, preprints, and patents, identifying the most reproducible and accurate approaches for UCHL1 research.
UCHL1 has been implicated in the pathogenesis of neurodegenerative disorders, such as Parkinson's disease, making it a potential biomarker and therapeutic target.
Researchers can utilize various flow cytometry techniques, such as FACSCanto II, LSRFortessa, and LSRII, to analyze UCHL1 expression and localization.
Fluorescent dyes like Alexa Fluor 488 and DAPI can be used to visualize and quantify the protein.
Additionally, common laboratory techniques, such as Triton X-100 for cell permeabilization and Lipofectamine 2000 for transfection, may be employed in UCHL1 studies.
By leveraging the insights and tools available, scientists can streamline their UCHL1 protein research, leading to more efficient and reliable discoveries that contribute to our understanding of neurological functions and the development of potential therapies.
PubCompare.ai's innovative approach, combined with established flow cytometry and molecular biology techniques, empowers researchers to maximize the impact of their UCHL1 investigations.