ResFinder 4.0 contains four databases including AMR genes (ResFinder), chromosomal gene mutations mediating AMR (PointFinder), translation of genotypes into phenotypes and species-specific panels for in silico antibiograms. The databases of ResFinder15 (link) and PointFinder16 (link) were reviewed by experts and, when necessary, entries were removed or added. Furthermore, the PointFinder database was extended to include chromosomal gene mutations leading to ampicillin resistance in Enterococcus faecium, ciprofloxacin resistance in E. faecium and Enterococcus faecalis, and resistance to cefoxitin, chloramphenicol, ciprofloxacin, fusidic acid, linezolid, mupirocin, quinupristin–dalfopristin, rifampicin and trimethoprim in Staphylococcus aureus. The genotype-to-phenotype tables were created by experts, by using additional databases (www.bldb.eu for β-lactam resistance genes,18 (link) http://faculty.washington.edu/marilynr/ for tetracycline as well as macrolide, lincosamide, streptogramin and oxazolidinone resistance genes) and by performing extensive literature searches. In the genotype-to-phenotype tables, the ResFinder and PointFinder entries have been associated with an AMR phenotype both at the antimicrobial class and at the antimicrobial compound level. A selection of antimicrobial compounds within each class was made to include antimicrobial agents important for clinical and surveillance purposes for the different bacterial species included (Table S1 , available as Supplementary data at JAC Online). The genotype-to-phenotype tables also include: (i) the PubMed ID of relevant literature describing the respective AMR determinants and phenotypes, when available; (ii) the mechanism of resistance by which each AMR determinant functions; and (iii) notes, which may contain different information such as warnings on variable expression levels (inducible resistance, cryptic genes in some species, etc.), structural and functional information, and alternative nomenclature.
>
Chemicals & Drugs
>
Antibiotic
>
Chloramphenicol
Chloramphenicol
Chloramphenicol is a broad-spectrum antibiotic used to treat a variety of bacterial infections.
It works by inhibiting protein synthesis in bacterial cells, making it effective against both Gram-positive and Gram-negative bacteria.
Chloramphenicol is commonly used to treat eye infections, meningitis, and typhoid fever, among other conditions.
However, its use has been limited due to the risk of serious side effects, including aplastic anemia.
Researchers can use PubCompare.ai to quickly identify optimized protocols for working with Chloramphenicol, streamlining their workflow and promoting reproducible research.
It works by inhibiting protein synthesis in bacterial cells, making it effective against both Gram-positive and Gram-negative bacteria.
Chloramphenicol is commonly used to treat eye infections, meningitis, and typhoid fever, among other conditions.
However, its use has been limited due to the risk of serious side effects, including aplastic anemia.
Researchers can use PubCompare.ai to quickly identify optimized protocols for working with Chloramphenicol, streamlining their workflow and promoting reproducible research.
Most cited protocols related to «Chloramphenicol»
Antibiogram
Bacteria
Cefoxitin
CFC1 protein, human
Chloramphenicol
Chromosomes
Ciprofloxacin
Enterococcus faecalis
Enterococcus faecium
Faculty
fluoromethyl 2,2-difluoro-1-(trifluoromethyl)vinyl ether
Fusidic Acid
Genes
Genotype
Lactams
Lincosamides
Linezolid
Macrolides
Microbicides
Mupirocin
Mutation
Oxazolidinones
Phenotype
quinupristin-dalfopristin
Rifampin
Staphylococcus aureus
Streptogramins
Tetracycline
Trimethoprim
The mariner-based transposon (Tn) bursa aurealis was used to generate random Tn insertion mutations in S. aureus strain JE2 essentially as described by Bae et al. (4 (link), 43 (link)). First, bacteriophage ϕ11 was used to transduce the bursa aurealis delivery plasmid pBursa into JE2 containing the transposase-encoding plasmid pFA545, with selection on TSA medium containing chloramphenicol (Cm) (10 µg/ml) and Tet (5 µg/ml). After growth for 48 h at 30°C to allow for transposition events, one colony was resuspended in 100 µl of prewarmed 45°C water and then 10 µl was plated onto TSA plates containing erythromycin (Erm) (25 µg/ml) and grown at 45°C for 12 to 24 h. Resulting colonies, irrespective of colony size, were then screened for loss of the temperature-sensitive plasmids pBursa and pFA545 by patching them on TSA-Erm (25 µg/ml), TSA-Cm (10 µg/ml), and TSA-Tet (5 µg/ml). Those colonies that were Cm and Tet susceptible but resistant to Erm were arrayed into 1-ml deep-well plates containing 400 µl of TSB-Erm (5 µg/ml) and grown at 37°C overnight. The next day, 400 µl of 50% glycerol was added to each well and the plates were stored in a −80°C freezer.
To identify the locations of the bursa aurealis transposon insertions, 400 µl of TSB-Erm (5 µg/ml) was inoculated into 96-well plates using a 96-prong replicator. After overnight growth, the Wizard genomic DNA purification kit (Promega) was used to isolate genomic DNA from the cultures with the following modifications. Briefly, after centrifugation at 4,100 rpm for 5 min in a Sorvall (Newtown, CT) Legend tabletop centrifuge, supernatants were removed, the content of each well was resuspended in 110 µl of 50 mM EDTA (pH 8.0), and 5 µl of 10-mg/ml lysostaphin was added. After incubation at 37°C for 60 min, 600 µl of Nuclei Lysis solution was added and the genomic DNA was collected according to the manufacturer’s instructions. After resuspension in Tris-EDTA (TE) buffer, approximately 2 µg of genomic DNA was digested with 10 units of AciI (New England Biolabs) at 37°C for 4 h. AciI was then heat inactivated at 65°C for 30 min; T4 DNA ligase (200 U) (Monserate Biotechnologies, San Diego, CA) was then added to each sample and ligated overnight at 4°C, followed by heat inactivation at 65°C for 30 min. DNA fragments spanning the bursa aurealis insertion sites in each sample were amplified using the Buster (5′ GCTTTTTCTAAATGTTTTTTAAGTAAATCAAGTACC 3′) and Martn-ermR (5′ AAACTGATTTTTAGTAAACAGTTGACGATATTC 3′) primer set. PCR conditions included 30 cycles with an annealing temperature of 63°C and an extension time of 3 min. Once amplified, samples of the DNA products were separated in a 1% agarose gel by electrophoresis, and the remainder was purified for sequencing using Exo-SAP-IT (GE Healthcare) according to the manufacturer’s instructions. Finally, determination of the nucleotide sequences of the genomic DNA flanking the transposons was achieved using the Buster primer at the DNA Microarray and Sequencing Core Facility at the University of Nebraska Medical Center.
To identify the locations of the bursa aurealis transposon insertions, 400 µl of TSB-Erm (5 µg/ml) was inoculated into 96-well plates using a 96-prong replicator. After overnight growth, the Wizard genomic DNA purification kit (Promega) was used to isolate genomic DNA from the cultures with the following modifications. Briefly, after centrifugation at 4,100 rpm for 5 min in a Sorvall (Newtown, CT) Legend tabletop centrifuge, supernatants were removed, the content of each well was resuspended in 110 µl of 50 mM EDTA (pH 8.0), and 5 µl of 10-mg/ml lysostaphin was added. After incubation at 37°C for 60 min, 600 µl of Nuclei Lysis solution was added and the genomic DNA was collected according to the manufacturer’s instructions. After resuspension in Tris-EDTA (TE) buffer, approximately 2 µg of genomic DNA was digested with 10 units of AciI (New England Biolabs) at 37°C for 4 h. AciI was then heat inactivated at 65°C for 30 min; T4 DNA ligase (200 U) (Monserate Biotechnologies, San Diego, CA) was then added to each sample and ligated overnight at 4°C, followed by heat inactivation at 65°C for 30 min. DNA fragments spanning the bursa aurealis insertion sites in each sample were amplified using the Buster (5′ GCTTTTTCTAAATGTTTTTTAAGTAAATCAAGTACC 3′) and Martn-ermR (5′ AAACTGATTTTTAGTAAACAGTTGACGATATTC 3′) primer set. PCR conditions included 30 cycles with an annealing temperature of 63°C and an extension time of 3 min. Once amplified, samples of the DNA products were separated in a 1% agarose gel by electrophoresis, and the remainder was purified for sequencing using Exo-SAP-IT (GE Healthcare) according to the manufacturer’s instructions. Finally, determination of the nucleotide sequences of the genomic DNA flanking the transposons was achieved using the Buster primer at the DNA Microarray and Sequencing Core Facility at the University of Nebraska Medical Center.
Bacteriophages
Cell Nucleus
Centrifugation
Chloramphenicol
DNA Chips
DNA Primers
Edetic Acid
Electrophoresis
Erythromycin
Genome
Glycerin
Jumping Genes
Lysostaphin
Microarray Analysis
Obstetric Delivery
Oligonucleotide Primers
Plasmids
Promega
Sepharose
Sequence Determinations, DNA
Strains
Synovial Bursa
T4 DNA Ligase
Transposase
Tromethamine
The second dataset, published by Holt et al. [24 (link)], consists of 130 globally distributed genomes of Shigella sonnei (Table S2), a Gram-negative bacterium that is a causative agent of dysentery. It enabled a comparison of ARIBA, SRST2, and KmerResistance with the manual method employed in the study of Holt et al. [24 (link)], confirming the accuracy of ARIBA for identifying known resistance SNPs as well as the presence or absence of genes of interest.
The phenotypic resistance profile for a number of antimicrobials is known for each isolate, and is attributable to both acquired resistance genes and SNPs. The three tools were run on all 130 samples using the reference database from CARD, version 1.1.2. To ensure our results were comparable with those originally reported in Table S1 of Holt et al. [24 (link)], we manually added those AMR genes listed on page 4 of their supplementary text not already included in the database (Table S3). The AMR determinants originally reported in the study of Holt et al. [24 (link)] were identified from mapping data, and reported as the proportion of bases in the gene sequence that were covered by reads from each isolate. From these originally reported data, we used a cut-off of> 90 % to indicate that a gene was present by their method.
In order to interpret the output of each tool as an AMR call, the following rules were used, where all relevant genes are listed in Table S4. A gene was counted as present by ARIBA if ariba summary reported yes or yes_nonunique; present by KmerResistance if it appeared in its output file; and present by SRST2 if it was reported without a ‘?’.
The focus for the genes of interest for each AMR call were those originally identified and reported in Holt et al. [24 (link)]. Given that the discovery and classification of AMR gene variants is an ongoing process, an AMR gene was called as present if it was either the originally identified gene in Holt et al. [24 (link)], or in the same CD-HIT cluster. Genes conferring resistance to antimicrobials not examined in the original paper were excluded, as were genes conferring resistance to the antimicrobials examined in the paper but falling in different CD-HIT clusters from the originally identified genes. For each antimicrobial examined, an AMR call for a resistant genotype was identified using the following rules. Ampicillin (Amp): the presence of any gene from a set of blaTEM, blaCTX-M and blaOXA genes. Chloramphenicol (Cmp): the presence of any gene from a set of cat genes. Nalidixic acid (Nal): the gyrA gene present, together with one of the SNPs S83L, D87G, or D87Y. Streptomycin (Str): both of the strA and strB genes, or one of the aadA genes. Sulfonamides (Sul): any gene from the set of sul1 and sul2 genes. Tetracycline (Tet): both of tetA +tetR, or all of tetA, C, D, R, where each of the two sets of tetA and tetR genes are disjoint. Trimethoprim (Tmp): any one of a set of dfrA or dhfr genes.
The phenotypic resistance profile for a number of antimicrobials is known for each isolate, and is attributable to both acquired resistance genes and SNPs. The three tools were run on all 130 samples using the reference database from CARD, version 1.1.2. To ensure our results were comparable with those originally reported in Table S1 of Holt et al. [24 (link)], we manually added those AMR genes listed on page 4 of their supplementary text not already included in the database (Table S3). The AMR determinants originally reported in the study of Holt et al. [24 (link)] were identified from mapping data, and reported as the proportion of bases in the gene sequence that were covered by reads from each isolate. From these originally reported data, we used a cut-off of
In order to interpret the output of each tool as an AMR call, the following rules were used, where all relevant genes are listed in Table S4. A gene was counted as present by ARIBA if ariba summary reported yes or yes_nonunique; present by KmerResistance if it appeared in its output file; and present by SRST2 if it was reported without a ‘?’.
The focus for the genes of interest for each AMR call were those originally identified and reported in Holt et al. [24 (link)]. Given that the discovery and classification of AMR gene variants is an ongoing process, an AMR gene was called as present if it was either the originally identified gene in Holt et al. [24 (link)], or in the same CD-HIT cluster. Genes conferring resistance to antimicrobials not examined in the original paper were excluded, as were genes conferring resistance to the antimicrobials examined in the paper but falling in different CD-HIT clusters from the originally identified genes. For each antimicrobial examined, an AMR call for a resistant genotype was identified using the following rules. Ampicillin (Amp): the presence of any gene from a set of blaTEM, blaCTX-M and blaOXA genes. Chloramphenicol (Cmp): the presence of any gene from a set of cat genes. Nalidixic acid (Nal): the gyrA gene present, together with one of the SNPs S83L, D87G, or D87Y. Streptomycin (Str): both of the strA and strB genes, or one of the aadA genes. Sulfonamides (Sul): any gene from the set of sul1 and sul2 genes. Tetracycline (Tet): both of tetA +tetR, or all of tetA, C, D, R, where each of the two sets of tetA and tetR genes are disjoint. Trimethoprim (Tmp): any one of a set of dfrA or dhfr genes.
Full text: Click here
4,4-difluororetinoic acid
Ampicillin
Chloramphenicol
Drug Resistance, Microbial
Dysentery
Gene Clusters
Genes
Genetic Diversity
Genome
Genotype
Gram Negative Bacteria
Microbicides
Nalidixic Acid
Phenotype
Shigella sonnei
Single Nucleotide Polymorphism
Streptomycin
Sulfonamides
Tetracycline
Trientine
Trimethoprim
Ampicillin
Arabinose
Cell Culture Techniques
Cells
Chloramphenicol
Cloning Vectors
Electroporation
Escherichia coli
Genes
Genes, Reporter
Genome
Insertion Mutation
Inverse PCR
Kanamycin
Plasmids
Proteins
Recombination, Genetic
Replication Origin
Strains
Transcription Initiation Site
In the G12D Nras experiment, the selected Gal− clones were analyzed by SpeI digestion of BAC miniprep DNA using unmodified CITB 50J2 BAC DNA as a control. Clones without rearrangements were analyzed by PCR using 1 μl BAC miniprep DNA as the template. The PCR products were gel purified and sequenced using the same primers as were used for PCR. Primers flanking the targeted mutation were: Nras test F: 5′-CACTCATCTGCAAGGAATGCT-3′; Nras test R: 5′-CCTCAGTAAGCACGAACTTGT-3′. PCR conditions were 94°C for 15 s, 60°C for 30 s and 72°C for 30 s, for 30 cycles. Modifications of the RP23-341F12 BAC (50, 75 and 100 kb deletions and the introduction of a loxP511 site) were tested by SpeI restriction analysis of BAC miniprep DNA and compared with unmodified 341F12 BAC DNA. In the loxP511 experiment, clones 3, 5 and 6 were further tested for correct insertion of the loxP511 site by transforming 1 μl of BAC miniprep DNA into electrocompetent and arabinose-induced EL350 cells (11 (link)) and plating on LB plates with chloramphenicol. Two colonies from each starting clone were tested by SpeI digestion of BAC miniprep DNA for the 95 kb Cre-mediated deletion. Finally, the Cre-recombined clones were tested by PCR with one primer mapping to the end of the pBACe3.6 BAC backbone and the other mapping to a position 95 kb away on the wild-type BAC. The primers (Invitrogen) used for this analysis were: 95 kb loxP511 check F: 5′-GCGGATGAATGGCAGAAATTC-3′; 95 kb LoxP511 check R: 5′-TTTGCCAGACTGGTGCCTAA-3′. PCR conditions were 94°C for 15 s, 60°C for 30 s and 72°C for 30 s, for 30 cycles. The resulting PCR bands were gel purified and confirmed by sequencing using the same primers as were used for the PCR amplification. The follow-up experiment for testing the source of the observed BAC deletions was done as described above.
Arabinose
Cells
Chloramphenicol
Clone Cells
Deletion Mutation
Digestion
Gene Deletion
Gene Rearrangement
Mutagenesis, Site-Directed
NRAS protein, human
Oligonucleotide Primers
Vertebral Column
Most recents protocols related to «Chloramphenicol»
Example 1
This example describes the generation of a marker-free B. subtilis strain expressing allulose epimerase. Briefly, in a first step, a B. subtilis strain was transformed with a cassette encoding the BMCGD1 epimerase and including an antibiotic resistance marker. This cassette recombined into the Bacillus chromosome and knocked out 8 kb of DNA, including a large sporulation gene cluster and the lysine biosynthesis gene lysA. In a second step, a second cassette was recombined into the B. subtilis chromosome, restoring the lysA gene and removing DNA encoding the antibiotic resistance. E. coli strain 39 A10 from the Keio collection was used to passage plasmid DNA prior to transformation of B. subtilis. The relevant phenotype is a deficiency in the DNA methylase HsdM in an otherwise wild-type K-12 strain of E. coli.
In detail, a cassette of 5120 bp (SEQ ID NO:1; synthetic DNA from IDT, Coralville, Iowa) was synthesized and cloned into a standard ampicillin resistant pIDT vector. The synthetic piece encoded 700 bp upstream of lysA on the B. subtilis chromosome, the antibiotic marker cat (651 bp), the DNA-binding protein lad (1083 bp), and the allulose epimerase (894 bp), and included 700 bp of homology in dacF. This vector was transformed into E. coli strain 39 A10 (Baba et al., 2006), and plasmid DNA was prepared and transformed into B. subtilis strains 1A751 and 1A976.
Transformants were selected on LB supplemented with chloramphenicol. The replicon for pIDT is functional in E. coli but does not work in Gram positive bacteria such as B. subtilis. The colonies that arose therefore represented an integration event into the chromosome. In strain 1A751, the colony morphology on the plates was used to distinguish between single and double recombination events. The double recombination event would knock out genes required for sporulation, whereas the single recombination would not. After three days on LB plates, colonies capable of sporulation were brown and opaque; sporulation-deficient colonies were more translucent.
B. subtilis strain 1A976 with the allulose epimerase cassette is auxotrophic for histidine and lysine and can achieve very high transformation efficiency upon xylose induction. A 1925 bp synthetic DNA (SEQ ID NO:2) was amplified by primers (SEQ ID NO:3, SEQ ID NO:4) and Taq polymerase (Promega). This PCR product encoded the lysA gene that was deleted by the dropping in the epimerase cassette and 500 bp of homology to lad. A successful double recombination event of this DNA should result in colonies that are prototrophic for lysine and sensitive to chloramphenicol; i.e., the entire cat gene should be lost.
Transformants were selected on Davis minimal media supplemented with histidine. Colonies that arose were characterized by PCR and streaking onto LB with and without chloramphenicol. Strains that amplified the introduced DNA and that were chloramphenicol sensitive were further characterized, and their chromosomal DNA was extracted.
Strain 1A751 containing the chloramphenicol resistant allulose was transformed with this chromosomal DNA and selected on Davis minimal media supplemented with histidine. Transformants were streaked onto LB with and without chloramphenicol and characterized enzymatically as described below.
Full text: Click here
Ampicillin
Anabolism
Antibiotic Resistance, Microbial
Antibiotics
Bacillus
Bacillus subtilis
Chloramphenicol
Chromosomes
Cloning Vectors
DNA, A-Form
DNA-Binding Proteins
Epimerases
Escherichia coli
Gene Clusters
Gene Knockout Techniques
Genes
Gram-Positive Bacteria
Histidine
Lysine
Methyltransferase
Oligonucleotide Primers
Phenotype
Plasmids
psicose
Recombination, Genetic
Replicon
Strains
Taq Polymerase
Xylose
The urine samples were centrifuged at 3000 rpm for 2 min and emulsified HVS samples in peptone water; 20 ul of the urine deposit or the emulsified HVS were spread on the SDA agar plate using a sterilized glass rod. Urine and the HVS samples were cultured on Sabourauds dextrose agar plates, containing 0.5 mg per 1000 ml chloramphenicol and incubated at 37 o C and examined for its growth at 24, 48 and 72 h. The culture plates were examined for the appearance, size, cream-coloured pastry colonies and morphology of the colonies [19 ].
Full text: Click here
Agar
Chloramphenicol
Glucose
Peptones
Urine
Cultures were grown overnight at 37° C in LB media containing 2% w/v glucose, 50 μg/ml spectinomycin, and 1 mM IPTG. The overnight cultures were then diluted to an OD of 1 × 10−5 before 50 μl of diluted culture was added to a plate and spread with an L-shaped spreader. Plates were made with 20 ml of LB-agar containing 2% w/v glucose, 50 μg/ml spectinomycin, and 1 mM IPTG. Differing levels of antibiotic were added to each plate depending on the MIC for the wild-type protein. For CAT-I, plates were made with 0, 16, 32, 64, 128, 256, 512, and 1024 μg/ml chloramphenicol. For NDM-1, plates were made with 0, 32, 64, 128, 256, 512, 1024, 2048, and 4096 μg/ml ampicillin. For AadB, plates were made with 0, 8, 16, 32, 64, 128, 256, and 512 μg/ml kanamycin. Plates were incubated for 16 h at 37° C before colonies were counted. We identified the MIC as the antibiotic concentration at which there were fewer than 5% of the colony forming units (CFU) relative to a plate without antibiotics.
Agar
Ampicillin
Antibiotics
Antibiotics, Antitubercular
Chloramphenicol
Chloramphenicol O-Acetyltransferase
Glucose
Isopropyl Thiogalactoside
Kanamycin
Proteins
Spectinomycin
AST was performed by the broth microdilution method using the VITEK 2 Compact System (BioMerieux, Lyon, France). The antimicrobial agents tested included piperacillin/tazobactam (TZP), cefoxitin (FOX), cefuroxime (CXM), ceftazidime (CAZ), cefotaxime (CTX), cefepime (FEP), imipenem (IPM), meropenem (MPN), amikacin (AMK), gentamicin (GEN), ciprofloxacin (CIP), levofloxacin (LEV), tetracycline (TE), trimethoprim/sulfamethoxazole (STX), chloramphenicol (C), and aztreonam (ATM), The minimum inhibitory concentrations (MICs) were interpreted according to the recommendations of the Clinical and Laboratory Standards Institute (CLSI) for Aeromonas spp. (Institute, 2015 ) E.coli ATCC25922 was used as the quality-control strain. Multidrug resistance (MDR) was defined as non-susceptibility to at least one agent in three or more antimicrobial categories (Magiorakos et al., 2012 (link)).
Full text: Click here
Aeromonas
Amikacin
Aztreonam
Cefepime
Cefotaxime
Cefoxitin
Ceftazidime
Cefuroxime
Chloramphenicol
Ciprofloxacin
Clinical Laboratory Services
Escherichia coli
Gentamicin
Imipenem
Levofloxacin
Meropenem
Microbicides
Minimum Inhibitory Concentration
Multi-Drug Resistance
Piperacillin-Tazobactam Combination Product
Strains
Susceptibility, Disease
Tetracycline
Trimethoprim-Sulfamethoxazole Combination
The bacterial strains and plasmids used in this study are listed in Table 1 . The primers used are listed in Table 2 . When necessary, the corresponding antibiotics (100 μg/ml ampicillin and 50 μg/ml kanamycin) were added to the medium. S. aureus was usually cultured in Tryptone Soy Broth medium at 37°C and 220 rpm, to which 15 μg/ml chloramphenicol and 10 μg/ml erythromycin were added when necessary.
Full text: Click here
Ampicillin
Antibiotics, Antitubercular
Bacteria
Chloramphenicol
Culture Media
Erythromycin
Kanamycin
Oligonucleotide Primers
Plasmids
Staphylococcus aureus
Strains
Top products related to «Chloramphenicol»
Sourced in United States, Germany, France, United Kingdom, Italy, China, Australia, Israel, Switzerland, Spain, India, Sao Tome and Principe, Brazil, Canada, Belgium, Czechia, Mexico, Poland, Ireland
Chloramphenicol is a bacteriostatic antibiotic that inhibits protein synthesis in bacteria. It is commonly used in microbiology laboratories for selective cultivation and identification of bacterial species.
Sourced in United States, Germany, United Kingdom, France, China, Switzerland, Sao Tome and Principe, Spain, Ireland, India, Italy, Japan, Brazil, Australia, Canada, Macao, Czechia, New Zealand, Belgium, Cameroon, Austria, Israel, Norway, Denmark, Netherlands
Ampicillin is a broad-spectrum antibiotic used in laboratory settings. It is a penicillin-based compound effective against a variety of gram-positive and gram-negative bacteria. Ampicillin functions by inhibiting cell wall synthesis, leading to bacterial cell lysis and death.
Sourced in United Kingdom, United States, Italy, Germany, Canada, China, Australia
Chloramphenicol is a broad-spectrum antibiotic used in various laboratory applications. It is commonly employed as a selective agent in bacterial cell culture and transformation experiments.
Sourced in United States, Germany, United Kingdom, France, Spain, China, Israel, India, Canada, Macao, Australia, Sao Tome and Principe, Belgium, Sweden, Poland, Japan, Switzerland, Brazil, Italy, Ireland
Kanamycin is a broad-spectrum antibiotic derived from the bacterium Streptomyces kanamyceticus. It is commonly used as a selective agent in molecular biology and microbiology laboratories for the growth and selection of bacteria that have been genetically modified to express a gene of interest.
Sourced in United States, Germany, United Kingdom, France, Australia, Italy, China, Switzerland, Denmark, India, Czechia, Poland, Sao Tome and Principe, Japan, Sweden
Tetracycline is a type of antibiotic used for laboratory testing and research. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Tetracycline is commonly used in microbiological studies and antimicrobial susceptibility testing.
Sourced in United States, Germany, France, United Kingdom, Italy, Sao Tome and Principe, Australia, China, Switzerland, Spain, Japan, Belgium, Macao
Erythromycin is a macrolide antibiotic produced by the bacterium Saccharopolyspora erythraea. It functions as a protein synthesis inhibitor by binding to the 50S subunit of the bacterial ribosome, preventing the translocation of the peptidyl-tRNA from the A-site to the P-site during translation.
Sourced in United Kingdom, United States, China, Germany, Belgium, Italy, Australia
Ampicillin is an antibiotic that is commonly used in microbiology and molecular biology laboratories. It is a broad-spectrum penicillin-type antibiotic that inhibits the synthesis of bacterial cell walls, effectively killing or preventing the growth of susceptible bacteria.
Sourced in United Kingdom, United States, Germany, Italy, Belgium, Ireland, India
Ciprofloxacin is a synthetic antibiotic that belongs to the fluoroquinolone class. It is a broad-spectrum antimicrobial agent effective against a variety of Gram-positive and Gram-negative bacteria.
Sourced in United Kingdom, United States, Germany
Tetracycline is a broad-spectrum antibiotic used in laboratory settings. It functions as an inhibitor of bacterial protein synthesis.
Sourced in United Kingdom, United States, Italy, Germany, France, India, Spain, China
Mueller-Hinton agar is a microbiological growth medium used for the antimicrobial susceptibility testing of bacteria. It is a standardized agar formulation that supports the growth of a wide range of bacteria and allows for the consistent evaluation of their susceptibility to various antimicrobial agents.
More about "Chloramphenicol"
Chloramphenicol, a broad-spectrum antibiotic, is widely used to treat a variety of bacterial infections.
This antimicrobial agent works by inhibiting protein synthesis in bacterial cells, making it effective against both Gram-positive and Gram-negative bacteria.
Commonly used to address eye infections, meningitis, and typhoid fever, Chloramphenicol's applications extend to other conditions as well.
However, its usage has been limited due to the risk of serious side effects, including the potentially life-threatening condition of aplastic anemia.
Researchers can leverage PubCompare.ai to quickly identify optimized protocols for working with Chloramphenicol, streamlining their workflow and promoting reproducible research.
The platform helps users locate the best protocols from literature, pre-prints, and patents, using AI-driven comparisons to identify the most effective techniques and products.
This includes not only Chloramphenicol, but also other commonly used antibiotics like Ampicillin, Kanamycin, Tetracycline, Erythromycin, and Ciprofloxacin.
When conducting antimicrobial research, it's important to consider factors like growth media, such as Mueller-Hinton agar, which is widely used for susceptibility testing.
By utilizing PubCompare.ai, researchers can experience seamless workflow optimization, leading to more efficient and reproducible studies on Chloramphenicol and related antimicrobial agents.
This antimicrobial agent works by inhibiting protein synthesis in bacterial cells, making it effective against both Gram-positive and Gram-negative bacteria.
Commonly used to address eye infections, meningitis, and typhoid fever, Chloramphenicol's applications extend to other conditions as well.
However, its usage has been limited due to the risk of serious side effects, including the potentially life-threatening condition of aplastic anemia.
Researchers can leverage PubCompare.ai to quickly identify optimized protocols for working with Chloramphenicol, streamlining their workflow and promoting reproducible research.
The platform helps users locate the best protocols from literature, pre-prints, and patents, using AI-driven comparisons to identify the most effective techniques and products.
This includes not only Chloramphenicol, but also other commonly used antibiotics like Ampicillin, Kanamycin, Tetracycline, Erythromycin, and Ciprofloxacin.
When conducting antimicrobial research, it's important to consider factors like growth media, such as Mueller-Hinton agar, which is widely used for susceptibility testing.
By utilizing PubCompare.ai, researchers can experience seamless workflow optimization, leading to more efficient and reproducible studies on Chloramphenicol and related antimicrobial agents.