> Chemicals & Drugs > Amino Acid > Versicans

← Venoms

Versicans

Versicans are large chondroitin sulfate proteoglycans found in the extracellular matrix of many tissues.
They play crucial roles in cell adhesion, proliferation, and differentation.
Versicans are involved in various physiological and pathological processes, including embrionic development, tissue homeostasis, and cancer progression.
Reserchers can utilize Versicans and PubCompare.ai to optimize research protocols and identify the most effective solutions, streamlining the reproducible research process.

Most cited protocols related to «Versicans»

Immunofluorescence Analysis of Mouse Spinal Cord

Cited 11 times

After terminal anesthesia by barbiturate overdose mice were perfused transcardially with 10% formalin (Sigma). Spinal cords were removed, post-fixed overnight, and cryoprotected in buffered 30% sucrose for 48 hours. Frozen sections (30μm horizontal) were prepared using a cryostat microtome (Leica) and processed for immunofluorescence as described^{16 (link)–18 (link)}. Primary antibodies were: rabbit anti-GFAP (1:1000; Dako, Carpinteria, CA); rat anti-GFAP (1:1000, Zymed Laboratories); goat anti-CTB (1:1000, List Biology Lab); rabbit anti-5HT (1:2000, Immunostar); goat anti-5HT (1:1000, Immunostar); mouse anti-CSPG^{22 (link)} (1:100, Sigma); rabbit-anti hemagglutinin (HA) (1:500 Sigma); mouse-anti HA (1:3000 Covance); sheep anti-BrdU (1:6000, Maine Biotechnology Services, Portland, ME); rabbit anti-laminin (1:80, Sigma, Saint Louis, MO); guinea pig anti-NG2 (CSPG4) (Drs. E.G. Hughes and D.W. Bergles^{57 (link)}, Baltimore, MA); goat anti-aggrecan (1:200, NOVUS); rabbit anti-brevican (1:300, NOVUS); mouse anti-neurocan (1:300, Milipore); mouse anti-phosphacan (1:500, Sigma); goat anti-versican (1:200, NOVUS); rabbit anti-neurglycan C (CSPG5) (1:200, NOVUS). Fluorescence secondary antibodies were conjugated to: Alexa 488 (green) or Alexa 350 (blue) (Molecular Probes), or to Cy3 (550, red) or Cy5 (649, far red) all from (Jackson Immunoresearch Laboratories). Mouse primary antibodies were visualized using the Mouse-on-Mouse detection kit (M.O.M. ®, Vector). BDA tract-tracing was visualized with streptavidin-HRP plus TSB Fluorescein geen or Tyr-Cy3 (Jackson Immunoresearch Laboratories). Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2ng/ml; Molecular Probes). Sections were coverslipped using ProLong Gold anti-fade reagent (InVitrogen, Grand Island, NY). Sections were examined and photographed using deconvolution fluorescence microscopy and scanning confocal laser microscopy (Zeiss, Oberkochen, Germany).

Anderson M.A., Burda J.E., Ren Y., Ao Y., O’Shea T.M., Kawaguchi R., Coppola G., Khakh B.S., Deming T.J, & Sofroniew M.V. (2016). Astrocyte scar formation aids CNS axon regeneration. Nature, 532(7598), 195-200.

Publication 2016

Aggrecans Alexa 350 Anesthesia Antibodies barbiturate Brevican Bromodeoxyuridine Cavia porcellus Cloning Vectors CSPG4 protein, human DAPI Domestic Sheep Drug Overdose Fluorescein Fluorescent Antibody Technique Formalin Frozen Sections Glial Fibrillary Acidic Protein Goat Gold Hemagglutinin Laminin Mice, House Microscopy, Confocal Microscopy, Fluorescence Microtomy Molecular Probes Neurocan Novus Protein Tyrosine Phosphatase, Receptor Type Z Rabbits Spinal Cord Stains Streptavidin Sucrose Versicans

