Antibiotic G 418

Samples: A total of 211 rectal swabs were collected from calves, aged 0–6
months, with mild to severe diarrhea from five industrial farms (3 dairy and 2 water
buffalo) in Guangxi province, China. All samples were collected in sterile tubes containing
10 ml of 1/100 antibiotic 10 mM phosphate-buffered saline and transported
on ice to our laboratory within 24 hr. Samples were homogenized by vortexing for 5 min at
room temperature and centrifuged at 3,000 × g for 15 min at 4°C, and then, the supernatant
was aliquoted and stored at −80°C until assayed.
Nucleic acid extraction and cDNA bank synthesis: RNA was extracted from
300 µl of the supernatant obtained from each rectal swab using the RNAiso
PLUS kit (Takara Bio, Inc., Dalian, China) following the manufacturer’s instructions.
Extracted RNA was eluted in 35 µl of RNase-free H₂O (Takara Bio,
Inc.) and used for first strand cDNA bank synthesis with the PrimeScript II 1st strand cDNA
Synthesis kit (Takara Bio, Inc.) in accordance with the manufacturer’s instructions.
Detection of bovine astrovirus and genome cloning and sequencing: Bovine
astrovirus was detected by reverse transcriptase polymerase chain reaction (RT-PCR) analysis
using the degenerate primer pair (forward) DPF 5′-GAYTGGACBCGHTWTGATGG-3′ and (reverse) DPR
5′-KYTTRACCCACATNCCAA-3′ to target a 418-bp fragment of the RdRp region common to
astroviruses, as described previously [21 (link)] with some
modifications. Some of the RT-PCR-positive samples were sequenced and primarily analyzed by
comparison of nucleotide sequences using the online Basic Local Alignment Search Tool
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm the detection of astroviruses.
Subsequently, we amplified the 3′-end of ORF2 and the ORF1b/ORF2 regions, which have been
confirmed by subgenomic RNA analysis for characterization of astroviruses. Since the direct
amplification with gene specific primers (GSPs) failed, the Rapid Amplification of cDNA Ends
(RACE) method was implemented to amplify the 3′-end of the ORF1b/ORF2 region. The 3′-end
RACE amplification was performed as described previously [16 (link)] with the following modifications to the primer pair: QT 5′-CCAGTGAGC
AGAGTGACGAGGACTCGAGCTCAAGCT (T)₁₆-3′ and QO 5′-CCAGTGAGCAGAGTGACG-3′. The RACE
products were reused as templates in a nested PCR performed to amplify desired sequences
using GSPs designed in this study based on the B76-2/HK sequence available in the GenBank
database (http://www.ncbi.nlm.nih.gov/genbank/) under the accession number HQ916317.1.The
GSPs were designed using OLIGO 7 software (Molecular Biology Insights, Inc., Colorado
Springs, CO, U.S.A.). The nucleotide sequences of the primer pairs used to amplify the
partial 3′-end of ORF2 were as follows: (forward, B1205F and B1350F)
5′-CAGGTCACCCCAGGCAACAC-3′ and 5′-ATCATACAGGCGGGCACGAGT-3′, respectively, and (reverse,
B1205R) 5′-CCCTTCACCTATGCTAATCAAATC-3′ (expected products length, 1,200 and 1,426 bp,
respectively). The two primer pairs used to amplify the ORF1b/ORF2 region were as follows:
(1) (forward, B-GSP2-2F) 5′-AACAGC ACAGGGAGAGGTATAAGCA-3′ and (reverse, B5130R)
5′-TGGCACGTGTTTCATAGGTCT-3′ (expected product length, 1,850 bp); and (2) (forward, B1350F)
5′-ATCATA CAGGCGGGCACGAGT-3′ and (reverse, B1205R) 5′- CCCTTCACCTATGCTAATCAAATC-3′ (expected
product length, 1,426 bp). For PCR, the final reaction volume of 25 µlconsisted of 2.5 µl of 10x L.A Taq Polymerase buffer, 4.0
µl of dNTP mixture (2.5 mM each), 0.25 µl of LA
Taq Polymerase (Takara Bio, Inc.), 0.5 µl forward (DPF)
and reverse (DPF) primers each, 2.5 µl of cDNA template, and 14.75
µl of ddH2O. The PCR cycling conditions consisted of 95°C for 5 min
followed by 35 cycles of 94°C for 1 min, 52°C for 1 min, 72°C for 1 min and a final
extension step at 72°C for 10 min in an automated thermal cycler (Bio-Rad Laboratories,
Inc., Hercules, CA, U.S.A.). 3′-RACE PCR and amplification of the ORF1b/ORF2 region were
performed under the same conditions as for the PCR analysis described above with cycling set
at 58°C as the annealing temperature for 3′RACE and 56°C as the annealing temperature for
amplification of the ORF1b/ORF2 region and an elongation step at 72°C for 1 min for each 1
kb.
The PCR products of expected sizes were purified and then cloned into pMD18-T plasmid
vectors (Takara Bio, Inc.), which were then used to transform competent Escherichia
coli Top 10 cells. The recombinant plasmids were submitted in duplicate for DNA
sequencing to Invitrogen Biotech (Beijing, China). Editing and assembly of nucleotide
sequences were performed using the SeqMan program included in the Lasergene 7 Genomics Suite
(DNAstar, Inc., Madison, WI, U.S.A.).
Assessment of the co-infection status of BAstV with other bovine gastrointestinal
viruses: The status of a combination of astrovirus with other gastrointestinal
viruses was assessed by RT-PCR.
Phylogenetic and genome analysis: Phylogenetic trees were constructed
based on the nucleotide sequences of both partial and full-length ORF2 sequences using the
Bootstrap Test Phylogeny algorithm with the neighbor-joining method included in the MEGA 4.1
software package (http://www.megasoftware.net/). Sequences were compared with those of other
mammalian astroviruses. Pair distances of nucleotide sequences between bovine and water
buffalo astroviruses, as well as the ORF1b/ORF2 junction, were analyzed using DNAstar
software (Lasergene 7; MegAlign Program with the ClustalW sequence
alignment algorithm).

Target gene deletion mutant of UvGAP1 was generated using a gene replacement strategy assisted by the CRISPR‐Cas9 system as described previously (Cao et al., 2021 ). The gene replacement vector pMD19‐UvGAP1 (Table S3) was constructed by insertion of the hygromycin gene (HYG) between the two flanking sequences (approximately 1.5 kb) of UvGAP1. The CRISPR‐Cas9 vector gRNA‐UvGAP1 was constructed by cloning gRNA spacers to the BsmBI site of pmCas9:tRp‐gRNA (Liang et al., 2018 (link)). The resulting vectors, pMD19‐UvGAP1 and gRNA‐UvGAP1, were co‐transformed into protoplasts of the wild‐type strain P‐1 by polyethylene glycol‐mediated transformation. Hygromycin‐resistant transformants were isolated and screened by PCR, which were then confirmed by sequencing. A similar approach was used to generate UvGAP2 and UvGAP3 deletion mutants. All primers used in this study were listed in Table S2.
For complementation assays, a fragment amplified with primers UvGAP1‐comF/comR (Table S2), containing a 1.5‐kb native promoter region and a full‐length UvGAP1 gene‐coding region was cloned into vector pKO1‐NEO (G‐418 resistance). The vector pKO1‐UvGAP1 was transformed into ∆Uvgap1 mutants through Agrobacterium tumefaciens‐mediated transformation (Lv et al., 2016 (link)). Positive transformants were selected on PSA plates supplemented with 800 μg/mL antibiotic G‐418, which were then confirmed by RT‐qPCR (Figure S2e,f). A similar approach was used to generate UvGAP2 complementation strains.