Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Biologically Active Substance > Subgenomic RNA

Subgenomic RNA

Subgenomic RNA refers to the smaller RNA molecules produced during the replication of certain viruses, such as coronaviruses.
These subgenomic RNAs are essential for the expression of viral genes and the production of new viral particles.
Understanding the dynamics and regulation of subgenomic RNA is crucial for developing effective treatments and interventions against viral infections.
This MeSH term provides a concise, informative overview of this important area of virology and molecular biology.

Most cited protocols related to «Subgenomic RNA»

1
Quantifying Viral Infection and Interferon Response
Cited 10 times
Tansduced cells were infected with the indicated virus at a dose that gave approximately 50% infected (GFP+) cells, which had been previously determined by FACS-based infectivity assays. Infected cells were harvested at various time points, within the first viral replication cycle when possible: HCV (48 h or 72 h), HIV (48 h), YFV (24 h), WNV (6 h), VEEV (5.5 h), CHIKV (10 h). Adherent cells were harvested into 200 μl Accumax cell dissociation medium (eBioscience) and transferred to a 96 well plate. Cells were pelleted at 2,000 RPM for 5 min at 4°C and resuspended in 1% paraformaldehyde fixation solution for at least 1 h. Cells were pelleted by centrifugation at 2,000 RPM for 5 min at 4°C, resuspended in cold 1X PBS+3% FBS, and stored at 4°C until FACS analysis. Samples were analyzed in a 96 well-based high throughput manner using the LSRII/HTS flow cytometer (BD Biosciences) equipped with a 561nm laser for detection of TagRFP. Data was analyzed using Flowjo software (Treestar) with a 0.1% compensation matrix.
For interferon titrations, Huh-7 or MT-4 T cells were treated with varying doses of IFNβ (PBL InterferonSource) or 1000 U/mL IFNα (Sigma), respectively, for 24 h prior to infection. Cells were infected with HCV (Huh-7) or HIV-1 (MT-4) and replication levels were monitored by FACS as described above.
For SINV-Fluc and SINV(ts6)-Fluc infection, cells were infected at 28°C (ts6) or 37°C (wild type) and harvested 4 h post-infection. Intracellular Fluc levels were assessed by the Luciferase Assay System reporter assay (Promega) according to the manufacturer’s instructions.
For HCV life cycle studies, subgenomic RNAs were generated by in vitro transcription using the RiboMax T7 transcription kit (Promega). 175ng RNA were transfected into 3.5 × 104 ISG-expressing Huh-7 cells with Mirus Reagent (Mirus Bio). Translation and replication were monitored by sampling cell supernatants and assaying for Gluc production over time (at 2, 4, 6, 8, 13.5, 24, 48, and 72 h post-transfection) with the Renilla Luciferase Assay System (Promega), or by quantifying HCV genome copy number by reverse transcription (RT)-PCR as previously described42 .
Schoggins J.W., Wilson S.J., Panis M., Murphy M.Y., Jones C.T., Bieniasz P, & Rice C.M. (2011). A diverse array of gene products are effectors of the type I interferon antiviral response. Nature, 472(7344), 481-485.
Publication 2011
Biological Assay Cells Centrifugation Common Cold DNA Replication Genome HIV-1 Infection Interferon-alpha Interferons Luciferases Luciferases, Renilla paraform Promega Protoplasm Reverse Transcription Subgenomic RNA T-Lymphocyte Titrimetry Transcription, Genetic Transfection Virus Virus Replication
2
Mosquito Cell-based SFV Amplification
Cited 7 times

Ae. albopictus-derived U4.4 mosquito cells were grown at 28°C in L-15 medium with 10% fetal calf serum and 10% tryptose phosphate broth. BHK-21 cells were grown in Glasgow minimum essential medium (GMEM) with 10% newborn calf serum and 10% tryptose phosphate broth at 37°C in a 5% CO2 atmosphere. Amplification of SFV (strain SFV4) and recombinant clones derived from SFV4 in BHK-21 cells (grown as described above), together with titration of plaque forming units (PFU) in BHK-21 cells have been previously described [50] (link). SFV and derived clones were purified from supernatant as described and resuspended in TNE (Tris-NaCl-EDTA) buffer [70] (link). Viruses were diluted in PBSA (PBS with 0.75% bovine serum albumin) and added to U4.4 cells at room temperature for 1 h followed by washing twice to remove any unbound particles; cells were grown at 28°C following infection. Details of reporter viruses (Fig. 1) can be obtained from the authors. The pCMV-SFV4 backbone for production of SFV4 has been previously described [71] (link). A second subgenomic promoter was placed behind the SFV4 structural open reading frame for construction of viruses with duplicated subgenomic promoters [72] (link). This second subgenomic promoter is of the T37/17 type (consisting of a sequence 37 nucleotides upstream and 17 nucleotides downstream of the original transcription start-site of the SFV subgenomic mRNA). The ZsGreen marker was inserted into the C-terminal region of nsP3 via a XhoI site naturally occuring in the genomic sequence (leading to expression of nsP3 containing ZsGreen), while Firefly luciferase (FFLuc) was inserted between duplicated nsP2 cleavage sites at the nsP3/4 junction as a cleavable reporter, using strategies previously shown [73] (link). The full egf1.0 coding sequence (including signal peptide) derived from MdBV was placed under control of the second subgenomic promoter in sense or antisense (as negative control) orientation.
Rodriguez-Andres J., Rani S., Varjak M., Chase-Topping M.E., Beck M.H., Ferguson M.C., Schnettler E., Fragkoudis R., Barry G., Merits A., Fazakerley J.K., Strand M.R, & Kohl A. (2012). Phenoloxidase Activity Acts as a Mosquito Innate Immune Response against Infection with Semliki Forest Virus. PLoS Pathogens, 8(11), e1002977.
Full text: Click here
Publication 2012
Atmosphere Buffers Cells Clone Cells Culicidae Cytokinesis Edetic Acid Fetal Bovine Serum Genome Infant, Newborn Infection Luciferases, Firefly Nucleotides Open Reading Frames Phosphates poly(tetramethylene succinate-co-tetramethylene adipate) Senile Plaques Serum Serum Albumin, Bovine Signal Peptides Sodium Chloride Strains Subgenomic RNA Titrimetry Transcription Initiation Site Tromethamine tryptose Vertebral Column Virus
3
Construction of MNV-1 Infectious cDNA Clones
Cited 7 times
A full-length cDNA clone of MNV 1 CW1 matching the passage 3 consensus sequence (Wobus et al., 2004 (link)), referred to as p20.3 by Sosnovtsev et al. (2006) (link), was supplied by Herbert Virgin IV (Washington University in Saint Louis, MO, USA). For clarity, this construct, containing the MNV 1 genome under the control of a truncated T7 RNA polymerase promoter, will be hereafter referred to as pT7 : MNV-G. A derivative of this construct (pT7 : MNV-GFS), containing a frame shift in the RNA-dependent RNA polymerase [NS7 in Fig. 1(a)], was generated by linearization with XhoI, followed by mung-bean nuclease digestion and religation. A transfer vector containing the AfeI–SacII fragment of the MNV-1 genome (pSL301 : MNV AfeI–SacII) was generated by cloning the fragment into pSL301 (Invitrogen). To repair the frame-shift mutation in pT7 : MNV-GFS, the AfeI–SacII fragment from the transfer vector pSL301 : MNV AfeI–SacII was inserted into pT7 : MNV-GFS to generate pT7 : MNV-GFS/R.
A BglII restriction site was introduced at position 3959 in the MNV genome by the introduction of a single-nucleotide change (C to A) at position 3959 to generate pT7 : MNV-G/BglII. The restriction site was introduced by PCR amplification of the region using the primers IGIC44 and 4450R (See Supplementary Table S1, available in JGV Online), digestion with AfeI and KpnI and subsequent insertion into the pSL301 : MNV AfeI–SacII transfer vector (see above). The mutated fragment was subcloned into pT7 : MNV-G via the AfeI and SacII sites. Insertion of the desired mutation, which did not affect the encoded polypeptide sequence, was confirmed by sequencing.
To insert a hepatitis delta virus ribozyme into pT7 : MNV-G at the 3′ end of the genome and to repair the 3′-terminal nucleotide, a derivative of the ribozyme containing a 5′ NheI site was PCR-amplified from pRZ (Walker et al., 2003 (link)) using the primers PUC-F and PUC-R (see Supplementary Table S1, available in JGV Online). The resultant PCR product was digested with NheI and ligated to the NheI-digested MNV subgenomic PCR product generated by using primers IGIC21 and IGIC37 (see Supplementary Table S1, available in JGV Online). The ligated product was subsequently digested with SacII and EcoRV and inserted into pT7 : MNV-G that had been digested with SacII and SnaBI. The resultant plasmid, pT7 : MNV-G 3′Rz, contained the MNV genomic RNA flanked by a truncated T7 RNA polymerase promoter at the 5′ end and a hepatitis delta virus ribozyme at the 3′ end. The RNA produced from this construct contained no additional non-viral nucleotides. A similar construct that lacked the 3′ ribozyme, but which contained a correct 3′-terminal nucleotide, referred to as pT7 : MNV-G 3′Rp, was generated by ligation of the 3′ SacII–NheI fragment from pT7 : MNV-G 3′Rz with SacII- and SnaBI-digested pT7 : MNV. The resulting construct, pT7 : MNV-G 3′Rp, was identical to pT7 : MNV-G 3′Rz, but lacked the 3′ hepatitis delta virus ribozyme.
The MNV 1 subgenomic RNA cDNA expression construct pT7 : MNV-SG was generated by RT-PCR amplification of RNA purified from MNV 1 CW1-infected cells, using primers IGIC21 and IGIC22 (see Supplementary Table S1, available in JGV Online). The amplified product was digested with NotI and SwaI and inserted into pTriEx1.1 (Novagen) between the NotI and MscI sites. The construct was then sequenced fully to confirm that it matched the reported CW1 passage 3 consensus sequence.
Chaudhry Y., Skinner M.A, & Goodfellow I.G. (2007). Recovery of genetically defined murine norovirus in tissue culture by using a fowlpox virus expressing T7 RNA polymerase. The Journal of General Virology, 88(Pt 8), 2091-2100.
Full text: Click here
Publication 2007
bacteriophage T7 RNA polymerase Catalytic RNA Cells Cloning Vectors Consensus Sequence Digestion DNA, Complementary Frameshift Mutation Genome Hepatitis Delta Virus Insertion Mutation Ligation Mung Bean Nuclease Nucleotides Oligonucleotide Primers Plasmids Polypeptides Reading Frames Reverse Transcriptase Polymerase Chain Reaction RNA-Directed RNA Polymerase Subgenomic RNA Transcription, Genetic Walkers
4
Generating CRISPR-Edited ESR1 Mutant Cell Lines
Cited 6 times
To select subgenomic RNAs (sgRNAs) (Additional file 1: Table S1) for CRISPR-Cas9 genome-editing of T47D cells [12 (link)–15 (link)], we utilized a web tool (http://crispr.mit.edu) entering the sequence flanking Y537S and D538G mutations. The oligos were cloned into PX458 (www.addgene.com), also coding for Cas9, tracrRNA, green fluorescent protein (GFP), and the resulting plasmid was transfected along with the respective double-stranded 70 bp oligos into T47D cells. GFP+ cells were sorted by fluorescence-activated cell sorting (FACS), and the mutation was confirmed by Sanger sequencing (Additional file 2: Figure S1) and digital droplet PCR (ddPCR) using previously described methods [16 (link)] (Fig. 1a). We obtained two clones for Y537S, three clones for D538G, and three clones for ESR1 wild-type (WT), which were kept as individual clones, and pooled for experimental studies as indicated.

Generation and characterization of ESR1 mutant, genome-edited MCF7 and T47D cell line models. a ESR1 mutation allele frequency in DNA and RNA was determined by digital droplet PCR. b T47D and MCF7 wild-type (WT) or mutant clones were pooled and treated with vehicle, 1 nM estradiol (E2) or 1 μM of fulvestrant (Ful) for 24 h, and lysates were immunoblotted as indicated. The blot is representative of three independent experiments. ER estrogen receptor. c T47D and MCF7 clones were pooled after hormone deprivation, transfected with ERE-TK, and relative light units (RLU) were determined (one-way analysis of variance (Anova), **p < 0.01). The experiment was repeated three times and the figure shows one representative experiment with two biological replicates. d Hormone-deprived T47D and MCF7 cells were treated with vehicle, 1 nM E2, 1 μM fulvestrant or 1 nM E2 with 1 μM fulvestrant for 12 h, and RNA was isolated, and RT-qPCR was performed (one-way Anova for comparison of basal level, Student’s t test for comparison of fulvestrant response in the presence of E2, *p < 0.05, **p < 0.01)

Gene targeting of ESR1 in MCF7 cells was carried out using recombinant adeno-associated virus (AAV) technology as previously described [17 (link)]. Briefly, ESR1 was targeted using one AAV vector for both the ESR1 Y537S and D538G mutations. AAV vectors were generated by ligating WT homology arms into an AAV plasmid backbone (Agilent, La Jolla, CA, USA), and site-directed mutagenesis was utilized to generate the Y537S and D538G mutations within the targeting construct. