CrRNA, Transactivating

(i) Plasmid constructions. In order to delete MRR1 and MFS7 in C. lusitaniae, the flanking regions of the two genes were cloned by PCR into pSFS2A (59 (link)). MRR1 flanking regions were amplified from isolate P1 with the primer pairs ClMRR1-Apa/ClMRR1-Xho and ClMRR-SacI/ClMRR-SacII (Table S1). MFS7 flanking regions were amplified from isolate P1 with the primer pairs MFS7-Kpn/MSF7-Xho and MFS7-SacI/MFS7-SacII (Table S1). PCR products were cloned sequentially into corresponding sites to result in plasmid pDS1860 (MFS7 inactivation) and pDS1864 (MRR1 inactivation). pDS1860 and pDS1864 were next modified by removing the SAT1 flipper cassette system by BamHI/NotI digestion and replacement with the NAT1 dominant marker amplified from pJK795 (60 (link)) using primers NAT1-BglII and NAT1-Not, thus resulting in pDS2039 and pSD2038, respectively.
(ii) Cas9-CRISPR for knockout of MRR1 and MFS7. The RNA-protein complex (RNP) approach reported by Grahl et al. (61 (link)) was used that employs reconstituted purified Cas9 protein in complex with scaffold and gene-specific guide RNAs. Genomic RNA (gRNA) specific for MRR1 and MFS7 (Table S1) were selected and obtained from Integrated DNA Technologies, Inc. (IDT) as CRISPR guide RNA (crRNA), which contains 20 bp homologous to the target gene fused to the scaffold sequence. Gene-specific RNA guides were designed in silico using Geneious Prime. RNPs were created using the Alt-R CRISPR-Cas9 system from IDT. Briefly, crRNAs (crMRR1 and crMFS7, Table S1) and tracrRNA (a universal transactivating CRISPR RNA) were first dissolved in RNase-free distilled water (dH₂O) at 100 μM and stored at –80°C. The complete guide RNA was generated by mixing equimolar concentrations (4 μM final) of the gene-specific crRNA and tracrRNA to obtain a final volume of 3.6 μl per transformation. The mix was incubated at 95°C for 5 min and cool down to room temperature. The Cas9 nuclease 3NLS (60 μM stock from IDT) was diluted to 4 μM in dH₂O at a volume of 3 μl per transformation. RNPs were assembled by mixing guide RNAs (3.6 μl of gene-specific crRNA/tracrRNA) with 3 μl of diluted Cas9 protein, followed by incubation at room temperature for 5 min. Transformation of C. lusitaniae cells was carried out by electroporation and used 6.6 μl of gene-specific RNPs, 40 μl of C. lusitaniae cells, and 1 to 2 μg of repair constructs (up to 3.4 μl volume). Repair constructs containing the MRR1 and MFS7 inactivation cassettes were obtained by PCR amplification with primer pairs ClMRR1-Apa/ClMRR-SacI and MFS7-Kpn/MFS7-SacI from pDS2038 and pSD2039, respectively. Transformants were selected at 30°C on YEPD agar containing 200 μg/ml nourseothricin. Transformants were verified by PCR using the primer pair NAT1_134_R/ClMRR1-verif3 for MRR1 deletion and NAT1_134_R/5-MFS7-A for MFS7 deletion. DNA from transformants was prepared by small-scale rapid DNA extraction, as described previously (62 (link)).
(iii) MRR1 reversion. In order to reintroduce MRR1 alleles in the background of MRR1 deletion mutants, an alternative mutant construction using a recyclable NAT1 marker was employed. The maltose-inducible MAL2-FLP1 system of pSFS2A was first excised from pSFS2A as a 0.9-kb ApaI-EcoRV fragment and cloned into pJK863 to substitute the SAP2 promoter, thus resulting in pDS2046. In this approach, the NAT1 marker could be recycled by MAL2-dependent FLP1 expression (MAL2-FLP-NAT1). This plasmid was used as the PCR template with the primer pair MRR1-5_pDS2046/MRR1-3_pDS2046. Both primers contained 70-bp homology to the MRR1 5′- and 3′-flanking regions and a 21-bp extension matching to the MAL2-FLP-NAT1 extremities. CRISPR-Cas9-mediated recombinations at MRR1 flanking regions with this PCR-amplified repair fragment were used with crRNAs crMRR1_del5 and crMRR1_del3 that were prepared as explained above to reconstitute functional RNPs, with the exception that both RNPs were concentrated by 2-fold. Transformation of C. lusitaniae was carried out by electroporation, as described below, and transformants were selected onto YEPD plates with nourseothricin (200 μg/ml).
After MRR1 deletion verification by PCR, as described above, strains were grown overnight on YEP liquid medium with 2% maltose at 30°C in order to induce FLP1-mediated recombination at FLP recombination target (FRT) sequences and the resulting loss of NAT1. Recycling of NAT1 was observed in YEPD agar medium containing each about 10²C. lusitaniae cells at a nourseothricin concentration of 1 μg/ml to distinguish between parent cells and those without NAT1.
Nourseothricin-sensitive C. lusitaniae cells deleted for MRR1 were used for MRR1 reversion. MRR1 alleles were first cloned into pSD2038 with fragments obtained by PCR using primers ClMRR1-Apa and ClMRR1-Xhorev and DNA templates from isolates P1 and P3, which resulted in plasmids pDS2040 and pDS2041, respectively. Repair fragments were obtained from both plasmids with primers ClMRR1-Apa and MRR1-3_rev_new. CRISPR-Cas9-mediated recombinations at the MRR1 flanking regions with these PCR-amplified repair fragments were used with crRNAs crRNA_MRR1_rev5 and crRNA_MRR1_rev3 that were prepared as described above to reconstitute functional RNPs. Transformations of C. lusitaniae were carried out by electroporation, as described below, and transformants were selected onto YEPD plates with nourseothricin (200 μg/ml). Reintegration of MRR1 alleles was verified by PCR on recovered genomic DNA with the primer pair ClMRR1_F/ClMRR1_3377_R, followed by sequencing with primer ClMRR1_2900_F to confirm allele identity.

To phenocopy the zmp splice-donor and start-site morpholino rescue of Il-1β-induced embryonic systemic inflammation, we used a CRISPR/Cas9 strategy utilizing the crRNA:tracrRNA duplex format with recombinant S. Pyogenes Cas9 nuclease (Cas9) from Integrated DNA Technologies (IDT). Using the Alt-R Custom Cas9 crRNA Design Tool (IDT), we designed two CRISPR RNAs (crRNAs): cr1.zmp:0000000936.ex8 5’-/AltR1/ucgacugcuggacaccagacguuuuagagcuaugcu/AltR2/-3’and cr2.zmp:0000000936.ex9 5’-/AltR1/uuaagguggagcuggucuuaguuuuagagcuaugcu/AltR2/-3’ against exon 8 and exon 9, respectively. For CRISPR-Cas9 ribonucleoprotein (RNP) preparation and microinjection, we followed the IDT demonstrated protocol “Zebrafish embryo microinjection” modified from Dr. Jeffrey Essner (Iowa State University). The crRNAs and transactivating crRNA (tracrRNA) were resuspended to 100 µM in nuclease-free TE buffer, pH 8.0, the individual crRNAs were combined with tracrRNA at 1:1 molar ratio in nuclease-free Duplex Buffer (IDT) to create 3 µM gRNA complexes (cr1 and cr2). The solutions were heated to 95°C for 5 min, then cooled to room temperature. Recombinant Cas9, glycerol-free (IDT) was diluted to 0.5 µg/µl in PBS, pH 7.4. The RNP complex was assembled by combining 3 µl of gRNA complexes with 3 µl of diluted Cas9, incubated at 37°C for 10 min, then cooled to room temperature. Approximately 2 nl of the RNP complexes with either cr1, cr2, or combined cr1/cr2 (1:1) was microinjected into ubb:Gal4-EcR, uas:Il1β^mat single-cell embryos and monitored for morbidity and mortality. PCR was performed on individual embryos using zmp:0000000936-specific primers: forward primer 5’-tatgtgttcctcttgcagCG-3’ and reverse primer 5’-tgtttatacgagcacCTGTGG-3’ located in intron 7 and intron 9, respectively. Percentages of survival (alive), morbidity (sick), and mortality (dead) were plotted for each group using Excel (Microsoft). To test for differences between groups, a chi-square test of independence was performed, followed by a post hoc test using adjusted residuals and a p-value Bonferroni adjustment.

Single-guide RNA (sgRNA) sequence targeting Regnase-1 was previously published (Mai et al, 2023 (link); see Appendix Table S2). Recombinant Cas9 protein (Cat. No. #1081058), synthetic locus-specific CRISPR RNA (crRNA), and transactivating crRNA (tracrRNA, Cat. No. #1072532) were all purchased from Integrated DNA Technologies (IDT™). Equimolar amounts (120 pmol) of crRNAs and tracrRNAs were mixed in a Cas9 buffer (HEPES 20 mM, 150 mM KCl, 1 mM MgCl₂, 10% glycerol, 1 mM TCEP) to obtain a total volume of 25 μl. To generate crRNA:tracrRNA duplexes, the mixtures were heated to 98 °C for 5 min and allowed to cool down to ambient temperature. Recombinant Cas9-3NLS (100 pmol) was diluted in Cas9 working buffer to obtain a final volume of 25 μl. Both crRNA:tracrRNA duplexes and diluted Cas9-3NLS were slowly mixed and incubated for 20 min at room temperature to allow the formation of ribonucleoprotein (RNP) complexes. CRISPR/Cas9-editing of T-cells was achieved using the human T-cell Nucleofector Kit (Lonza, Cat. No. #VPA-1002) and according to the manufacturer’s protocol. Briefly, upon CD3/CD28-bead removal on day 3 of CAR T-cell production (as described above), 3–5 × 10⁶ transduced T-cells were harvested, spun down, and resuspended in 50 μl of nucleofection solution. RNP and cell solutions were combined in a 100 μl nucleocuvette. Electroporation was carried out using a 2B-Nucleofector (Lonza) using cell line-specific settings according to the manufacturer’s recommendations. Electroporated T-cells were resuspended at a density of 1 × 10⁶ cells/ml in T-cell medium (Advanced RPMI 1640 (Gibco™, #12633012) supplemented with penicillin (100 U/ml)/streptomycin (100 µg/ml), GlutaMax™ (1:100, Gibco, # 35050061) and 10% FBS (Gibco™, Cat. No. #16000044) in addition to IL-2 (100 U/ml, Gibco™, Cat. No. #CTP0021).