Histological Procedures for Cardiovascular Markers

Cited 7 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2011

Acetone ACTA2 protein, human BMP2 protein, human Cardiac Arrest Cells Complex, Immune Diffusion Digestion Endopeptidase K Fetus Fixatives Fluorescent Antibody Technique Heart Histological Techniques LacZ Genes Methanol Microscopy Microscopy, Confocal paraform Radionuclide Imaging SOX9 protein, human Tissues TP63 protein, human Transmission, Communicable Disease Versicans

Embryonic and Adult Aortic Valve Histology

Cited 6 times

Embryonic and adult tissue were processed for hematoxylin and eosin (H and E) staining, Herovici’s collagen stain and, immunohistochemistry/immunofluorescence (IHC) as previously described (Dina et al., 2015 ; Durst et al., 2015 ; Sauls et al., 2015 ). IHC of cilia stains to look at expression and measure cilia length were done on 15 μm thick sections to insure measurement of full cilia length. Histology and IHC were preformed using 5 μm thick sections from E11,13,15,17, P0, and Adult (4month) aortic valves. Herovici stains were preformed using Herovici’s Collagen Stain Kit Procedure (American MasterTech, LODI, CA, Cat#KTHERPT). For immunohistochemistry (IHC): Antigen retrieval was performed for 1 minute using antigen unmasking solution (Vector Laboratories, Burlingame, CA, USA, Cat#H-3300) by pressure cooker (Cuisinart, Stamford, CT, USA). The following are the antibodies and their dilutions; Acetylated Tubulin (Sigma, Cat#T6793, 1:500), Gamma Tubulin (Abcam, Cambridge, MA, USA, Cat#ab11317, 1:1000), Versican (gift from Stan Hoffman, Medical University of South Carolina, 1: 250), Collagen (gift from Stan Hoffman, Medical University of South Carolina, 1: 250), MF20 (DSHB, Iowa City, IA, USA, Concentrate, I:50), Ki67 (Abcam, Cat#ab16667, 1:250), Phospho-histone H3 (EMD Millipore, Darmstadt Germany, Cat#06-570, 1:250), Smoothened (LSBio, Seattle WA, Cat#LS-A2666, 1:250), Gli3 (Origene, Rockville MD, Cat#TA337186, 1:250). Primary antibody was detected using fluorescent secondary antibody, Goat anti-Mouse IgG Alexa fluor 488 (Cat#A-11029, 1:100), Goat anti-Rabbit Alexa fluor 488 (Cat#A-11034, 1:100) anti-Mouse Alexa fluor 568 (Cat#A-11004, 1:100), anti-Rabbit Alexa fluor 568 (Cat#A-11036, 1:100) Cy5 goat anti-Mouse (Cat#A-10524, 1:100) and Cy5 goat anti-Rabbit (Cat#A-10523, 1:100) (Life Technologies, Rockville, MD, US). Nuclei were counterstained with Hoechst (Life Technologies, Cat #H3569, 1:10,000) for 10 minutes and slides were cover slipped with Slow Fade mounting medium (Life Technologies, Cat#S36937). Fluorescence imaging was preformed using Zeiss Axioimager M2 and Leica TCS SP5 AOBS Confocal Microscope System (Leica Microsystems, Inc., 410 Eagleview Boulevard, Suite 107, Exton, PA 19341). Z-stacks were set by finding the highest and lowest depth with visible fluorescence and using the system optimized setting to determine steps. Z-stacks were then compiled to form maximum projection images.

Toomer K.A., Fulmer D., Guo L., Drohan A., Peterson N., Swanson P., Brooks B., Mukherjee R., Body S., Lipschutz J., Wessels A, & Norris R.A. (2017). A Role for Primary Cilia in Aortic Valve Development and Disease. Developmental dynamics : an official publication of the American Association of Anatomists, 246(8), 625-634.

