> Chemicals & Drugs > Amino Acid > Vinculin

Vinculin

Vinculin is a cytoskeleton protein that plays a critical role in cell-cell and cell-matrix adhesion.
It is involvd in the formation and regulation of focal adhesions, which are important for cell migration, signaling, and mechanical force transmission.
Vinculin interacts with a variety of other proteins, including actin, talin, and α-actinin, to mediate these adhesive processes.
Dysregulation of vinculin has been implicated in a number of diseases, including cancer, cardiovascular disorders, and neurodegenerative conditions.
Understanding the functions and regulation of vinculin is an active area of research, with potential therapeutic applications.

Most cited protocols related to «Vinculin»

Regulation of SRF Activity by Cofilin

Cited 12 times

PC12 cells were maintained on collagen-coated plates in DME with 6% FCS and 6% horse serum and seed at 6 × 10⁵ cells per 6-cm dish before transfection using FuGene reagent (Roche) according to the manufacturer's instructions. Each transfection mix (4 μg total plasmid DNA) included SRF reporter plasmid 3D.ALuc (firefly luciferase; 0.1 μg), reference standard pRLTK (thymidine kinase promoter controlling renilla luciferase; 0.4 μg), EF-eGFP (0.2 μg) to monitor transfection efficiency, and EFplink expression vector or derivatives encoding activator proteins or FLAG–cofilin (3.3 μg). For phosphorylation studies, cofilin expression plasmids were used at 0.2 μg per transfection. From control immunoblotting experiments with transfection efficiency estimated using GFP, we estimate that FLAG–cofilin was overexpressed by between two- and fivefold (unpublished data). Transfected cells were maintained in 0.5% serum for 18 h before stimulation with 15% serum; lysates were prepared 8 h later. For reporter experiments, activities were normalized to the activity of a parallel control transfection in which reporter activation was achieved using the constitutively active SRF derivative SRFVP16 (50 ng; Dalton and Treisman, 1992 (link)), taken as 100. Each reporter figure shows mean ± SEM for at least three independent transfection experiments. RNA analysis and transfection of mouse NIH3T3 cells were performed as previously described (Sotiropoulos et al., 1999 (link)); total RNA (10 μg) was analyzed using mouse GAPDH and vinculin probes with RNase T1 digestion (8 U per hybridization). Drug treatments were as follows: cytochalasin D (2 μM; Calbiochem); jasplakinolide (0.5 μM; Molecular Probes); pretreatments for 45 min with Y27632 (10 μM; gift from Yoshitomi Corp, Osaka, Japan) or latrunculin B (0.5 μM; Calbiochem).

Geneste O., Copeland J.W, & Treisman R. (2002). LIM kinase and Diaphanous cooperate to regulate serum response factor and actin dynamics. The Journal of Cell Biology, 157(5), 831-838.

Publication 2002

Actin Depolymerizing Factors Cells Cloning Vectors Collagen Crossbreeding Cytochalasin D derivatives Digestion Equus caballus FuGene GAPDH protein, human Hyperostosis, Diffuse Idiopathic Skeletal jasplakinolide latrunculin B Luciferases, Firefly Luciferases, Renilla Molecular Probes Mus NIH 3T3 Cells PC12 Cells Pharmaceutical Preparations Phosphorylation Plasmids Proteins Ribonuclease T1 Serum Thymidine Kinase Transfection Vinculin Y 27632

Western Blot Analysis of Protein Samples

Cited 10 times

Western blotting was conducted as previously described with modifications to protein preparation^{37 , 38}. Protein samples were combined with NuPAGE LDS Sample Buffer (4X) (Life Technologies, #NP0007) without any reducing agents and split into two aliquots for each sample. While one aliquot was for non-reducing analysis, beta-mercaptoethanol at 2% final concentration was added to the other aliquot for reducing analysis. All samples were incubated at 70 °C for 10 minutes before SDS-PAGE analysis. The primary antibodies and concentrations used for Western blotting were as follows: ACSL4 (1:2000, Santa Cruz Biotechnology, #sc-271800); HSPC300 (1:1000, Santa Cruz Biotechnology, #sc-390459); BAX (1:2000, #2772T), BAK (1:2000, #12105T), SLC3A2/4F2hc/CD98 (1:5000, #13180S), tubulin (1:5000, #2144S); filamin A (FLNA) (1:500, #4762S), filamin B (FLNB) (1:500, #12979S), myosin IIa (MYH9) (1:500, #3403S), talin-1 (TLN1) (1:500, # 4021S), SLC7A11 (1:1000, #12691S), CYFIP1 (1:1000, #44353S), WAVE-2 (1:1000, # 3659T), cleaved-caspase 3 (1:1000, #9661s), V5 (1:2000, #13202S; all from Cell Signaling Technology); glutathione antibody (1:1000, Abcam, #ab19534); actin (1:500, #MA5-11869, clone ACTN05 [C4]), NCKAP1 (1:1000, #PA5-30406; both from Thermo Fisher Scientific); drebrin (1:2000, #10260-1-AP), destrin (1:1000, #67657-1-Ig), Abi2 (1:1000, # 14890-1-AP), RPN1 (1:1000, #12894-1-AP; all from Proteintech); and vinculin (1:5000, Sigma-Aldrich, #V4505).

Atkin W.S., Hart A., Edwards R., Cook C.F., Wardle J., McIntyre P., Aubrey R., Baron C., Sutton S., Cuzick J., Senapati A, & Northover J.M. (2000). Single blind, randomised trial of efficacy and acceptability of oral Picolax versus self administered phosphate enema in bowel preparation for flexible sigmoidoscopy screening. BMJ : British Medical Journal, 320(7248), 1504-1509.

Publication 2023

2-Mercaptoethanol ABI2 protein, human Actins Antibodies Buffers Caspase 3 Clone Cells Destrin Filamin A Glutathione NCKAP1 protein, human Nonmuscle Myosin Type IIA Proteins Reducing Agents SDS-PAGE SLC3A2 protein, human Talin Tubulin Vinculin

BRCA2 Knockout and Gene Silencing

Cited 8 times

Human HeLa, HCC1395, 293T and U2OS cells were grown in Dulbecco’s modified Eagle’s medium (DMEM), while SH-SY5Y were grown in DMEM/F12 (1:1). Media was supplemented with 10% fetal calf serum. For BRCA2 gene knockout, the commercially available BRCA2 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-400700). Transfected cells were FACS-sorted into 96-well plates using a BD FACSAria II instrument. Resulting colonies were screened by western blot. Cell extracts, chromatin fractionation and western blot experiments were performed as previously described (29–31 (link)). Antibodies used for Western blot were: BRCA2 (Bethyl A303-434A), GAPDH (Santa Cruz Biotechnology sc-47724), RAD51 (Santa Cruz Biotechnology sc-8349), Vinculin (Santa Cruz Biotechnology sc-73614), RAD52 (Santa Cruz Biotechnology sc-365341). For gene knockdown, cells were transfected with Stealth siRNA (Life Tech) using Lipofectamine RNAiMAX reagent. For co-depletion experiments, control (non-targeting) siRNA was added to the targeting siRNA in the single knockdown samples to equalize total siRNA levels. The siRNA targeting sequences used were: E2F7 #1: GGACGATGCATTTACAGATTCTCTA; E2F7 #2: GACTATGGGTAACAGGGCATCTATA; E2F7 #3: AAACAAAGGTACGACGCCTCTATGA (used for E2F7 knockdown unless otherwise mentioned); BRCA2: GAGAGGCCTGTAAAGACCTTGAATT; RAD51: CCATACTGTGGAGGCTGTTGCCTAT; RAD52: GGCCAATGAGATGTTTGGTTACAAT.

Clements K.E., Thakar T., Nicolae C.M., Liang X., Wang H.G, & Moldovan G.L. (2018). Loss of E2F7 confers resistance to poly-ADP-ribose polymerase (PARP) inhibitors in BRCA2-deficient cells. Nucleic Acids Research, 46(17), 8898-8907.

Publication 2018

Antibodies Cell Extracts Cells Chromatin Clustered Regularly Interspaced Short Palindromic Repeats Eagle Fetal Bovine Serum GAPDH protein, human Gene, BRCA2 Gene Knockdown Techniques Gene Knockout Techniques HeLa Cells Homo sapiens Lipofectamine Plasmids RAD52 protein, human Radiotherapy Dose Fractionations RNA, Small Interfering Vinculin Western Blot

Protein Extraction and Analysis Protocol

Cited 6 times

MV4;11 and 293T cells were lysed with RIPA buffer supplemented with halt protease inhibitor cocktail (Thermo Fisher Scientific) and 0.1% benzonase (Novagen) on ice for 60 minutes. Lysates were clarified by centrifugation at 20,000 xg for 10 minutes at 4 ºC. NIH/3T3 and 293FT cells were lysed with RIPA buffer supplemented with cOmplete protease inhibitors (Roche) and PhosSTOP phosphatase inhibitors (Roche) on ice for 60 minutes. Lysates were clarified by centrifugation at 20,000 xg for 10 minutes at 4 ºC. Protein concentration was determined by a BCA assay (Pierce), and all samples were run with equal total protein content. The following antibodies were used in this study: HA (Cell Signaling, #3724 and #2367), BRD4 long isoform (Bethyl labs, #A301-985A), BRD4 short isoform (Abcam, #ab128874), BRD3 (Abcam, #ab56342), BRD2 (Bethyl labs, #A302–582A), FKBP12 (Abcam, #ab24373), vinculin (Santa Cruz, #Sc-25336), GAPDH (Millipore, #MAB374), phospho-AKT S473 (Cell Signaling, #4060), AKT (Cell Signaling, #2920), phospho-MEK1/2 S221 (Cell Signaling, #2338), MEK1/2 (Cell Signaling, #4694), phospho-ERK1/2 T202/Y204 (Cell Signaling, #4370), ERK1/2 (Cell Signaling, #4696), phospho-Pol II S2 (Millipore, #04-1571-1), and Pol II (Santa Cruz, #Sc-899). Imaging was performed by detection of fluorescently labelled infrared secondary antibodies (IRDye) on the Odyssey CLx Imager (LI-COR).

Nabet B., Roberts J.M., Buckley D.L., Paulk J., Dastjerdi S., Yang A., Leggett A.L., Erb M.A., Lawlor M.A., Souza A., Scott T.G., Vittori S., Perry J.A., Qi J., Winter G.E., Wong K.K., Gray N.S, & Bradner J.E. (2018). The dTAG system for immediate and target-specific protein degradation. Nature chemical biology, 14(5), 431-441.

Publication 2018

A-301 Antibodies Benzonase Biological Assay BRD4 protein, human Buffers Cells Centrifugation GAPDH protein, human HEK293 Cells inhibitors MAP2K1 protein, human Mitogen-Activated Protein Kinase 3 NIH 3T3 Cells Phosphoric Monoester Hydrolases Protease Inhibitors Protein Isoforms Proteins Radioimmunoprecipitation Assay RNA Polymerase II Tacrolimus Binding Protein 1A Vinculin

Molecular Tools for Cytoskeletal Dynamics

Cited 6 times

The expression plasmid for GFP–CP was constructed from pEGFP-C1 (Clontech, Palo Alto, CA) and a cDNA encoding mouse CP-β2 (53 (link)). The expression plasmid for GFP–Arp3 was described (66 (link)). The expression plasmids for mutant forms of rac1 and cdc42 were as described (13 (link)). The plasmids for expression of LIM–kinase-1 and mutant LIM–kinase-1 were as described (2 (link)). Exoenzyme C3 transferase was purchased from Calbiochem-Novabiochem (La Jolla, CA). Activated RhoA was expressed in bacteria and purified as described (48 (link)). The expression plasmid for mouse phosphatidylinositol 5-kinase (PI 5-kinase) (GenBank/EMBL/DDBJ accession number AF048695) was constructed using pRK5myc (30 (link)) and a cDNA clone derived from American Type Culture Collection (no. 569886; Rockville, MD) and the NIH Image consortium (est no. ma36d03; National Institutes of Health, Bethesda, MD). The cloned PI 5-kinase is a variant of mouse type I alpha PI 5-kinase. Plasmid regions that had been amplified using PCR were sequenced to check for errors. Antibodies to Arp3, p34, and p21 of the Arp2/3 complex (65 (link)), CP-β2 (53 (link)), actin (mAb C4) (32 (link)), VASP (10 (link)), zyxin (36 (link)), mena (20 (link)), ezrin (3 (link)), and profilin (38 (link)) were as described. Anti-vinculin was purchased from Sigma (St. Louis, MO). Antibody to PI 4,5-P₂ was purchased from perSeptive Diagnostics (Framingham, MA) and was injected at 11 mg/ml, a concentration that had effects in other studies (21 (link)). Antibodies to myosin IIA and myosin IIB were gifts from R. Wysolmerski (St. Louis University, St. Louis, MO); anti–myosin V (17 (link)) and anti–myosin I (34 (link)) were as described. A peptide based on a polyphosphoinositide-binding site in gelsolin (residues 150– 169) (28 (link)) was synthesized and injected at 10 mM. Rhodamine-labeled secondary antibodies were purchased from Chemicon (Temecula, CA). Rhodamine dextrans were purchased from Sigma.

Schafer D.A., Welch M.D., Machesky L.M., Bridgman P.C., Meyer S.M, & Cooper J.A. (1998). Visualization and Molecular Analysis of Actin Assembly in Living Cells. The Journal of Cell Biology, 143(7), 1919-1930.

Publication 1998

1-Phosphatidylinositol 3-Kinase 1-Phosphatidylinositol 4-Kinase Actin-Related Protein 2-3 Complex Actins Antibodies Bacteria Binding Sites CDC42 protein, human Diagnosis DNA, Complementary ezrin Gelsolin Gifts Immunoglobulins Lim Kinases Mus Myosin Type I Myosin Type V Nonmuscle Myosin Type IIA Nonmuscle Myosin Type IIB Peptides Phosphatidylinositol Phosphates Plasmids Profilins RHOA protein, human Rhodamine rhodamine dextran Transferase VASP protein, human Vinculin ZYX protein, human

Most recents protocols related to «Vinculin»

Quantitative ABCA4 Protein Analysis in Retinal Samples

The ROs were pooled (10) and lysed in radioimmunoprecipitation assay protein lysis buffer (Abcam) with protease inhibitor cocktail (Roche, Basel, Switzerland) and homogenized using a 25G needle. The protein concentration was assessed using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions and the plate absorbance was read in the SpectraMAX plate reader (Molecular Devices, San Jose, CA, USA) at 562 nm. The samples (22.5–85 μg) were loaded on 4–20% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad), ran for the first 30 min at 70 V and the next 4 h at 100 V in Tris-Glycine SDS buffer. The gels were transferred to PVDF membranes (Merck KGaA) previously activated with methanol, in 1× Tris-Glycine buffer and 20% methanol at 70 mV overnight at 4°C. The membranes were rinsed in PBS-0.1% Tween, blocked in Pure Odyssey Blocking Buffer (Li-COR Biosciences, Lincoln, NE, USA) for 2 h and incubated with an anti-ABCA4 clone 5B4 (1:1,000; Merck KGaA) and anti-vinculin (1:5,000; Abcam) at 4°C overnight. The membranes were washed with PBS-0.1% Tween and incubated with Goat Anti-Mouse IRDye 800 and Goat Anti-Rabbit IRDye 680 (1:5000; Li-COR Biosciences) for 1.5 h in the dark. The membranes were washed with PBS-0.1% Tween and scanned wet in the Odyssey IR system (Li-COR Biosciences). The intensity of the detected bands was quantified using FIJI ImageJ 1.53c, and the samples were normalized to the wild-type sample. The mean percentage of the detected ABCA4 protein was statistically analyzed using GraphPad Prism 9, with ordinary one-way ANOVA test followed by Dunnet’s multiple comparison test.

Kaltak M., de Bruijn P., Piccolo D., Lee S.E., Dulla K., Hoogenboezem T., Beumer W., Webster A.R., Collin R.W., Cheetham M.E., Platenburg G, & Swildens J. (2023). Antisense oligonucleotide therapy corrects splicing in the common Stargardt disease type 1-causing variant ABCA4 c.5461-10T>C. Molecular Therapy. Nucleic Acids, 31, 674-688.

Full text: Click here

Publication 2023

Biological Assay Buffers Clone Cells Gels Glycine Goat IRDye800 Medical Devices Methanol Mice, House Needles neuro-oncological ventral antigen 2, human polyvinylidene fluoride prisma Protease Inhibitors Proteins Rabbits Radioimmunoprecipitation Assay Tissue, Membrane Tromethamine Tweens Vinculin

Protein Extraction and Immunoblotting Methodology

Cell lysate preparation, SDS-PAGE, and Western blotting were carried out according to standard protocol. Proteins were harvested in cell lysis buffer supplemented with proteinase inhibitor cocktail (P8340; Sigma-Aldrich) and phosphatase inhibitor cocktail 2 (P5726; Sigma-Aldrich). Antigen detection was performed using antibodies directed against c-Src (rabbit anti-mouse/human antibody; #2109; Cell Signaling), Ctsk (mouse anti-mouse/human antibody; sc-48353; Santa Cruz), Rho (mouse anti-mouse/human antibody; #05-778; Millipore), galectin-3 (mouse anti-mouse/human antibody; ab2785; Abcam; epitopes mapped within the N-terminal region), Lrp1 (mouse anti-mouse antibody; MABN1796; Millipore), Mmp9 (rabbit anti-mouse antibody; ab38898; Abcam), Mmp14 (rabbit anti-mouse antibody; ab53712; Abcam), OXPHOS (rabbit anti-mouse antibody; ab110413; Abcam), vinculin (mouse anti-mouse antibody; V9131; Sigma-Aldrich), β3 integrin (rabbit anti-mouse antibody; #4702; Cell Signaling), or β-actin (rabbit anti-mouse antibody; #4970; Cell Signaling). Goat anti-rabbit IgG horseradish peroxidase (#65-6120; Thermofisher Scientific) or goat anti-mouse IgG horseradish peroxidase (#32430; Thermofisher Scientific) were used as secondary antibody. Bound primary antibodies (diluted to 1:1,000) were detected with horseradish peroxidase–conjugated species-specific secondary antibodies (Santa Cruz; diluted to 1:2,000) using the Super Signal Pico system (Thermo Fisher Scientific).
For immunoprecipitation analysis, cells were solubilized in IP Lysis Buffer (#87788; Thermo Fisher Scientific) supplemented with complete protease inhibitor cocktail (Roche). Immunoprecipitation was performed by incubation with a mouse monoclonal IgG (#5415; Cell Signaling) or anti–galectin-3 antibody (sc-32790; Santa Cruz) followed by the addition of Protein A/G Magnetic Beads (#88803; Thermo Fisher Scientific). Immune complexes were separated by electrophoresis followed by blotting with antibodies directed against Lrp1 (MABN1796; Millipore) and galectin-3 (ab2785; Abcam).

Zhu L., Tang Y., Li X.Y., Kerk S.A., Lyssiotis C.A., Sun X., Wang Z., Cho J.S., Ma J, & Weiss S.J. (2023). Proteolytic regulation of a galectin-3/Lrp1 axis controls osteoclast-mediated bone resorption. The Journal of Cell Biology, 222(4), e202206121.

Publication 2023

Actins anti-IgG Antibodies Antibodies, Anti-Idiotypic Antigens Buffers Cells Complex, Immune CTSK protein, human Electrophoresis Epitopes G-substrate Galectin 3 Goat GTP-Binding Proteins Homo sapiens Horseradish Peroxidase Immunoglobulins Immunoprecipitation Integrin beta3 MMP9 protein, human MMP14 protein, human Mus Protease Inhibitors protein phosphatase inhibitor-2 Proteins Rabbits SDS-PAGE Staphylococcal Protein A Vinculin

Western Blot Analysis of Liver Proteins

Frozen liver tissues were homogenised in 400 µl of ice-cold RIPA buffer (10 mM Tris–HCl pH 7.4, 150 mM NaCl, 5 mM EDTA pH 8.0, 1 mM NaF, 0.1% SDS, 1% Triton X-100, 1% Sodium Deoxycholate with freshly added 1 mM NaVO₄ and protease inhibitors) using a PowerGen 125 homogeniser and lysates normalised to 1 µg per 1 µl. Proteins were separated on a 4–12% Bis–Tris gel by SDS-PAGE and transferred onto nitrocellulose membrane.
Membranes were probed for the following; phospho-AKT (Ser 473, cat: 4060), total Akt (cat: 4691), phospho-S6 (Ser 235/236, cat: 4858), total S6 (cat: 2217), phospho-AMPK (Thr 172, cat: 2535), total AMPK (cat: 5832) and GAPDH (cat: 5174) (all Cell Signaling Technology), DEGS1 (cat: ab185237, Abcam), RBP4 (Dako), or IR β-chain (Santa Cruz Biotechnology). ApoB 48, ApoB 100 (Meridian Life Sciences UK, cat: K23300R) and Vinculin (Cell Signaling Technology, cat: 13901) were separated on a 6% Tris–Glycine gel. Anti-rabbit and anti-mouse horse radish peroxidase (HRP) conjugated antibodies were from Anaspec. Primary and secondary antibodies were used at 1:1000 and 1:5000 respectively.
Blots used in figures are all compliant with the digital image and integrity policies of Nature publishing and Scientific Reports journal. Western blot membranes were cut at approximate molecular weight (± 20 kDa) of target protein before incubation of primary antibodies. Equal numbers of representative samples from all treatment groups were run on multiple gels/blots to accommodate all samples. Images obtained were minimally processed. Image analysis and quantification with normalisation to loading control protein was performed within the same membrane and then data combined for graphical representation. No direct quantitative comparisons between samples on different gels/blots were performed.

Thompson D., Mahmood S., Morrice N., Kamli-Salino S., Dekeryte R., Hoffmann P.A., Doherty M.K., Whitfield P.D., Delibegović M, & Mody N. (2023). Fenretinide inhibits obesity and fatty liver disease but induces Smpd3 to increase serum ceramides and worsen atherosclerosis in LDLR−/− mice. Scientific Reports, 13, 3937.

Full text: Click here

Publication 2023

Anti-Antibodies Antibodies Apolipoprotein B-48 Apolipoprotein B-100 Bistris Buffers Cold Temperature Deoxycholic Acid, Monosodium Salt Edetic Acid Freezing GAPDH protein, human Gels Glycine Horseradish Peroxidase Liver Meridians Mus Nitrocellulose PER1 protein, human Protease Inhibitors Proteins Protein Targeting, Cellular Rabbits Radioimmunoprecipitation Assay RBP4 protein, human SDS-PAGE Sodium Chloride Tissue, Membrane Tissues Triton X-100 Tromethamine Vinculin Western Blotting

Talin-1 Splicing Variant Modulates Cell Adhesion

Full-length WT talin-1 plasmid containing internal GFP and RFP (Kumar et al., 2016 (link)) was used in this study. Nucleotides corresponding to the 17-residue region of the 17b splice variant were cloned into WT talin-1 by Gibson assembly. Briefly, the WT talin-1 plasmid was digested with NotI and XhoI. Primers containing overhangs of nucleotides corresponding to the 17-residue region of the splice variant were used to amplify R2. Two fragments containing nucleotides between the NotI site to R1 domain and beyond R2 domain to XhoI site were also amplified by PCR. All fragments were incubated with Gibson assembly mix (New England Biolabs) as per manufacturer’s instructions.
Talin-2 was knocked down in Tln1^−/− cells (Priddle et al., 1998 (link)) by transient transfection of Tln2 siRNA (ONTARGET-plus Smartpool siRNA, Catalog ID:L-065877-00-0005, Horizon Discovery) and scrambled siRNA (AM4636; Ambion), using Lipofectamine RNAimax, as described previously (Kumar et al., 2016 (link)). Knockdown was confirmed by immunoblotting for talin-2 using mouse anti-talin-2 antibody (AC14-0126; Abcore). These cells were transfected with full-length WT talin-1 and full-length talin-1-17b variant, using Lipofectamine 2000 (Thermo Fisher Scientific) for 24 h and trypsinized for all experiments at this time point. For early adhesion analysis, Tln1−/−transfected cells were held in suspension for 30 min and plated on fibronectin-coated glass bottom dishes for 15 min, 30 min, 1 h, and 4 h. Cells were fixed in 4% paraformaldehyde and counterstained with Alexa 405 phalloidin (Thermo Fisher Scientific) and anti-vinculin antibody (V9131; Sigma-Aldrich). Cells were imaged using a 63× objective on a Leica SP8 confocal microscope. ImageJ was used to assess cell area, focal adhesion area, focal adhesion number and mean fluorescence intensities of vinculin and talin within each adhesion. To assess substrate stiffness–dependent cell spreading, cells were trypsinized and plated on either fibronectin-coated (10 µg/ml) glass-bottom dishes or polyacrylamide gels of varying stiffness. At 6 h, cells were fixed in 4% paraformaldehyde and counterstained with Alexa 647 phalloidin (Thermo Fisher Scientific). The cell area was calculated using ImageJ.
For tensin-1 localization, cells were plated for 48 h and counter-stained with tensin-1 (SAB4200283; Sigma-Aldrich). Talin adhesions that were within 7 µm from centroid of the cell were considered central adhesions and tensin intensity was quantified within these adhesions. Mean of tensin intensity within central adhesions was divided by mean of tensin intensity of peripheral adhesions in each cell and the ratio was plotted. β-catenin staining was also performed on densely seeded cells using anti-β-catenin antibody (9562; CST).

Gallego-Paez L.M., Edwards W.J., Chanduri M., Guo Y., Koorman T., Lee C.Y., Grexa N., Derksen P., Yan J., Schwartz M.A., Mauer J, & Goult B.T. (2023). TLN1 contains a cancer-associated cassette exon that alters talin-1 mechanosensitivity. The Journal of Cell Biology, 222(5), e202209010.

