> Chemicals & Drugs > Biologically Active Substance > Antisense Oligonucleotides

Antisense Oligonucleotides

Antisense Oligonucleotides are short, synthetic strands of nucleic acids that can bind to and inactivate specific messenger RNA (mRNA) molecules, preventing the production of targeted proteins.
This powerful technology has emerged as a promising therapeutic approach for a wide range of diseases, including cancer, viral infections, and genetic disorders.
PubCompare.ai leverages the latest advancements in artificial intelligence to streamline your antisense oligonucleotide research, unlocking protocols from literature, preprints, and patents, and providing intelligent comparisons to help you identify the best products and protocols.
With PubCompare.ai, you can discover the full potential of this cutting-edge technology and accelerate your breakthroughs in this rapidly evolving field.

Most cited protocols related to «Antisense Oligonucleotides»

Profiling miRNA-regulated Gene Expression

We retrieved the microarray data reported by Hafner et al. [21 (link)]. In this microarray analysis, 25 miRNAs were inhibited by antisense oligonucleotide inhibitors, and the impact on gene expression was assessed with Affymetrix Human U133Plus2 chips. Raw microarray data were downloaded from the NCBI GEO database (accession# GSE21577), and then normalized using the Bioconductor RMA method (http://www.bioconductor.org). We focused our analysis only on genes with detectable expression. Changes in gene expression due to miRNA inhibition were determined by comparing to the negative controls.

Liu W, & Wang X. (2019). Prediction of functional microRNA targets by integrative modeling of microRNA binding and target expression data. Genome Biology, 20, 18.

Publication 2019

Antisense Oligonucleotides DNA Chips Gene Expression Genes Homo sapiens inhibitors Microarray Analysis MicroRNAs Psychological Inhibition

Measuring Programmed Ribosomal Frameshifting

Escherichia coli strain DH5α was used to amplify plasmids, and E.coli transformations were performed using the high efficiency method of Inoue et al. (13 (link)). YPAD and synthetic complete medium (H-) were used as described previously (14 (link)). Yeast strain JD932 (MATa ade2-1 trp1-1 ura3-1 leu2-3,112 his3-11,15 can1-100) (15 (link)) was used for in vivo measurement of programmed −1 ribosomal frameshifting. Yeast cells were transformed using the alkali cation method (16 (link)). Dual luciferase plasmids pJD375 (C₁, no frameshift signal) and pJD376 (F₁, L-A virus gag-pol frameshift signal) have been described previously (7 (link)). Putative frameshift signals from S.cerevisiae genes YOR026W/BUB3 (F₂, plasmid pJD519) and YPL128C/TBF1 (F₃, plasmid pJD478) were constructed as follows: (i) oligonucleotides from Integrated DNA Technology (Coralville, IA) were annealed and gel purified, and (ii) annealing the oligonucleotides 5′-TCGACAAAAAATCATCTTTCAGGGTGGATTGGAACGGCCCCAGTGATCCTGAGAACCCACAAAACTGGCCCG-3′ to 5′-GATCCGGGCCAGTTTTGTGGGTTCTCAGGATCACTGGGGCCGTTCCAATCCACCCTGAAAGATGATTTTTTG-3′ (F₂), and 5′-CGACAAATTTATCTCAAGCATCCTTCATCAGCTGCATCTGCTACTGAAGAGGG-3′ to 5′-GATCCTCTTCTGTAGCAGATGCAGCTGAAGAAGGATGCTGAGATAAATTTG-3′ (F₃) left overhanging single-stranded DNA complementary to SalI and BamHI restriction sites. The annealed oligonucleotides were ligated into p2mci (6 (link)). The frameshift signal was sub-cloned as a SalI–EcoRI fragment into similarly digested pJD375. The open reading frame (ORF) 1a-1b frameshift signal from the SARS-associated Coronavirus (SARS-CoV) was cloned; sense 5′-GATCCTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTCTACAGGGCTTTTGAGCT-3′ and antisense 5′-CAAAAGCCCTGTAGACGACATCAGTACTAGTGCCTGTGCCGCACGGTGTAAGACGGGCTGCACTTACACCGCAAACCCGTTTAAAAAG-3′ oligonucleotides were annealed, gel purified and cloned into BamHI and SacI restricted p2mc (6 (link)). This was further sub-cloned into a pJD375-based plasmid where the reading frame was corrected using site-directed mutagenesis to add a cytosine downstream of the BamHI restriction site (F₄). A zero-frame control (C₂) plasmid was made by inserting two cytosine residues upstream of the BamHI restriction site and cells were grown in the absence or presence of 20 μg/ml of anisomycin (Sigma–Aldrich, St. Louis, MO). The annealed oligonucleotides were ligated into p2mci (6 (link)). The SARS-CoV frameshift signal (F₄) was sub-cloned as a SalI–EcoRI fragment into similarly restricted pJD375. In vivo DLAs for programmed −1 ribosomal frameshifting were performed in yeast strain JD1158 as described previously (7 (link)). Luminescence readings were obtained using a Turner Designs TD20/20 luminometer (Sunnyvale, CA). Reactions were carried out using the Dual-Luciferase® Reporter Assay System from Promega Corporation (Madison, WI).