Publication 2017

Adult alexa 568 alexa fluor 488 anti-IgG Antibodies Antigens Cell Nucleus Cilia Cloning Vectors Collagen Embryo Eosin Fluorescence Fluorescent Antibody Technique gamma-Tubulin Goat Hematoxylin Histone H3 Immunoglobulins Immunohistochemistry Microscopy, Confocal Mus Pressure Rabbits Staining Stains Technique, Dilution Tissues Tubulin Valves, Aortic Versicans

Dissociation and Culture of Dorsal Root Ganglia Neurons

Cited 6 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2014

Adult Ara-C Brain Cells Chickens Chondroitin ABC Lyase Chondroitin Sulfate Proteoglycans Culture Media Deoxyribonucleases Digestion Edetic Acid Embryo Enzymes Ganglia, Spinal Glycosaminoglycans Hyperostosis, Diffuse Idiopathic Skeletal Laminin laminin-10 Liberase Lumbar Region Mus Neck Neurites Neurocan Neurons Penicillins Protein Tyrosine Phosphatase, Receptor Type Z Regeneration Serum Albumin, Bovine Streptomycin Sulfates, Inorganic Tissues Trypsin Versicans

Adamts5 Modulation of Versican Proteolysis

Cited 6 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2009

Antibiotics Antibodies, Anti-Idiotypic Cells Chemiluminescence Chondroitin ABC Lyase Cloning Vectors Cultured Cells Culture Media, Conditioned Culture Media, Serum-Free Diagnosis Eagle fibulin FuGene Homo sapiens Muscle, Smooth, Vascular Peptide Hydrolases Plasmids Protease Inhibitors Transfection Triton X-100 Tromethamine Versicans

Most recents protocols related to «Versicans»

Quantification of Plasma Proteins via ELISA

ELISA kits for human proteins were used to quantify the plasma levels of endogenous proteins, according to the manufacturer’s instructions. ELISA kits for gelsolin (GSN; abx253831), versican (VCAN; abx153474), staphylococcal nuclease, tudor domain containing 1 (SND1; abx383338), sialic acid–binding Ig-like lectin 14 (SIGLEC14; abx545882), and protein arginine methyltransferase 1 (PRMT1; abx258982) were purchased from Abbexa, whereas a kit for CD163 (DC1630) was purchased from R&D Systems.
After determining the optimal dilution factor for each protein, the concentrations of GSN, VCAN, SND1, CD163, SIGLEC14, and PRMT1 were measured and quantified in the pretreatment frozen plasma samples (n = 202). Absorbance at 450 nm was measured using a SPARK multimode microplate reader (Tecan Systems, Inc).

Kim S.I., Hwangbo S., Dan K., Kim H.S., Chung H.H., Kim J.W., Park N.H., Song Y.S., Han D, & Lee M. (2023). Proteomic Discovery of Plasma Protein Biomarkers and Development of Models Predicting Prognosis of High-Grade Serous Ovarian Carcinoma. Molecular & Cellular Proteomics : MCP, 22(3), 100502.

Full text: Click here

Publication 2023

CD163 protein, human Enzyme-Linked Immunosorbent Assay Freezing Gelsolin KIT protein, human Lectin Micrococcal Nuclease N-Acetylneuraminic Acid Plasma Plasma Proteins Protein-Arginine N-Methyltransferase Proteins Technique, Dilution Tudor Domain Versicans

Isolation and Characterization of Dermal Papilla Cells

Dermal papilla cells (DPCs) from Rex rabbits were kindly provided by Professor Xin Sheng Wu (College of Animal Science and Technology, Yangzhou University, Jiangsu, China) and were identified as previously described. The results showed that the isolated DPCs had high alkaline phosphatase activity and the marker proteins α smooth muscle actin (α-SMA) and versican (Vim) were positive [48 ].

Li F., Liu H., Wu X., Song Z., Tang H., Gong M., Liu L, & Li F. (2023). Tetrathiomolybdate Decreases the Expression of Alkaline Phosphatase in Dermal Papilla Cells by Increasing Mitochondrial ROS Production. International Journal of Molecular Sciences, 24(4), 3123.

Full text: Click here

Publication 2023

Actins Alkaline Phosphatase Animals Cells Muscle Proteins Nipples Oryctolagus cuniculus Versicans

Quantitative Real-Time PCR Analysis of Mechanically Stimulated Cells

hDPCs were seeded in 6-well plates at a density of 1 × 10⁵ cells/well, and then the cells were treated with GAM or PAM at 30W for 10 s. After incubation for 18 h, RNA was extracted using Trizol reagent (Ambion, CA, USA) and was converted to cDNA using Verso cDNA Synthesis Kit (Thermo Scientific, UT, USA). The quantitative RT-PCR was performed using Applied Biosystems™ SYBR Green Master Mixes (Thermo Scientific, UT, USA) and analyzed by QuantStudio 1 Real-Time PCR System (Thermo Fisher Scientific, UT, USA). The lists of primers are indicated below.

\begin{matrix} FER: & FW 5^{'} TGA AGA GCA GAC CCG TTT GG 3^{'} . \\ RW 5^{'} AGC GTG TCC ATG ATG AGG TG 3^{'} . \\ USP47: & FW 5^{'} GGC TTC TAC TAG GTG GCG TC 3^{'} . \\ RW 5^{'} TCA CCA TCA CTT CTC CAG GT 3^{'} . \\ INPP5D: & FW 5^{'} GGG AGA AAG TCC TCC GAC AC 3^{'} \\ RW 5^{'} CAA ACA TCT CGG GCT TCG TC 3^{'} \\ Versican: & FW 5^{'} TGT GTT TCA CTA CAG GGC GG 3^{'} . \\ RW 5^{'} GCG TCA CAC TGC TCA AAT CC 3^{'} \\ LEF1 & FW 5^{'} TCCCGTGAAGAGCAGGCTAAAT 3^{'} \\ RW 5^{'} TTGTCTCTTGCAGACCAGCCT 3^{'} \\ GAPDH: & FW 5^{'} GAC CAC AGT CCA TGC CAT CAC T 3^{'} \\ RW 5^{'} TCC ACC ACC CTG TTG CTG TAG 3^{'} \end{matrix}

Mongkolpobsin K., Sillapachaiyaporn C., Lertpatipanpong P., Boonruang K., Hwang C.Y., Tencomnao T, & Baek S.J. (2023). Cold atmospheric microwave plasma (CAMP) stimulates dermal papilla cell proliferation by inducing β-catenin signaling. Scientific Reports, 13, 3089.

Full text: Click here

Publication 2023

Anabolism Cells DNA, Complementary GAPDH protein, human INPP5D protein, human miltefosine Oligonucleotide Primers Reverse Transcriptase Polymerase Chain Reaction SYBR Green I trizol Versicans

Hordenine Effects on Dermal Papilla Cells

DPCs were seeded in a 24-well plate at a density of 3 × 10⁴ and cultured for 24 h. Then, Hordenine at the concentration of 0, 25 and 50 µmol/L was added to treat DPCs for 24 h. Then, cells were washed with PBS for three times, fixed in 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100, and blocked with 1% FBS for 0.5 h. The cells were then incubated overnight at 4 °C with the specific primary antibodies, followed by incubation for 2 h with fluorescent secondary antibody and staining with DAPI for 5 min. Photographing were conducted under an Olympus microscope. All the primary antibodies used in immunofluorescence staining were as follows: 1:200 anti-Ki67 antibody (Abcam, 16667, Cambridge, UK), 1:200 anti-β-catenin antibody (Proteintech, 51067-2-AP, Chicago, IL, USA), 1:100 anti-ALP antibody (Abcam, 65834, Cambridge, UK), 1:100 anti-Versican antibody (Abcam, 19345, Cambridge, UK).

Wang C., Zang K., Tang Z., Yang T., Ye X, & Dang Y. (2023). Hordenine Activated Dermal Papilla Cells and Promoted Hair Regrowth by Activating Wnt Signaling Pathway. Nutrients, 15(3), 694.

Full text: Click here

Publication 2023

Antibodies Antibodies, Anti-Idiotypic Cells CTNNB1 protein, human DAPI Fluorescent Antibody Technique hordenine Microscopy paraform Triton X-100 Versicans

Hordenine Modulates Osteoblast Differentiation

DPCs were seeded into a 6-well plate with 2.5 × 10⁵ cells per well. After treating the cells with 0, 25 and 50 µmol/L Hordenine for 24 h, the total RNA was extracted with Magzol Reagent (Magen, KD210300, Guangzhou, China). Reverse-transcription PCR was conducted with 1000 ng of total RNA using a Hifair^® Ⅱ 1st Strand cDNA Synthesis SuperMix (Yeasen, 11120ES60, Shanghai, China). Q-PCR was performed with Hieff^® qPCR SYBR Green Master Mix (Yeasen, 11202ES03, Shanghai, China) to detect the expression of related genes according to the following conditions: 95 °C for 15 s, 55 °C for 30 s, and 72 °C for 30 s (40 cycles). β-actin was used as an internal control.
All the primers used in the real-time quantitative PCR were as follows: ALP, 5′-CCAACTCTTTTGTGCCAGAGA-3′ (forward) and 5′-GGCTACATTGGTGTTGAGCTTTT-3′ (reverse); Versican, 5′-TTTTACCCGAGTTACCAGACTCA-3′ (forward) and 5′-GGAGTAGTTGTTACATCCGTTGC-3′ (reverse); Wnt3a, 5′-CTCCTCTCGGATACCTCTTAGTG-3′ (forward) and 5′-GCATGATCTCCACGTAGTTCCTG-3′ (reverse); β-catenin, 5′-ATGGAGCCGGACAGAAAAGC-3′ (forward) and 5′CTTGCCACTCAGGGAAGGA-3′ (reverse); Lef-1, 5′-AGAAATGAGAGCGAATGTCGTAG-3′ (forward) and 5′-CTTTGCACGTTGGGAAGGA-3′ (reverse); Axin2, 5′-TGACTCTCCTTCCAGATCCCA-3′ (forward) and 5′-TGCCCACACTAGGCTGACA-3′ (reverse); Cyclin d1, 5′-GCGTACCCTGACACCAATCTC-3′ (forward) and 5′-CTCCTCTTCGCACTTCTGCTC-3′ (reverse).

Wang C., Zang K., Tang Z., Yang T., Ye X, & Dang Y. (2023). Hordenine Activated Dermal Papilla Cells and Promoted Hair Regrowth by Activating Wnt Signaling Pathway. Nutrients, 15(3), 694.

Full text: Click here

Publication 2023

Actins Anabolism AXIN2 protein, human beta-Catenin Cyclin D1 DNA, Complementary Gene Expression hordenine LEF1 protein, human Oligonucleotide Primers Real-Time Polymerase Chain Reaction Reverse Transcription SYBR Green I Versicans

Top products related to «Versicans»

Ab19345 by Abcam

Sourced in United States, United Kingdom

Ab19345 is a laboratory equipment product offered by Abcam. It is a device designed for a specific function in scientific research and analysis. The core function of this product is to perform a particular task required in a laboratory setting.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Versican by Abcam

Sourced in United States, United Kingdom

Versican is a large chondroitin sulfate proteoglycan that is involved in the organization of the extracellular matrix. It plays a role in cell adhesion, proliferation, and migration.

Rneasy mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway

The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

β actin by Merck Group

Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Macao, Italy, Sao Tome and Principe, Israel, Spain, Denmark, France, Finland, Australia, Morocco, Ireland, Czechia, Sweden, Uruguay, Switzerland, Netherlands, Senegal

β-actin is a protein that is found in all eukaryotic cells and is involved in the structure and function of the cytoskeleton. It is a key component of the actin filaments that make up the cytoskeleton and plays a critical role in cell motility, cell division, and other cellular processes.

Ab1033 by Merck Group

Sourced in United States

The AB1033 is a laboratory instrument designed for analyzing molecular samples. It utilizes advanced spectroscopic techniques to detect and measure the properties of various biomolecules. The core function of the AB1033 is to provide precise and reliable data for scientific research and clinical applications.

Versican by Merck Group

Sourced in United States

Versican is a laboratory equipment product manufactured by the Merck Group. It is a piece of equipment designed for use in various laboratory settings. Versican's core function is to perform specific tasks or measurements required in the laboratory environment.

Taqman gene expression assay by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, Switzerland, Canada, Italy, Australia, Spain, France, Sweden, Estonia, Lithuania, Belgium, Denmark, Finland, Israel, Netherlands, Hungary

TaqMan Gene Expression Assays are a set of pre-designed and pre-optimized qPCR assays for accurately quantifying gene expression levels. They provide a sensitive and reliable method for measuring targeted mRNA transcripts in a variety of sample types.

Steponeplus real time pcr system by Thermo Fisher Scientific

Sourced in United States, Japan, China, Germany, United Kingdom, Switzerland, Canada, Singapore, Italy, France, Belgium, Denmark, Spain, Netherlands, Lithuania, Estonia, Sweden, Brazil, Australia, South Africa, Portugal, Morocco

The StepOnePlus Real-Time PCR System is a compact, flexible, and easy-to-use instrument designed for real-time PCR analysis. It can be used to detect and quantify nucleic acid sequences.

What are Versicans and what do they do?

How can PubCompare.ai help with Versican research?

PubCompare.ai allows researchers to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform can help identify the most effective protocols related to Versicans for specific research goals. PubCompare.ai's AI-driven analysis can highlight key differences in protocol effectiveness, enabling researchers to choose the best option for reproducibility and accuracy.

What are some common challenges in working with Versicans?

One of the main challenges in working with Versicans is understanding the different variations or types and how they can be utilized in specific applications. Researchers may also struggle to identify the most effective protocols from the vast amount of literature available. PubCompare.ai can assist in this process by streamlining the research and helping to find the optimal solutions.

What are some key applications of Versicans?

Versicans have a wide range of applications in various fields, including tissue engineering, regenerative medicine, and cancer research. They are used to study cell-matrix interactions, investigate embryonic development, and explore the role of the extracellular matrix in disease progression. PubCompare.ai can help researchers find the most relevant and effective protocols for these Versican-related applications.

Are there any special considerations when using Versicans in research?

Yes, there are a few important considerations when working with Versicans. Researchers need to be aware of the different isoforms and how they may impact their experimental results. Additionally, the extraction and purification of Versicans can be challenging and requires careful optimization. PubCompare.ai can assist by helping to identify the most reliable and reproducble protocols for Versican-related research.

More about "Versicans"

Versicans, also known as proteoglycans, are essential components of the extracellular matrix (ECM) found in many tissues throughout the body.
These large chondroitin sulfate proteoglycans play crucial roles in cell adhesion, proliferation, and differentiation, making them integral to various physiological and pathological processes, such as embryonic development, tissue homeostasis, and cancer progression.
Researchers can leverage the power of Versicans and PubCompare.ai to optimize their research protocols and identify the most effective solutions, streamlining the reproducible research process.
PubCompare.ai, an AI-driven platform, empowers researchers to locate the best protocols from literature, preprints, and patents using advanced comparisons, ensuring they have access to the most effective and up-to-date methodologies.
By incorporating Versicans and PubCompare.ai into their research workflows, scientists can experience the future of reproducible research today.
This integration allows them to streamline their processes, find the most effective solutions, and ultimately drive their research forward with greater efficiency and accuracy.
For example, researchers studying Versicans may utilize tools like Ab19345, a specific antibody for Versican detection, or TRIzol reagent and the RNeasy Mini Kit for RNA extraction and purification.
They may also employ techniques such as Lipofectamine 2000 for transfection, β-actin as a housekeeping gene, AB1033 for Versican immunohistochemistry, and TaqMan Gene Expression Assays with the StepOnePlus Real-Time PCR System for gene expression analysis.
By leveraging the insights and capabilities of Versicans and PubCompare.ai, researchers can optimize their research protocols, streamline their workflows, and ultimately unlock new discoveries that drive the advancement of science and medicine.