Trimethoprim

The second dataset, published by Holt et al. [24 (link)], consists of 130 globally distributed genomes of Shigella sonnei (Table S2), a Gram-negative bacterium that is a causative agent of dysentery. It enabled a comparison of ARIBA, SRST2, and KmerResistance with the manual method employed in the study of Holt et al. [24 (link)], confirming the accuracy of ARIBA for identifying known resistance SNPs as well as the presence or absence of genes of interest.
The phenotypic resistance profile for a number of antimicrobials is known for each isolate, and is attributable to both acquired resistance genes and SNPs. The three tools were run on all 130 samples using the reference database from CARD, version 1.1.2. To ensure our results were comparable with those originally reported in Table S1 of Holt et al. [24 (link)], we manually added those AMR genes listed on page 4 of their supplementary text not already included in the database (Table S3). The AMR determinants originally reported in the study of Holt et al. [24 (link)] were identified from mapping data, and reported as the proportion of bases in the gene sequence that were covered by reads from each isolate. From these originally reported data, we used a cut-off of >90 % to indicate that a gene was present by their method.
In order to interpret the output of each tool as an AMR call, the following rules were used, where all relevant genes are listed in Table S4. A gene was counted as present by ARIBA if ariba summary reported yes or yes_nonunique; present by KmerResistance if it appeared in its output file; and present by SRST2 if it was reported without a ‘?’.
The focus for the genes of interest for each AMR call were those originally identified and reported in Holt et al. [24 (link)]. Given that the discovery and classification of AMR gene variants is an ongoing process, an AMR gene was called as present if it was either the originally identified gene in Holt et al. [24 (link)], or in the same CD-HIT cluster. Genes conferring resistance to antimicrobials not examined in the original paper were excluded, as were genes conferring resistance to the antimicrobials examined in the paper but falling in different CD-HIT clusters from the originally identified genes. For each antimicrobial examined, an AMR call for a resistant genotype was identified using the following rules. Ampicillin (Amp): the presence of any gene from a set of blaTEM, blaCTX-M and blaOXA genes. Chloramphenicol (Cmp): the presence of any gene from a set of cat genes. Nalidixic acid (Nal): the gyrA gene present, together with one of the SNPs S83L, D87G, or D87Y. Streptomycin (Str): both of the strA and strB genes, or one of the aadA genes. Sulfonamides (Sul): any gene from the set of sul1 and sul2 genes. Tetracycline (Tet): both of tetA +tetR, or all of tetA, C, D, R, where each of the two sets of tetA and tetR genes are disjoint. Trimethoprim (Tmp): any one of a set of dfrA or dhfr genes.

All animal procedures were approved by the Institutional Animal Care and Use Committee at the Allen Institute for Brain Science. Cre lines were generated at the Allen Institute or imported from external sources for characterization. Methods used to generate BAC transgenic and knock-in Cre lines at the Allen Institute have been described previously (Madisen et al., 2010 (link)). External sources included Cre lines generated as part of the NIH Neuroscience Blueprint Cre Driver Network (www.credrivermice.org) and the GENSAT project (http://gensat.org/), as well as individual labs. Cre lines were on mixed or various backgrounds, but the majority were crossed to C57Bl6/J mice and maintained as heterozygous lines upon arrival. All Cre driver lines included in this study (n = 135) are shown in Supplemental Table 1, along with information on the method of generation (e.g., knock-in or transgenic), availability at public repositories and links to image series data available for each line through the Transgenic Characterization data portal (http://connectivity.brain-map.org/transgenic/). Lines were generated using conventional and BAC transgenic, or knock-in strategies. Knock-ins include either direct insertion of Cre at ATG start site, which disrupts endogenous gene expression, or bicistronic cassettes inserted after the targeted gene, usually in the 3′UTR using IRES, IRES2, or 2A sequences to mediate ribosomal entry or skipping (Bochkov and Palmenberg, 2006 (link); Trichas et al., 2008 (link)). The IRES2 sequence (Clontech) is a non-attenuated IRES that could result in higher levels of expression of the downstream gene (e.g., Cre). The 2A sequence used for new lines generated at the Allen Institute (Table 1) was a modified T2A (5′-ggaagcggcgagggcagaggaagtcttctgacatgcggagacgtggaagagaatcccggccctgccccaggctca-3′) or F2A (5′cgggctaagagaggttctggagcaccggtgaaacagactttgaattttgaccttctcaagttggcgggagacgtggagtccaacccagggccc-3′), as indicated in Supplemental Table 1. Lines imported from external sources have been renamed in specific cases to maintain a standard convention across all lines characterized in our pipeline; see Supplemental Table 1. Line names typically follow this order: (1) NCBI symbol for specific gene promoter, (2) an IRES, IRES2 or 2A sequence preceding Cre if present, (3) Cre, and, for all GENSAT lines, the (4) line number given by GENSAT, e.g., Ntsr1-Cre_GN220. Regulatable versions of Cre are noted by modifying “Cre” to “CreERT2” for the tamoxifen-inducible fusion protein (Feil et al., 1997 (link)) and “dCre” for a destabilized Cre fusion gene that allows recombination at loxP sites following administration of trimethoprim (Sando et al., 2013 (link)).

Genome assemblies were uploaded to Pathogenwatch v2.3.1 [46 (link)] where Kleborate v2.2 [47 (link)] and Kaptive v2.0 [17 (link)] were automatically deployed to call multi-locus sequence types (STs) using the seven-locus scheme [65 (link)], capsular polysaccharide (K) and lipopolysaccharide O locus types, and serotype predictions, acquired virulence traits including the siderophores aerobactin (iuc), yersiniabactin (ybt) and salmochelin (iro), the genotoxin colibactin (clb) and the hypermucoidy locus (rmpADC). Pathogenwatch also deploys Kleborate to identify established AMR determinants (acquired genes and chromosomal mutations) [47 (link)] for the following antimicrobial classes: aminoglycosides, carbapenems, third-generation cephalosporins, third-generation cephalosporins plus β-lactamase inhibitors, colistin, fluoroquinolones, fosfomycin, penicillins, penicillins + β-lactamase inhibitors, phenicols, sulfonamides, tetracyclines, tigecycline and trimethoprim.

11 host WT mice (male) ranging from 13 to 17 weeks of age were irradiated twice with 6.02 Gy in 4 h (Faxitron CP-160). 3 WT (male) and 3 Cxcl4^−/− (male) graft mice were sacrificed after isoflurane narcosis. Femora and tibiae were separated from muscle tissue and cleaned. Under sterile conditions, bone marrow was flushed out with syringes using phosphate buffered saline (PBS) with 2% fetal calf serum (FCS). Erythrocytes were lysed by incubating 5 min in 1x erythrocyte lysis buffer (BD Pharm Lyse) followed by two washing steps with PBS. Cell suspension was filtered through a 40 μm cell strainer. Tyrosine kinase KIT positive (cKIT+) cells were isolated by magnetic cell separation using murine cKIT-microbeads (Miltenyi Biotech) according to the manufacturer’s instructions. WT or Cxcl4^−/− cKIT⁺ stem cells were transplanted into the lethally irradiated host mice 2 h after the second radiation by retroorbital injection of 5 × 10⁵ cKit⁺ cells per mouse (6x WT, 5x Cxcl4^−/−). To protect against infections during engraftment, antibiotics (Sulfadimethoxin & Trimethoprim, 95 mg/kg BW) were added to drinking water for 21 days after transplantation. 28 days after transplantation, success of hematopoietic stem cell engraftment was checked by taking blood samples and monitoring blood count. Mice were subjected to IRI or sham surgery as described before.