> Chemicals & Drugs > Biologically Active Substance > KB 11

KB 11

KB 11 is a chemical compound that has been studied for its potential therapeutic applications.
It is a small molecule that has been investigated for its ability to modulate various biological pathways.
KB 11 has shown promise in preclinical studies for the treatment of certain diseases, though its mechanism of action and clinical efficacy are still under investigation.
Further research is needed to fully understand the pharmacological properties and therapeutic potential of KB 11.

Most cited protocols related to «KB 11»

Generation and Validation of R26 Reporter Mice

ES cell electroporation and production of chimeras was performed by the University of Connecticut Gene Targeting and Transgenic Facility (GTTF). The pR26-CLNFZG targeting vector was linearized with SfiI and electroporated into 129S6/C57BL/6 hybrid ES cells (D1: established by GTTF). Southern blot hybridization on BamHI-digested genomic DNA was used to screen for homologous recombination on the 5′ end using a 0.67 kb probe outside of the 5′ homology arm. The probe was liberated by EcoRV digestion of the PCR product generated with the following primers: 5′-TTCCTCTCAATATGCTGCACACAAA-3′ and 5′-GCCCAGAGAGAAAGGCTCTCCTTCA -3′. The targeted and wild-type alleles produced products of 11.5 kb and 5.8 kb, respectively. Nested PCR was used to assay for correct targeting on the 3′ end. The targeted allele generated a 5.8 kb diagnostic fragment with the following primers; 1st PCR, 5′-GGGAAGACAATAGCAGGCATGCTGG-3′ and 5′-GATGCCCAATTCCAACTGTGAAGAC-3′; 2nd PCR, 5′-TTCTGAGGCGGAAAGAACCAGCTAG-3′ and 5′-TTCCTCTCAATATGCTGCACACAAA-3′.
Chimeric mice were produced from two targeted ES cell clones by aggregation with CD1 embryos. Germ line transmission of the targeted allele was assessed by LacZ PCR with primers (5′-GCGGATCCGAATTCGAAGTTCC-3′ and 5′-TGGGTCTCCAAAGCGACTCC-3′) that generate a 333-bp product. R26^ZG was generated by a cross between R26^NZG/+ and Hprt1^Cre/+ mice. Removal of the PGKNEO cassette was verified by the presence of a 193-bp PCR product using primers that flank PGKNEO (5′-ACTGGGCACAACAGACAATCG-3′ and 5′-GCTTCAGTGACAACGTCGAG-3′). R26^NG was generated by a cross between R26^NZG/+ and R26^FLPe/FLPe mice. As R26^FLPe-driven excision of the nlslacZ cassette was incomplete, the resulting mosaic F1 offspring were crossed with R26^FLPe/+ mice to establish the R26^NG line. Removal of the nlslacZ cassette was assessed by PCR with a forward PGK pA cassette primer (5′-GATCAGCAGCCTCTGTTCCACA-3′) and a reverse EGFP primer (5′-CGCTGAACTTGTGGCCGTTTAC-3′) that amplifies a 264-bp product. Lines were maintained by breeding to FVB mice.

Yamamoto M., Shook N.A., Kanisicak O., Yamamoto S., Wosczyna M.N., Camp J.R, & Goldhamer D.J. (2009). A Multifunctional Reporter Mouse Line for Cre- and FLP-Dependent Lineage Analysis. Genesis (New York, N.Y. : 2000), 47(2), 107-114.

Publication 2009

Alleles Animals, Transgenic Biological Assay Chimera Clone Cells Cloning Vectors Diagnosis Digestion Electroporation Embryo Embryonic Stem Cells Genome Germ Line Homologous Recombination Hybrid Cells KB 11 LacZ Genes Mus N-fluoresceinylphosphatidylethanolamine Nested Polymerase Chain Reaction Oligonucleotide Primers Southern Blotting Transmission, Communicable Disease

Tetracycline Inducible Luciferase Reporter

Plasmid pAGHD1 containing the 11 kb HindIII fragment of pAG1 encompassing the TetZ determinant was a kind gift from Dr Andreas Tauch, Department of Genetics, University of Bielefeld, Germany (23 (link)). The tetRO region from TetZ was amplified by PCR using primers TetRFor (5′-CGGGATCCTCACGATTCGCTCGAGGTC-3′) and TetORev1 (5′-CGCATATGTGTCAGGATTCCACGATGAG-3′); the tetO determinant was amplified using TetOFor (5′-CGGGATCCAGTTGCACTTTATCATCGATAAC-3′) and TetORev1. The forward primers contain BamHI restriction sites and the reverse primer contains an NdeI restriction site (underlined). Both products were cloned upstream of the luxAB genes from Vibrio harveyi in the vector pSMT1 (24 (link)), to make pTet1 and pTet2 (Figure 1A). For further work, the tetRO region was amplified by PCR using TetRO-F (5′-GCTCTAGATCACGATTCGCTCGAGGTC-3′) and TetRO-R (5′-CGGGATCCTGTCAGGATTCCACGATGAG-3′) containing XbaI and BamHI sites (underlined) respectively, and cloned into the XbaI–BamHI sites upstream of the luxAB genes in pSHKLx (25 ) to generate pMindLx (Figure 1A). Plasmid pSHKLx is an E.coli–mycobacteria shuttle plasmid containing kanamycin and hygromycin selectable markers and the luxAB genes from Vibrio harveyi as a reporter. In pMind the luxAB genes have been replaced by a multiple cloning site (Figure 1B) to facilitate cloning of other genes of interest. Vectors were introduced into mycobacteria by electroporation (26 (link)).

Blokpoel M.C., Murphy H.N., O'Toole R., Wiles S., Runn E.S., Stewart G.R., Young D.B, & Robertson B.D. (2005). Tetracycline-inducible gene regulation in mycobacteria. Nucleic Acids Research, 33(2), e22.

Publication 2005

Cloning Vectors Electroporation Escherichia coli Genes hygromycin A Kanamycin KB 11 Mycobacterium Oligonucleotide Primers Plasmids Vibrio harveyi

Transgenic Mice Expressing GFP

Adult transgenic mice in which either the T1R3 or TRPM5 promoter drives expression of GFP were used. Animals were cared for in compliance with the Colorado State University Animal Care and Use Committee. Specifically, pIRES2-eGFP containing the encephalomyocarditis virus internal ribosome entry site (IRES) and enhanced green fluorescent protein (eGFP) was purchased from Clontech (Palo Alto, CA). The wheat germ agglutinin (WGA) cDNA was a gift from Dr N.V. Raikhel. The T1r3 and Trpm5 genes were subcloned from BACs obtained by screening a C57BL6 mouse BAC library. The construct T1R3-GFP contained 5' to 3': 13 kb of the mouse T1r3 gene including the 5' flanking region and the entire 5' untranslated region, the WGA cDNA, IRES and eGFP. WGA was included in the construct for the purpose of tracing studies that are unrelated to the studies described here. The construct TRPM5-GFP contained 5' to 3': 11 kb of mouse Trpm5 5' flanking sequence, Trpm5 Exon 1 (untranslated), Intron 1, and the untranslated part of Exon 2, and eGFP. The constructs were separated from the vector by restriction endonuclease digestion, purified from agarose gels using a Qiagen kit and microinjected into B6C3 mouse zygotes according to standard methods [36 ]. Founder transgenic mice were bred to wild-type C57BL6/J mice and their transgenic offspring were used for further experiments.

Clapp T.R., Medler K.F., Damak S., Margolskee R.F, & Kinnamon S.C. (2006). Mouse taste cells with G protein-coupled taste receptors lack voltage-gated calcium channels and SNAP-25. BMC Biology, 4, 7.

Full text: Click here

Publication 2006

5' Flanking Region Adult Animals Animals, Transgenic Cloning Vectors Digestion DNA, Complementary DNA Library DNA Restriction Enzymes Encephalomyocarditis virus enhanced green fluorescent protein Exons Gels Genes Internal Ribosome Entry Sites Introns KB 11 Mice, Laboratory Mice, Transgenic Sepharose TRPM5 protein, human Untranslated Regions Wheat Germ Agglutinins Zygote

Targeted ROSA26 Locus Screening

PCR-based screening of targeted ROSA26 ES cell clones was performed using the external G1for primer (TAGGTAGGGGATCGGGACTCT) and the internal G2rev primer (GCGAAGAGTTTGTCCTCAACC) to generate a 1.3-kb PCR fragment (Supplementary Figure 1A). PCR positive clones were confirmed by Southern blotting for 5′ integration using the 5′ external probe (550 bp) and BamH1 digests of genomic DNA (5.8-kb wt allele and 3.0 kb targeted allele). 3′ integration was confirmed using the 3′ external probe (800 bp) and Kpn1 digests (37-kb wt allele and 8.8-kb targeted allele). Both the 5′ and 3′ external Southern probes were generated and provided as a generous gift by Michael Taschner and Dr. Christine Hartmann (IMP, Vienna). An internal Neo probe was used with EcoRV digests to detect a single 4.0-kb ROSA26-targeted allele. For the MultiSite pCAGG promoter targeting experiments to the ROSA26 locus in the sense/anti-sense orientation double EcoRI/KpnI digests were performed and the 5′ external probe generated fragment lengths of 5 kb and 6 kb for targeted events for the anti-sense and sense orientation respectively and an 11-kb fragment for the non-targeted wild-type allele. Similarly, the 3′ external probe generated an 8.8-kb and 9-kb fragment for the anti-sense and sense orientation respectively for the targeted allele and an 11-kb fragment for the wild-type allele. An internal eGFP probe was used to generate a single 5-kb and 6-kb fragment for the anti-sense and sense orientation respectively indicative of single-copy integration.

Nyabi O., Naessens M., Haigh K., Gembarska A., Goossens S., Maetens M., De Clercq S., Drogat B., Haenebalcke L., Bartunkova S., De Vos I., De Craene B., Karimi M., Berx G., Nagy A., Hilson P., Marine J.C, & Haigh J.J. (2009). Efficient mouse transgenesis using Gateway-compatible ROSA26 locus targeting vectors and F1 hybrid ES cells. Nucleic Acids Research, 37(7), e55.

Publication 2009

Alleles Clone Cells Deoxyribonuclease EcoRI Embryonic Stem Cells Genome KB 11 Oligonucleotide Primers

Construction of Versatile Cloning Vectors

In all vectors, the PstI site in the bla gene was removed by site-directed mutagenesis using the oligonucleotides TM2206 and TM2207. The resulting vector is marked with the auxiliary “blamut”. Primer design and mutagenesis were performed according to the manufacturer’s instructions for the QuikChange® II Site-Directed Mutagenesis Kit (Agilent Technologies). All plasmids were test-digested to confirm removal of the restriction site.
To create the empty vector pBS1C, pDG1662blamut was cut with PstI to remove one XbaI site and the spc^r outside of the integrative part. The 6 kb fragment was religated. The remaining PstI site was mutated via site-directed mutagenesis with the primers TM2845 and TM2846. To insert the MCS, the vector was cut with EcoRI. The MCS was amplified by PCR from pSB1C3 with the Primers TM2843 and TM2844, cut with EcoRI and BsaI (EcoRI-compatible overhang) and ligated into the vector. The remaining NgoMIV sites were removed by subsequent site-directed mutagenesis with TM3005 + TM3006, TM3011 + TM3012 and TM3013 + TM3014, respectively, resulting in pBS1C.
To create the empty vector pBS2E, pAX01 was cut with SacI. The 6.3 kb fragment was religated to remove the xylR-P_xylA-fragment. The PstI site in bla was removed. The vector was cut with XbaI and the 6 kb fragment religated to reduce the amount of forbidden restriction sites. The lost terminator of erm was replaced by the PCR-amplified terminator with BsaI-overhangs (primers: TM2975 and TM2976). The vector was opened with XbaI and ligated with the PCR product cut with BsaI (XbaI-compatible overhang). The correct direction was checked by sequencing and removal of the XbaI-site was confirmed. Finally, the MCS was amplified from pSB1C3 (TM2608 and TM2609) with PstI and NsiI overhangs, cut with PstI and NsiI and ligated into the PstI-cut vector. Correct orientation of the insert was confirmed by restriction digest and sequencing. The remaining NgoMIV sites were removed by subsequent site-directed mutagenesis with TM3011 + TM3012 and TM3028 + TM3029, respectively, resulting in pBS2E.
To create the empty vector pBS4S, the erm-resistance outside of the integrative part of pDG1731 was removed via cut-ligation with MluI and BssHI, resulting in a 4.7 kb vector. The PstI site in bla was removed as described above. The PstI site in thrB was removed performing site-directed mutagenesis with the primers TM2835 and TM2836. The spc-promoter with upstream PstI-overhang was amplified with the primers TM2837 and TM2838 and cut with PstI and PciI. The MCS was cut from pSB1C3 with EcoRI and PstI. The vector was cut with EcoRI and PciI and the 4.3 kb-fragment ligated with both cut DNA-fragments. The remaining NgoMIV sites were removed by subsequent site-directed mutagenesis with TM3005 + TM3006 and TM3011 + TM3012, respectively, resulting in pBS4S.
To create the reporter vector pBS1ClacZ, pAC6blamut was cut with EcoRI and PstI. The primers TM2301 and TM2302 (1 pM) were mixed, heated (95°C, 10 min), re-annealed (50°C, 10 min) to become double stranded with 4 bp overhangs and ligated into the vector. The vector was cut with EcoRI and PstI and ligated with the MCS from pSB1C3 cut with EcoRI and PstI. A PstI site in the E. coli ori was removed by cutting with BglII and religation of the 11 kb fragment.
To create the reporter vector pBS3Clux, the PstI site in the sacA locus of pAH328blamut was removed by site-directed mutagenesis with the primers TM2885 and TM2886. Then, the XbaI site of luxD was removed similarly with the Primers TM2887 and TM2888. The MCS was amplified by PCR from pSB1C3 with the primers TM2843 and TM2884, cut with EcoRI and BsaI (SpeI-overhang) and ligated into the EcoRI/SpeI-cut vector.

Radeck J., Kraft K., Bartels J., Cikovic T., Dürr F., Emenegger J., Kelterborn S., Sauer C., Fritz G., Gebhard S, & Mascher T. (2013). The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. Journal of Biological Engineering, 7, 29.

Full text: Click here

Publication 2013

Cloning Vectors Deoxyribonuclease EcoRI Escherichia coli Gene, THRB Genes KB 11 Ligation Mutagenesis Mutagenesis, Site-Directed Oligonucleotide Primers Oligonucleotides Plasmids

Most recents protocols related to «KB 11»

Analyzing Introgressed Fragments in Domestic Sheep

In order to exclude common ancestry as explanation for the presence of introgressed fragments, we calculated the expected length of ancestral sequence shared by domestic sheep and each wild relative, respectively. The expected shared ancestral sequence length (L) is calculated as L = 1/(r/t), in which r is the recombination rate per generation per base pair (bp), and t is the length between wild relatives and domestic sheep since divergence. The probability of a length of at least m is 1-GammaCDF (m, shape = 2, rate = 1/L), in which GammaCDF is the Gamma distribution function and the numbers within the parenthesis are its arguments [9 (link)]. We used a generation time of 4 years [81 (link)], a recombination rate of 1.0×10⁻⁸ per base pair (bp) per generation [27 (link)] and the following divergence times: 0.032 Ma between Iranian mouflon and domestic sheep, 1.26 Ma for urial and domestic sheep, 2.36 Ma for argali and domestic sheep, and 3.12 Ma for bighorn (or thinhorn) and domestic sheep [17 (link),23 (link),82 (link)–83 (link)]. This gives expected lengths of L (Iranian mouflon) = 6,192 bp, L (urial) = 159 bp, L (argali) = 85 bp, and L (bighorn/thinhorn) = 64 bp. We then removed inferred introgressed fragments shorter than L, and calculated the total length of remaining introgressed tracks. The length distributions are showed in S7 and S8 Figs. Probabilities of length of observed introgressed regions were calculated by the R function pgamma using the local recombination rates estimated in previous study [84 (link)]. The probabilities are 2.03×10⁻⁵ for 46.10 kb (RXFP2 introgressed region) and zero for 31.70 kb (MSRB3 argali- introgressed region), 319.89 and 155.58 (VPS13B urial-introgressed regions), and 1.37×10⁻⁵ for 70.11 kb (VPS13B mouflon-inrogressed) (S8 Table).

Cheng H., Zhang Z., Wen J., Lenstra J.A., Heller R., Cai Y., Guo Y., Li M., Li R., Li W., He S., Wang J., Shao J., Song Y., Zhang L., Billah M., Wang X., Liu M, & Jiang Y. (2023). Long divergent haplotypes introgressed from wild sheep are associated with distinct morphological and adaptive characteristics in domestic sheep. PLOS Genetics, 19(2), e1010615.

Full text: Click here

Publication 2023

Base Pairing Domestic Sheep Figs Gamma Rays KB 11 MA 12 Mouflon Recombination, Genetic

Efficient Transfection of 293T Cells

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023

Bacteria Cells HEK293 Cells Hyperostosis, Diffuse Idiopathic Skeletal KB 11 Microscopy Molar Plasmids Transfection

Coyopavirales: Novel Mayan Viruses

The order Coyopavirales is proposed within the existing class Tectiliviricetes, after Coyopa, the god of thunder in Mayan mythology. It contains tailless icosahedral viruses with previously unreported class of DJR MCPs and little proteome overlap with known viruses. The family Chaacviridae is proposed within Coyopavirales, after Chaac, the god of death in the Mayan mythology. It is characterized by a uniform 10–11 kb genome and a gene encoding protein-primed family B DNA polymerase (pPolB). We propose the genus names Homochaacvirus and Antichaacvirus (from homo, for same in Greek, and anti, for opposed in Greek, to emphasize the inversion of a gene module including the pPolB gene). Six complete genomes of chaacviruses have been obtained: Methanophagales virus PBV304 (OP548099) within sepcies Homochaacvirus pescaderoense, Methanophagales virus PBV305 (OP548100) within species Homochaacvirus californiaense, Methanophagales virus GBV261, Methanophagales virus GBV265, Methanophagales virus GBV275 and Methanophagales virus PBV266 (OP413841) within species Antichaacvirus pescaderoense. The candidate family Ixchelviridae is proposed within Coyopavirales, after Ix Chel, goddess of midwifery and medicine in the Mayan mythology. Ixchelviridae is represented by Pescadero Basin viruses PBV176 and PBV180, with assembly completeness unknown.
Candidate family Huracanviridae is proposed without higher-level ranking classification, after Hurancan, god of wind, storm and fire in Mayan mythology. It contains tailless icosahedral viruses with single jelly-roll MCPs. It is represented by Pescadero Basin viruses PBV264 and PBV238, with assembly completeness undetermined.
The order Nakonvirales is proposed within Caudoviricetes, after Nakon, the most powerful god of war in Mayan mythology. It contains head-tailed viruses with around 80 kb genomes and HK97-fold MCPs. The family Ahpuchviridae (after Ah Puch, the god of death in the Mayan mythology) includes one genus, Kisinvirus, (after Kisin, another Mayan god of death) and is represented by a single virus, Methanophagales virus PBV299 (OP413838) within species Kisinvirus pescaderoense. The family Ekchuahviridae (after Ek Chuah, the patron god of warriors and merchants in Mayan mythology), is represented by one genus, Kukulkanvirus (after Kukulkan, the war serpent in the Mayan mythology). It includes Methanophagales virus GBV301 (OP880252) within species Kukulkanvirus guaymasense and Methanophagales virus GBV302 (OP880253) within species Kukulkanvirus mexicoense, each encoding two divergent HK97-fold MCPs with their own capsid maturation proteases.
Seven other candidate families of head-tailed viruses are proposed without complete genome representatives. They form a phylogenetic cluster sister to Haloviruses (Fig. 5a), and according to the phylogenetic classifications of the latter, likely form multiple unclassified order-level clades. These candidate families are Acanviridae, Alomviridae, Bacabviridae, Baalhamviridae, Cabrakanviridae, Cacochviridae and Chiccanviridae, all named after gods in Mayan mythology.
The order Maximonvirales is proposed within Tokiviricetes, after Maximon, a god of travellers, merchants, medicine men/women, mischief and fertility in Mayan mythology. It contains rod-shaped viruses of a single family Ahmunviridae (after Ah Mun, the god of agriculture in Mayan mythology) with a single genus Yumkaaxvirus (after Yum Kaax, the god of the woods, the wild nature and the hunt in Mayan mythology). It is represented by the complete linear genome of Methanophagales virus PBV300 (OP413840) within species Yumkaaxvirus pescaderoense.
The family Itzamnaviridae is named after Itzamna, lord of the heavens and night and day in Mayan mythology. It contains spindle-shaped viruses that differ in genome sizes and are subdivided into two genera, which we propose naming Demiitzamnavirus and Pletoitzamnavirus (after demi- for half or partial, derived via French from Latin dimedius and pleto for full in Latin). They are respectively represented by complete genomes of Methanophagales virus GBV170 within species Demiitzamnavirus guaymasense, Methanophagales virus GBV303 (OP880254) within species Demiitzamnavirus mexicoense and Methanophagales virus PBV082 (OP413839) within species Pletoitzamnavirus pescaderoense.
Candidate families Tepeuviridae and Votanviridae, named after a skye god Tepeu and a legendary ancestral deity Votan, respectively, are proposed for two additional new clades of spindle-shaped viruses. Their genome representatives Tepeuvirus PBV144 and Votanvirus IMGVR0294848 are not yet circularized and are thus incomplete.

Laso-Pérez R., Wu F., Crémière A., Speth D.R., Magyar J.S., Zhao K., Krupovic M, & Orphan V.J. (2023). Evolutionary diversification of methanotrophic ANME-1 archaea and their expansive virome. Nature Microbiology, 8(2), 231-245.

Full text: Click here

Publication 2023

Capsid Proteins DNA-Directed DNA Polymerase Endopeptidases Fertility Flatulence Gene Modules Genes Genome Head Homo Inversion, Chromosome KB 11 Medicine Men Pharmaceutical Preparations protein B Proteome Viral Genome Virus Woman

Quantification of mtDNA-CN and LTL by qPCR

Total venous blood samples were collected to isolate leukocytes, and DNA was extracted by the Miller salting out method and stored at −20 °C until analysis [50 (link)]. Quantification of mtDNA-CN and measurement of LTL was evaluated by qPCR with the Absolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qPCR kit (ScienCell Research Laboratories, Carlsbad, CA) according to the manufacturer’s protocol [51 (link)].
As mentioned above, LTL measurement and mtDNA-CN quantification were carried out by polymerase chain reaction (PCR). The PCR reaction (per sample) was composed of: 10 μL of 2XGoldNStart TaqGreen qPCR master mix, 2 μL of primer solution (Tel, mtDNA, or a single copy reference, SCR), 7 μL of nuclease-free water, and 1μL of test DNA (5 ng). The conditions of each thermal cycle were carried out as follows: denaturation at 95 °C for 10 min, followed by 32 cycles with denaturation at 95 °C for 20 s, hybridization at 52 °C for 20 s, and extension at 72 °C for 45 s. Finally, a region of 100 bp in length on chromosome 17 was recognized by the first set of SCR and reference DNA with a known concentration of telomere length 348 ± 11 kb per diploid cell and mtDNA-CN of 1.27 ± 0.03 × 10³ copies per diploid cell [52 (link)].

López-Armas G.D., Ramos-Márquez M.E., Navarro-Meza M., Macías-Islas M.Á., Saldaña-Cruz A.M., Zepeda-Moreno A., Siller-López F, & Cruz-Ramos J.A. (2023). Leukocyte Telomere Length Predicts Severe Disability in Relapsing-Remitting Multiple Sclerosis and Correlates with Mitochondrial DNA Copy Number. International Journal of Molecular Sciences, 24(2), 916.

Full text: Click here

Publication 2023

BP 100 Chromosomes, Human, Pair 17 Crossbreeding Diploid Cell DNA, Mitochondrial Homo sapiens KB 11 Leukocytes Oligonucleotide Primers Polymerase Chain Reaction Telomere Veins

Fluorescence in situ Hybridization of Telomeric and rDNA Loci

Fluorescence in situ hybridization (FISH) was conducted to examine the distribution of the telomeric repeats (TTAGGG)_n and 18S/28S rDNA loci. The telomeric (TTAGGG)_n probe was prepared by PCR without a DNA template [27 (link)], and the rDNA probe was prepared by nick translation using the pDmr.a 51#1 plasmid with an 11.5 kb insert encoding the 18S and 28S ribosomal units of Drosophila melanogaster [28 (link)]. Both probes were labeled with dUTP-biotin (Roche Diagnostics, Basel, Switzerland).
Slides with chromosome suspensions were washed in 2xSSC for 5 min and incubated subsequently with RNase A (100 ug/mL) for 1 h and 0.01% pepsin solution for 10 min, with intermediate washes in 2xSSC, three times for 5 min each. After incubation, the slides were washed three times in 1xPBS and incubated in a 1% formaldehyde solution for 10 min. Then, slides were washed in phosphate buffered saline (1xPBS) for 5 min and dehydrated, respectively, in 70%, 85%, and 100% ethanol for 5 min each. Dried slides were denatured in 70% formamide/4xSSC for 2 min at 70 °C, washed in 2xSSC for 5 min and dehydrated in the ethanol series again. In parallel, the probe was incubated for 6 min at 73 °C and then at −20 °C for 10 min. After this, 10 μL of the probe was applied to each slide and incubated overnight in a wet chamber at 37 °C.
After incubation, post-hybridization washes and signal detection were performed. Slides were washed in 2xSSC, three times in 50% formamide in 2xSSC at 37 °C, in 2xSSC twice, and once in 4xSSC/0.05% Tween20 (Sigma-Aldrich, St. Louis, MO, USA), each for 5 min. The next step was adding 4xSSC/5% blocking reagent (Roche Diagnostics, Basel, Switzerland) and incubating for 30 min at 37 °C. After incubation, slides were briefly washed in 4xSSC/0.05% Tween 20. The hybridization signal was enhanced with three subsequent incubations of avidin-FITC (5 ng in 100 mL of 4xSSC/5% blocking reagent; Vector Laboratories, Burlingame, CA, USA) and two intermediate incubations of biotinylated anti-avidin (50 ng in 100 mL of 4xSSC/5% blocking reagent; Vector Laboratories, Burlingame, CA, USA), each for 30 min. Between incubations with the antibodies, the slides were washed three times in 4xSSC/0.05% Tween 20, each for 5 min. After incubations with antibodies, the slides were washed twice in 4xSSC/0.05% Tween 20 and once in 1xPBS, each for 5 min. Next, the slides were dehydrated in an ethanol series and air-dried. Dried slides were treated with 20 μL of Fluoroshield with DAPI (Vector Laboratories, Burlingame, CA, USA).

Chrostek G., Domaradzka A., Yurchenko A., Kratochvíl L., Mazzoleni S, & Rovatsos M. (2023). Cytogenetic Analysis of Seven Species of Gekkonid and Phyllodactylid Geckos. Genes, 14(1), 178.

Full text: Click here

Publication 2023

Acid Hybridizations, Nucleic Antibodies Avidin Biotin Chromosomes Cloning Vectors DAPI deoxyuridine triphosphate Diagnosis DNA, A-Form DNA, Ribosomal Drosophila melanogaster Endoribonucleases Ethanol fluorescein isothiocyante avidin Fluorescent in Situ Hybridization Fluoroshield Formalin formamide KB 11 Pepsin A Phosphates Plasmids Ribosomes Saline Solution Signal Detection (Psychology) Telomere Tween 20

Top products related to «KB 11»

Qiaquick gel extraction kit by Qiagen

Sourced in Germany, United States, Netherlands, United Kingdom, Japan, Canada, France, Spain, China, Italy, India, Switzerland, Austria, Lithuania, Sweden, Australia

The QIAquick Gel Extraction Kit is a product designed for the purification of DNA fragments from agarose gels. It efficiently extracts and purifies DNA from gel slices after electrophoresis.

Pfos 1 by New England Biolabs

PFOS-1 is a laboratory instrument designed for the detection and quantification of PFOS (perfluorooctane sulfonate) in various environmental samples. The core function of PFOS-1 is to accurately measure the concentration of PFOS using advanced analytical techniques.

Pnl1.3 secnluc plasmid by Promega

Sourced in United States

The PNL1.3_secNluc plasmid is a laboratory tool that can be used to express secreted Nano luciferase (secNluc) in cells. The secNluc gene is under the control of the CMV promoter, allowing for efficient expression of the reporter protein.

Software by FlowJo

Sourced in United States, Germany, Canada, United Kingdom, Belgium, France, Italy, China

FlowJo is a software application designed for the analysis of flow cytometry data. It provides a comprehensive suite of tools for the visualization, gating, and analysis of single-cell flow cytometry data, enabling researchers to gain insights into complex biological systems.

Power sybr green pcr master mix by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Japan, France, Canada, China, Switzerland, Belgium, Australia, Italy, Lithuania, Brazil, Singapore, Ireland

The Power SYBR Green PCR Master Mix is a pre-formulated reagent designed for quantitative real-time PCR (qPCR) experiments. It contains SYBR Green I dye, optimized buffer components, and a DNA polymerase enzyme. The master mix is intended to simplify setup and improve the consistency of qPCR reactions.

Tamoxifen by Cayman Chemical

Sourced in United States, United Kingdom

Tamoxifen is a selective estrogen receptor modulator (SERM) that is commonly used in laboratory research settings. It functions by binding to estrogen receptors, thereby modulating their activity. Tamoxifen is often utilized in studies related to hormone-dependent processes and cellular signaling pathways.

Primescript rt reagent kit by Takara Bio

Sourced in Japan, China, United States, France, Germany, Switzerland, Canada, Sweden, Puerto Rico, Singapore

The PrimeScript RT reagent kit is a reverse transcription kit designed for the synthesis of first-strand cDNA from RNA templates. The kit includes RNase-free reagents and enzymes necessary for the reverse transcription process.

Hybond n by GE Healthcare

Sourced in United Kingdom, United States, Germany, Japan

Hybond-N is a nylon-based membrane used in nucleic acid hybridization and transfer applications. It provides a high-binding capacity for both DNA and RNA, allowing for efficient immobilization and detection of these biomolecules.

Female c57bl 6 mice by Charles River Laboratories

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Montenegro, Spain

Female C57BL/6 mice are laboratory rodents commonly used in scientific research. They are genetically inbred and have a well-characterized genetic background. These mice are widely utilized as animal models in various fields of study, including immunology, oncology, and neuroscience.

Colchicine by Merck Group

Sourced in United States, Germany, France, Canada, India, Japan, United Kingdom, Italy, Spain, Macao

Colchicine is a chemical compound used in various laboratory and research applications. It is a naturally occurring alkaloid derived from the autumn crocus plant. Colchicine is primarily used as a research tool to study cell division and microtubule dynamics.

What is KB 11 and how is it used in research?

KB 11 is a chemical compound that has been studied for its potential therapeutic applications. It is a small molecule that has been investigated for its ability to modulate various biological pathways. KB 11 has shown promise in preclinical studies for the treatment of certain diseases, though its mechanism of action and clinical efficacy are still under investigation. Further research is needed to fully understand the pharmacological properties and therapeutic potential of KB 11.

What are some common challenges researchers face when working with KB 11?

One of the main challenges with KB 11 is the lack of standardization in research protocols. Researchers may use different variations or formulations of KB 11, which can lead to inconsistent results and make it difficult to compare findings across studies. Additionally, the complex mechanisms of action and potential off-target effects of KB 11 can make it challenging to optimize its use for specific research applications.

How can PubCompare.ai help researchers working with KB 11?

PubCompare.ai allows you to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform can help researchers identify the most effective protocols related to KB 11 for their specific research goals. PubCompare.ai's AI-driven analysis can highlight key differences in protocol effectiveness, enabling researchers to choose the best option for reproducibility and accuracy, thus optimizing their research and saving time.

Are there different variations or types of KB 11 that researchers should be aware of?

Yes, there are different variations or formulations of KB 11 that researchers may encounter. Some studies have investigated the use of KB 11 in different solvents, concentrations, or delivery methods, which can impact its effectiveness and pharmacological properties. It's important for researchers to be aware of these variations and to carefully evaluate the specific details of each protocol to ensure they are using the most appropriate form of KB 11 for their research objectives.

What are some of the potential therapeutic applications of KB 11?

KB 11 has shown promise in preclinical studies for the treatment of certain diseases, including [typo] some types of cancer, inflammatory conditions, and neurodegenerative disorders. However, its exact mechanisms of action and clinical efficacy are still under investigation. Further research is needed to fully understand the therapeutic potential of KB 11 and to develop effective treatment protocols for specific disease indications.

More about "KB 11"

KB 11 is a small molecule compound that has garnered attention for its potential therapeutic applications.
This chemical compound has been extensively studied by researchers to understand its ability to modulate various biological pathways.
In preclinical studies, KB 11 has shown promise in the treatment of certain diseases, though its precise mechanism of action and clinical efficacy are still under investigation.
Interestingly, KB 11 shares some similarities with other well-known compounds like PFOS-1 and PNL1.3_secNluc plasmid.
These related molecules have also been the subject of scientific inquiry, with researchers using tools like FlowJo software and Power SYBR Green PCR Master Mix to analyze their properties and behaviors.
The potential therapeutic applications of KB 11 span a wide range of areas, including the treatment of conditions that may be alleviated by compounds like Tamoxifen or those requiring the use of PrimeScript RT reagent kit and Hybond-N.
Researchers have also explored the effects of KB 11 in animal models, such as Female C57BL/6 mice, to better understand its pharmacological profile and potential for clinical use.
Despite the promising results observed in preclinical studies, further research is still needed to fully elucidate the mechanism of action and therapeutic potential of KB 11.
This ongoing investigation may involve the use of techniques like colchicine treatment to gain additional insights into the compound's behavior and interactions within biological systems.
As the scientific community continues to explore the nuances of KB 11 and its related compounds, the potential for new and innovative therapies continues to grow.
With the aid of advanced tools and techniques, researchers are steadily unlocking the secrets of these promising molecules, paving the way for potential breakthroughs in the treatment of various diseases.