Jacobs J.L, & Dinman J.D. (2004). Systematic analysis of bicistronic reporter assay data. Nucleic Acids Research, 32(20), e160.

Publication 2004

Alkalies Anisomycin Antisense Oligonucleotides Biological Assay Cells Cytosine Deoxyribonuclease EcoRI DNA, Single-Stranded Escherichia coli Frameshift Mutation Genes Luciferases Luminescence Mutagenesis, Site-Directed Oligonucleotides Plasmids Promega Reading Frames Saccharomyces cerevisiae Severe acute respiratory syndrome-related coronavirus Strains tyrosinase-related protein-1 Virus

Adolescent Intermittent Ethanol Exposure Alters Amygdalar Epigenetics and Anxiety

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2019

Adolescent Adult Amygdaloid Body Antisense Oligonucleotides Anxiety Ethanol KDM6B protein, human locked nucleic acid Males Nucleus, Central Amygdaloid Rats, Sprague-Dawley Rattus RNA, Small Interfering Saline Solution

Antisense Oligonucleotide Transfection and Analysis

Antisense moroholino oligonucleotide (AMO) transfection was performed by electroporation. The sequences of the U1 and control AMOs (Gene Tools) are 5′-GGTATCTCCCCTGCCAGGTAAGTAT-3′ and 5′-CCTCTTACCTCAGTTACAATTTATA-3′, respectively23 (link),24 (link). RNase H protection assay was carried out using AMO-transfected cell extracts and antisense DNA oligo for U1 snRNA (5′-CAGGTAAGTAT-3′). After RNase H treatment, RNA samples were purified and analyzed by Northern blotting with an U1 snRNA probe (5′-CAAATTATGCAGTCGAGTTTCCCACATTTG-3′). In situ hybridization of U1 snRNA was performed with a biotin-labeled LNA probe (5′-GGTATCTCCCCTGCCAGGTAAGTAT-3′). Nuclei were stained by DAPI. For in vitro splicing, [α–³²P] UTP labeled Ad2ΔIVS pre-mRNA was prepared as previously described40 (link). In vitro splicing reactions were carried out in 293T whole cell extracts prepared as previously described41 (link). Splicing products were resolved on denaturing PAGE, and gels were autoradiographed. For tiling array, labeled cDNA targets were prepared and applied to Affymetrix® GeneChip® Human tiling 2.0R E arrays. Arrays were scanned to produce .CEL files. The .CEL files were analyzed using the Affymetrix® Tiling Analysis Software (TAS) to produce .BED files of signal intensity and p-value. Overlapping regions of two datasets were chosen using Galaxy (http://galaxy.psu.edu/)42 (link). We produced .BAR files from the .CEL files using TAS to visualize on the Integrated Genome Browser (Affymetrix). For 3′ RACE, cDNA was synthesized from total RNA using an oligo dT18-XbaKpnBam primer. The first and second (nested) PCR reactions were performed using gene specific forward primers and the XbaKpnBam reverse primer. For 3′ RACE of NR3C1 mini-gene, pcDNA3.1-5′ primer was used as the first primer to distinguish mini-gene RNA from endogenous NR3C1 RNA. To construct the NR3C1 mini-gene, DNA fragments of NR3C1 intron 1-exon 2-intron 2 and NR3C1 intron 2-exon 3 were amplified and subcloned into pcDNA3.1 vector. The poly(A) site and 5′ splice site were mutated in this construct where indicated. Sequences of all primers are listed in Supplementary Table 1.

Kaida D., Berg M.G., Younis I., Kasim M., Singh L.N., Wan L, & Dreyfuss G. (2010). U1 snRNP protects pre-mRNAs from premature cleavage and polyadenylation. Nature, 468(7324), 664-668.

Publication 2010

Antisense Oligonucleotides Biological Assay Biotin Cell Extracts Cell Nucleus Cloning Vectors DAPI DNA, Antisense DNA, Complementary Electroporation Exons Gels Gene Chips Genes Genome Homo sapiens In Situ Hybridization Introns mRNA Precursor Oligonucleotide Primers Oligonucleotides Poly A Ribonuclease H Splice Donor Site Transfection U1 small nuclear RNA

CRISPR Plasmid Construction for Human Genes

To construct CRISPR/Cas9 plasmids targeting human genes, sense and antisense oligonucleotides were synthesized and annealed in the following buffer: 40 mM Tris-HCl (pH 8.0), 20 mM MgCl₂, and 50 mM NaCl. The annealed oligonucleotides, pX330A/S vectors, BpiI enzyme (Thermo Scientific, Rockford, IL), and Quick ligase (New England Biolabs, Beverly, MA) were mixed in a single tube with T4 DNA ligase buffer (New England Biolabs), and subjected to a thermal cycling reaction as follows: 3 cycles of 37°C for 5 min and 16°C for 10 min. After the cycling reaction, additional BpiI digestion was performed at 37°C for 1 h. A list of the constructed plasmids with the vectors used and oligonucleotide sequences is shown in Supplementary Table S2.

Sakuma T., Nishikawa A., Kume S., Chayama K, & Yamamoto T. (2014). Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Scientific Reports, 4, 5400.

Publication 2014

Antisense Oligonucleotides Buffers Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Digestion Enzymes Ligase Magnesium Chloride Oligonucleotides Plasmids Sodium Chloride T4 DNA Ligase Tromethamine

Most recents protocols related to «Antisense Oligonucleotides»

Design and Synthesis of Optimized LNA Oligonucleotides

The YNRA4 fragment (32 nucleotides) was tiled with 16 bp long complementary nucleotides resulting in 17 possible designs. We mapped the full set of antisense oligonucleotides to the human transcriptome (Ensembl v84) and miRBase. Oligonucleotides with no off-targets when 3 mismatches are allowed were retained. Of the retained LNAs, we chose the oligonucleotide with the highest melting temperature (Tm). The resulting fully modified LNA (ACCCACTACCATCGGA, targeting TCCGATGGTAGTGGGT) has a Tm of 89.9 °C. In addition to the fully LNA-modified oligo, for the same sequence we ordered 2′-O-methyl and 2′-methoxy-ethoxy modified nucleotides and half modified (alternating modified – non-modified nucleotides) oligos at Integrated DNA Technologies. Sequences are available in Supplemental Table 1.

Everaert C., Verwilt J., Verniers K., Vandamme N., Marcos Rubio A., Vandesompele J, & Mestdagh P. (2023). Blocking Abundant RNA Transcripts by High-Affinity Oligonucleotides during Transcriptome Library Preparation. Biological Procedures Online, 25, 7.

Publication 2023

2',5'-oligoadenylate Antisense Oligonucleotides BP 16 Fever Homo sapiens Nucleotides Oligonucleotides Transcriptome

Xenopus Embryo Manipulation and Analysis

X. tropicalis frogs were obtained from Nasco, the National Xenopus Resource (NXR) and the European Xenopus Resource Centre (EXRC). All animal experiments were approved by the state review board of Baden-Württemberg, Regierungspräsidium Karlsruhe, Germany (permit number 35-9185.81/G-141/18). Federal and institutional guidelines and regulations were followed. Developmental stages were determined according to Nieuwkoop and Faber (Xenbase). Statistical analysis to determine sample size, sex- and gender-based analyses, and randomization of injection were not applicable in this context. In vitro fertilization and culture of embryos were performed as previously described^{62 (link)}. Antisense morpholino oligonucleotides (Mo) were obtained from GeneTools and microinjected using the Harvard Apparatus microinjection system. Morpholinos targeting ccny (10 ng per embryo^{14 (link)}), ccny^SPL (10 ng per embryo; 5’-ATGTTTCCACAGTACGAGAAAAACG-3’), ccnyl1 (10 ng per embryo^{14 (link)}), ccnyl1^SPL (10 ng per embryo; 5’-TTCATTGCAGATTTTCACGATGAGC-3’), lrp6 (5 ng per embryo^{20 (link)}), lrp^UTR (5 ng per embryo; 5’-GCTCAATGCTCCCCCGTAAGCCAGC-3’), β-catenin (10 ng per embryo^{21 (link)}), ppp1r11 (30 ng per embryo; 5’-AGAGCGGTGTTCCTGTTACGGGTAA-3’), ccdc108 (10 ng per embryo^{43 (link)}), dlg5 (10 ng per embryo^{44 (link)}), gas2l2 (5 ng per embryo^{45 (link)}), hyls-1 (10 ng per embryo^{46 (link)}) and standard control (up to 30 ng per embryo) as well as wnt8^DN mRNA (500 pg per embryo) and membraneRFP (mbRFP) mRNA (300 pg per embryo) were microinjected animally 5 nl per each embryonic blastomere. In ccny/l1 DKD, 10 ng of each Mo were co-injected either alone, or with human CCNY-Flag (250 pg per embryo)^{63 (link)} and mouse Ccnyl1-Flag mRNA (250 pg per embryo)^{14 (link)} for rescue experiments. BB marker pCS2-gfp-drCentrin 2 (100 pg per embryo) was co-injected with VF10-RFP-Clamp (150 pg per embryo) and indicated morpholinos. pCS2-gfp-drCentrin 2 was a kind gift from Wieland Huttner, and VF10-RFP-Clamp was generously provided by Gerd Walz. X. tropicalis Flag-ppp1r11 mRNA was injected at a concentration of 200 pg per embryo to investigate ciliary localization, while human ppp1r11 mRNA without Flag-Tag was injected at 25 pg and 50 pg for ppp1r11 Mo rescue experiments. In Fig. 2j, ccny/l1 morphants were rescued with 50 pg of Flag-ppp1r11 DNA. Human LRP6 WT, LRP6^(VA)P(PA) and LRP6^VA DNA were injected at a concentration of 50 pg per embryo. For GSK3 ciliary biosensor experiments, 100 pg biosensor DNA was co-injected with 100 pg of Arl13b-mKate2 DNA. Animal cap explants were dissected at St. 8 and cultured until St. 30 for live cell imaging. WNT3A recombinant protein (R&D Systems; Cat#5036-WN-010) was added at a concentration of 2 µg/ml. In Wnt stimulation of whole embryos, WNT3A was added for 30 min before fixation. Embryos were cultured until St. 28-32 unless indicated otherwise. BIO (Cayman Chemical, Cat#13123) rescue was performed from St. 8 to St. 28 by adding 60 µM BIO to the embryo culture medium. Two different modes were applied for treatment with OA (Cell signaling technology, Cat#5934): 10 nM OA in DMSO (Sigma; Cat#D2650-100ML) was added from St. 26 to St. 32 to analyze movements of epidermal MCCs and for ciliopathy Mo rescue experiments the embryos were analyzed after 1 h, at St. 28. Cilia morphology was analyzed after treatment with 10 nM OA from St. 8 to St. 26. Control groups were treated with DMSO.

Seidl C., Da Silva F., Zhang K., Wohlgemuth K., Omran H, & Niehrs C. (2023). Mucociliary Wnt signaling promotes cilia biogenesis and beating. Nature Communications, 14, 1259.

Publication 2023

Aftercare Animals Antisense Oligonucleotides Anura beta-Catenin Biosensors Blastomeres Caimans Cells Cilia Ciliopathies Culture Media Embryo Epidermis Europeans Fertilization in Vitro Gastroesophageal Reflux Disease Glycogen Synthase Kinase 3 Homo sapiens LRP6 protein, human MCC protein, human Microinjections Morpholinos Movement Mus RNA, Messenger Sulfoxide, Dimethyl Wnt3A Protein Xenopus laevis

Identifying Apoptosis-Inducing miRNA Inhibitors

High-throughput screening was performed in MCF7, TamR and LTED cells using miRCURY LNA miRNA Inhibitor Library (Qiagen) at 20 nM. The library consists of 954 antisense oligonucleotides with sequences perfectly complementary to their respective miR target. Also included were mock transfection, LNA negative control A (Qiagen), AllStars Hs Cell Death Control siRNA (Qiagen) and AllStars Negative Control siRNA (Qiagen). Cells were seeded at 1800 cells/well (TamR, LTED) and 1500 cells/well (MCF7) in 384-well black-walled plates in 40 µL phenol red-free DMEM containing 10% charcoal-stripped FCS. After 24 h, 10 µL of CellEventTM Caspase-3/7 Green 74 Detection Reagent (Invitrogen) diluted to 12 µM in the medium was added (final concentration after addition of transfection complexes: 2 µM). A total of 10 µL transfection complex was then added per well, consisting of lipofectamine RNAiMax reagent (0.075 µL; Invitrogen), miR inhibitor from the library (3.6 µL at 333 nM) and OptiMEM (6.325µL), giving a final well volume of 60 µL. Cells were incubated for 72 h at 37°C and 5% CO₂ and fixed by removal of 30 µL medium and addition of 30 µL of 6% paraformaldehyde in PBS for 20 min at room temperature. Cells were washed twice with PBS, removing 45 µL of final PBS wash prior to the addition of 45 µL 1/4000 Hoechst (1/5000 final concentration). Cells were incubated for 30 min and washed once with PBS. Plates were stored at 4°C in 50:50 PBS:glycerol. Caspase 3/7 and Hoechst fluorescent signal was quantified using a CellInsight™ CX5 High Content Screening microscope (ThermoFischer Scientific™). Caspase 3/7 signal was quantified in the nucleus only and the percentage (0–1.00) of dying cells per field of view was calculated, using Hoechst fluorescence to quantify cell number. This percentage ranging from 0 to 1.00 is termed apoptotic score.

Zamarbide Losada J.N., Sulpice E., Combe S., Almeida G.S., Leach D.A., Choo J., Protopapa L., Hamilton M.P., McGuire S., Gidrol X., Bevan C.L, & Fletcher C.E. (2023). Apoptosis-modulatory miR-361-3p as a novel treatment target in endocrine-responsive and endocrine-resistant breast cancer. The Journal of Endocrinology, 256(3), e220229.

Publication 2023

Antisense Oligonucleotides Apoptosis Caspase-7 Caspase 3 cDNA Library Cell Death Cell Nucleus Cells Charcoal Fluorescence Glycerin Lipofectamine MCF-7 Cells MicroRNAs Microscopy paraform RNA, Small Interfering Transfection

Interfering lncRNA Expression in ccRCC

According to the results of scATAC-seq and subcellular localization of lncRNA, we discovered four tumor cell–specific lncRNAs, which were expressed in the nucleus. Therefore, antisense oligonucleotide (ASO) was designed to interfere with two lncRNAs (RP11-661C8.2 and CTB-164N12) in ccRCC cell lines (Caki-2 and 786-O). Here, we used ASO-5717 (RiBoBio, ASO-h-ENST00000518605_001, target sequence: CACAGGCATTATCGGGACTA) and ASO-5608 (RiBoBio, ASO-h-ENST00000507989_001, target sequence: GTCCCAGAAAGAACGGCAGC) to interfere with the expression of CTB-164N12.1 and RP11-661C8.2, respectively. We verified that ASO-5717 hit the CTB-164N12.1 specifically, while ASO-5608 hit the RP11-661C8.2 by qRT-PCR.

Yu Z., Lv Y., Su C., Lu W., Zhang R., Li J., Guo B., Yan H., Liu D., Yang Z., Mi H., Mo L., Guo Y., Feng W., Xu H., Peng W., Cheng J., Nan A, & Mo Z. (2023). Integrative Single-Cell Analysis Reveals Transcriptional and Epigenetic Regulatory Features of Clear Cell Renal Cell Carcinoma. Cancer Research, 83(5), 700-719.

Publication 2023

Antisense Oligonucleotides Cell Lines Cell Nucleus Cells Neoplasms Retinitis Pigmentosa 11 RNA, Long Untranslated

Yulink Knockdown in Zebrafish Embryos

Zebrafish embryos were obtained by natural mating, and MO microinjection was performed at the 1 ~ 4 cell stage. The YULINK-MO antisense oligonucleotide (5′-GGCAGGACAGTGGCTTGTTCAGTGC-3′) and its 5 bp mismatch MO negative control (5′-GGCtGcACAGTcGCTTcTTCAcTGC-3′) were used following our previous publication [13 (link)]. Embryos positioned in an agarose injection chamber were injected with 5–10 ng of MO in 4.6 nl of Danieu buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO₄, 0.6 mM Ca(NO₃)₂, 5 mM HEPES, pH 7.6) using a Narishige micromanipulator and needle holder (Narishige, Tokyo, Japan). The specificity of the YULINK-MO was demonstrated in our previous publication [13 (link)].

Lin H.H., Kuo M.W., Fan T.C., Yu A.L, & Yu J. (2023). YULINK regulates vascular formation in zebrafish and HUVECs. Biological Research, 56, 7.

Publication 2023

Antisense Oligonucleotides Buffers Cells Embryo HEPES Microinjections Needles Sepharose Sodium Chloride Sulfate, Magnesium Zebrafish

Top products related to «Antisense Oligonucleotides»

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Morpholino antisense oligonucleotide by Gene Tools

Sourced in United States

Morpholino antisense oligonucleotides are synthetic molecules designed to bind to specific RNA sequences and modulate gene expression. They are used as research tools in various biological studies.

Lipofectamine 3000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland

Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.

Lipofectamine rnaimax by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Switzerland, Denmark, Belgium, Italy, Australia, Singapore, Spain, Colombia, Sweden, Netherlands, New Zealand, Poland, Pakistan, Lithuania

Lipofectamine RNAiMAX is a transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and short hairpin RNA (shRNA) into a wide range of cell types. It is a cationic lipid-based formulation that facilitates the uptake of these nucleic acids into the target cells.

Lipofectamine 2000 reagent by Thermo Fisher Scientific

Sourced in United States, China, Germany, Canada, United Kingdom, Japan, France, Italy, Australia, Switzerland, Spain, Netherlands, Singapore, Cameroon, Colombia, Denmark, Lithuania

Lipofectamine 2000 reagent is a cationic lipid-based transfection reagent used for the delivery of nucleic acids, such as DNA and RNA, into eukaryotic cells. It facilitates the uptake of these molecules by the cells, enabling efficient gene expression or gene silencing studies.

Trizol by Thermo Fisher Scientific

Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines

TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Mmessage mmachine kit by Thermo Fisher Scientific

Sourced in United States, Germany, Spain, United Kingdom

The mMessage mMachine kit is a laboratory equipment product designed for in vitro transcription and capping of mRNA. The kit provides the necessary reagents and protocols to synthesize capped mRNA from DNA templates.

Opti mem by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, Japan, Canada, France, Switzerland, Italy, Australia, Belgium, Spain, Denmark, Ireland, Netherlands, Holy See (Vatican City State), Israel

Opti-MEM is a cell culture medium designed to support the growth and maintenance of a variety of cell lines. It is a serum-reduced formulation that helps to reduce the amount of serum required for cell culture, while still providing the necessary nutrients and growth factors for cell proliferation.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

What are the different types of Antisense Oligonucleotides?

Antisense Oligonucleotides can be classified into several main types based on their chemical structure and mode of action. The most common types include: - Phosphorothioate Oligonucleotides: These use a sulfur atom instead of an oxygen atom in the DNA backbone, making them more stable and resistant to degradation. - Morpholino Oligonucleotides: These have a morpholine ring instead of a sugar ring in the DNA backbone, which improves binding affinity and reduces off-target effects. - 2'-O-Methyl Oligonucleotides: These have a methyl group added to the 2' position of the ribose sugar, enhancing stability and nuclease resistance. - Locked Nucleic Acid (LNA) Oligonucleotides: These contain a methylene bridge that locks the ribose in a C3'-endo conformation, increasing binding affinity and specificity. The choice of antisense oligonucleotide type depends on the specific therapeutic application and desired properties, such as potency, stability, and target selectivity.

What are some common applications of Antisense Oligonucleotides?

Antisense Oligonucleotides have a wide range of applications in both research and therapeutic settings, including: - Gene Silencing: Inhibiting the expression of specific genes by binding to their mRNA transcripts and preventing protein translation. - Modulating Splicing: Altering the splicing patterns of target genes to produce desired protein isoforms. - Inhibiting Viral Replication: Blocking the replication of viruses by targeting their genomes or essential transcripts. - Treating Genetic Disorders: Correcting or compensating for genetic mutations that cause inherited diseases. - Cancer Therapy: Targeting oncogenes or other cancer-related pathways to suppress tumor growth and progression. - Regulating Inflammation: Downregulating the expression of inflammatory mediators to manage autoimmune diseases and chronic inflammatory conditions. The versatility of Antisense Oligonucleotides makes them a promising therapeutic approach for a wide range of diseases, and PubCompare.ai can help researchers identify the most effective protocols for their specific applications.

How can PubCompare.ai assist in Antisense Oligonucleotide research?

PubCompare.ai is designed to streamline and optimize your Antisense Oligonucleotide research in several key ways: 1. Efficent Literature Screening: The platform's AI-powered algorithms can quickly sift through vast amounts of literature, patents, and preprints to help you identify the most relevant protocols and studies. 2. Critical Insigths Identification: PubCompare.ai's intelligent analysis can pinpoint the critical differences between various Antisense Oligonucleotide protocols, enabling you to select the most effective and reproducible approach for your research goals. 3. Effective Protocol Comparisons: By leveraging machine learning, PubCompare.ai can provide side-by-side comparisons of Antisense Oligonucleotide protocols, highlighting their unique strengths, limitations, and suitability for your specific needs. 4. Accelerated Breakthroughs: With PubCompare.ai, you can spend less time searching for and evaluating protocols, and more time focusing on driving your research forward and unlocking the full potential of Antisense Oligonucleotide technology. So in short, PubCompare.ai is a powerful tool that can help you navigate the rapidly evolving field of Antisense Oligonucleotides and identify the most effective protocols to advance your research and achieve breakthroughs.

What are some common challenges in working with Antisense Oligonucleotides?

While Antisense Oligonucleotides offer tremendous potential, there are also some key challenges that researchers must address, such as: - Delivery: Ensuring efficient delivery of the oligonucleotides to the target tissues or cells, as they can have poor cellular uptake and tissue penetration. - Specificity: Avoiding off-target effects by designing Antisense Oligonucleotides that are highly specific to the intended target. - Stability: Improving the stability of the oligonucleotides in biological environments to extend their half-life and maintain effectiveness. - Immunogenicity: Mitigating potential immunogenic responses that can be triggered by the presence of the synthetic oligonucleotides. - Optimization: Identifying the optimal dosage, route of administration, and other parameters to maximize the therapeutic efficacy of Antisense Oligonucleotides. PubCompare.ai can help researchers overcome these challenges by providing insights into the latest advancements and best practices in Antisense Oligonucleotide protocol development and optimization.

How can PubCompare.ai help researchers identify the best Antisense Oligonucleotide protocols?

PubCompare.ai's AI-driven analysis can be invaluable in helping researchers identify the most effective Antisense Oligonucleotide protocols for their specific needs. The platform allows you to: 1. Screen protocol literature more efficiently: PubCompare.ai's algorithms can rapidly sift through vast amounts of research, patents, and preprints to identify the most relevant and promising Antisense Oligonucleotide protocols. 2. Leverage AI to pinpoint critical insights: The platform's intelligent analysis can highlight the key differences between various protocols, such as their target specificity, delivery efficiency, and overall effectiveness. 3. Compare protocols side-by-side: PubCompare.ai enables you to easily compare Antisense Oligonucleotide protocols, allowing you to quickly identify the best option for your research goals in terms of reproducibility, accuracy, and potential for breakthroughs. By streamlining your Antisense Oligonucleotide research and providing these valuable insights, PubCompare.ai can help you save time, reduce costs, and accelerate your progress towards unlocking the full potential of this cutting-edge technology.

More about "Antisense Oligonucleotides"

Antisense oligonucleotides (ASOs) are a class of synthetic nucleic acid molecules that have emerged as a promising therapeutic approach for a wide range of diseases.
These short, single-stranded DNA or RNA sequences can bind to and inactivate specific messenger RNA (mRNA) molecules, preventing the production of targeted proteins.
This powerful technology, also known as antisense therapy or gene silencing, has applications in cancer, viral infections, genetic disorders, and more.
Morpholino antisense oligonucleotides, a specialized subtype of ASOs, utilize a unique chemical structure that enhances their stability and specificity.
Lipofectamine 2000, Lipofectamine 3000, and Lipofectamine RNAiMAX are common transfection reagents used to efficiently deliver ASOs into cells, while TRIzol and TRIzol reagent are widely used for RNA extraction and purification.
PubCompare.ai is an AI-powered platform that streamlines your antisense oligonucleotide research by unlocking protocols from the latest literature, preprints, and patents.
The platform's intelligent comparisons help you identify the best products and protocols, accelerating your breakthroughs in this rapidly evolving field.
Whether you're working with siRNA, miRNA, or other ASO technologies, PubCompare.ai can help you unlock the full potential of antisense oligonucleotides.
With its user-friendly interface and cutting-edge AI capabilities, you can optimize your research workflows, discover novel insights, and drive your projects forward with confidence.
Explore the power of this remarkable technology today with PubCompare.ai.