Full text: Click here

Publication 2023

Antibodies, Anti-Idiotypic ARID1A protein, human Cells CTNNB1 protein, human Fluorescence FN1 protein, human Focal Adhesions Hyperostosis, Diffuse Idiopathic Skeletal Lipofectamine lipofectamine 2000 Microscopy, Confocal Mus Nucleotides Oligonucleotide Primers paraform Phalloidine Plasmids polyacrylamide gels RNA, Small Interfering Talin Tensin Tissue Adhesions Transfection Transients Vinculin

Western Blot Analysis of Cellular Proteins

Cells were lysed using radio-immunoprecipitation assay (RIPA) buffer (Thermo Fisher Scientific, Waltham, MA, Cat #89900) supplemented with protease and phosphatase inhibitors (Thermo Fisher Scientific, #78440) and 0.5 M Ethylenediaminetetraacetic acid (EDTA) (#78440, Thermo Fisher Scientific). Lysates were centrifuged at 14,000 rpm for 15 min at 4 °C. Protein concentrations were determined using Pierce^TM BCA Protein Assay Kit reagent (Thermo Fisher Scientific, #23227) and separated by electrophoresis on NuPAGE^TM 4 to 12% Bis-Tris, 1.0, Protein gel (Invitrogen, Waltham, MA). Antibodies were added according to the manufacturers recommended conditions. Antibodies used include anti-p53R2 + RRM2 antibody (abcam, Cambridge, United Kingdom, ab209995, 1:10000), anti-RRM2 antibody (abcam, ab172476, 1:5000), phospho-NF-κB p65 (Ser536)(93H1) Rabbit mAb (CST #3033, 1:1000), NF-κB p65(D14E12)XP Rabbit antibody (CST #8242, 1:1000), Phospho-AMPKα (Thr172) antibody (CST #2531, 1:1000), p53 (7F5) Rabbit mAb(CST #2527, 1:1000). Equal protein loading was confirmed using anti-vinculin antibody (abcam, ab219649, 1:5000). Molecular weight marker EZ-Run^TM prestained protein ladder (Thermo Fisher Scientific, BP3603500) was used to confirm the expected size of the proteins of interest. Immunoblots were developed with SuperSignal^TM West Femto Maximum Sensitivity Substrate (# 34095, Thermo Fisher Scientific) and imaged on a LiCor ODYSSEY Fc (LiCor Inc. Lincoln, NE, Model # 2800). Protein bands were quantified using Image Studio™ Acquisition Software (LI-COR) and normalized to the control bands.

Brown A., Pan Q., Fan L., Indersie E., Tian C., Timchenko N., Li L., Hansen B.S., Tan H., Lu M., Peng J., Pruett-Miller S.M., Yu J., Cairo S, & Zhu L. (2023). Ribonucleotide reductase subunit switching in hepatoblastoma drug response and relapse. Communications Biology, 6, 249.

Full text: Click here

Publication 2023

Antibodies Antibodies, Anti-Idiotypic Biological Assay Bistris Buffers Cells Edetic Acid Electrophoresis Hypersensitivity Immunoblotting Immunoglobulins Immunoprecipitation inhibitors Peptide Hydrolases Phosphoric Monoester Hydrolases Proteins Rabbits RRM2 protein, human Transcription Factor RelA Vinculin

Top products related to «Vinculin»

Vinculin by Merck Group

Sourced in United States, Germany, United Kingdom, Denmark

Vinculin is a cytoskeletal protein that plays a key role in cell-cell and cell-matrix adhesion. It functions as a linker between the actin cytoskeleton and the cell membrane, providing structural integrity and facilitating cell-cell and cell-matrix interactions.

Anti vinculin by Merck Group

Sourced in United States, United Kingdom, Germany, Italy, Belgium, France

Anti-vinculin is a laboratory reagent used in cell biology research. It is a monoclonal antibody that specifically binds to the protein vinculin, which is involved in cell-cell and cell-matrix adhesion. Anti-vinculin is commonly used in techniques such as Western blotting, immunoprecipitation, and immunocytochemistry to detect and study the expression and localization of vinculin in various cell types and samples.

Vinculin by Cell Signaling Technology

Sourced in United States, United Kingdom

Vinculin is a cytoplasmic protein that plays a key role in the regulation of cell-cell and cell-matrix adhesions. It acts as a linker between the actin cytoskeleton and the cell membrane, facilitating the transmission of mechanical forces and signal transduction.

Vinculin by Santa Cruz Biotechnology

Sourced in United States, United Kingdom, Germany

Vinculin is a cytoskeletal protein that plays a crucial role in cell-cell and cell-matrix adhesion. It is involved in the regulation of actin filament organization and the formation of focal adhesions.

Pvdf membrane by Merck Group

Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria

PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.

β actin by Merck Group

Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Macao, Italy, Sao Tome and Principe, Israel, Spain, Denmark, France, Finland, Australia, Morocco, Ireland, Czechia, Sweden, Uruguay, Switzerland, Netherlands, Senegal

β-actin is a protein that is found in all eukaryotic cells and is involved in the structure and function of the cytoskeleton. It is a key component of the actin filaments that make up the cytoskeleton and plays a critical role in cell motility, cell division, and other cellular processes.

Vinculin by Abcam

Sourced in United States, United Kingdom

Vinculin is a cytoskeletal protein that functions as a linkage between the actin cytoskeleton and cell-cell or cell-matrix adhesion sites. It plays a role in the regulation of cell-cell and cell-matrix junctions, as well as in the organization of the actin cytoskeleton.

Anti vinculin by Cell Signaling Technology

Sourced in United States

Anti-vinculin is a primary antibody that recognizes the vinculin protein. Vinculin is a cytoskeletal protein involved in cell-cell and cell-matrix junctions, playing a role in cell adhesion and signaling.

V9131 by Merck Group

Sourced in United States, United Kingdom, Germany

The V9131 is a laboratory equipment product manufactured by Merck Group. It is designed for use in research and scientific applications. The core function of the V9131 is to [insert brief, factual description of the product's core function without interpretation or extrapolation].

Nitrocellulose membrane by Bio-Rad

Sourced in United States, Germany, Italy, United Kingdom, Canada, France, China, Switzerland, Japan, Spain, Australia, Sweden, Portugal, Israel, Netherlands, Belgium

Nitrocellulose membranes are a type of laboratory equipment designed for use in protein detection and analysis techniques. These membranes serve as a support matrix for the immobilization of proteins, enabling various downstream applications such as Western blotting, dot blotting, and immunodetection.

What are the different types or variations of vinculin?

Vinculin exists in two main isoforms - vinculin and metavinculin. Vinculin is the more common form found in most cell types, while metavinculin is primarily expressed in muscle cells. The two isoforms differ in their C-terminal regions, which impacts their interactions with other proteins and their roles in cellular processes. Understanding the distinct functions of these vinculin variants can provide important insights into cell adhesion and signaling mechanisms.

How can vinculin be used in biomedical research and applications?

Vinculin plays a critical role in a variety of cellular processes, making it a key target for biomedical research. Studying vinculin can provide insights into cancer metastasis, as changes in vinculin expression and localization have been linked to increased cell motility and invasiveness. Vinculin is also important for cardiovascular health, with implications in atherosclerosis, cardiac remodeling, and mechanotransduction. Additionally, the role of vinculin in neurodegeneration is an active area of investigation, with potential applications in the development of therapuetic interventions.

What are some common challenges or limitations in working with vinculin?

One of the main challenges in working with vinculin is its complex regulation and interactions with a wide range of other proteins. Vinculin can undergo post-translational modifications, such as phosphorylation, which can modulate its activity and localization. Additionally, vinculin's interactions with proteins like talin, α-actinin, and actin can be highly context-dependent, making it difficult to fully elucidate its precise mechanistic role in different cellular contexts. Careful experimental design and the use of advanced techniques, such as live-cell imaging and single-molecule assays, are often required to overcome these limitations.

How can PubCompare.ai assist in optimizing vinculin research?

PubCompare.ai can be a valuable tool for researchers working with vinculin. The platform's AI-driven analysis can help you screen the literature more efficiently to identify the most effective protocols and products related to vinculin research. By leveraging the platform's critical insights, you can pinpoint key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy in your vinculin studies. This can save you time and resources, while also improving the quality and impact of your research.

More about "Vinculin"

Vinculin, a pivotal cytoskeletal protein, plays a crucial role in cell-cell and cell-matrix adhesion processes.
It is a key component of focal adhesions, which are essential for cell migration, signaling, and force transmission.
Vinculin interacts with a variety of other proteins, such as actin, talin, and α-actinin, to mediate these critical adhesive functions.
Dysregulation of vinculin has been implicated in a range of diseases, including cancer, cardiovascular disorders, and neurodegenerative conditions.
Understanding the intricate roles and regulation of vinculin is an active area of research, with promising therapeutic applications.
Researchers often utilize tools like anti-vinculin antibodies, PVDF and nitrocellulose membranes, and the vinculin-related protein β-actin to study vinculin and its associated pathways.
The V9131 antibody is a commonly used tool for vinculin detection and analysis.
By exploring the latest vinculin research across literature, preprints, and patents, scientists can uncover valuable insights and optimize their protocols using AI-driven platforms like PubCompare.ai.
This data-driven approach helps identify the most effective methods and products for vinculin-related studies, advancing our understanding of this critical cytoskeletal component and its implications for human health and disease.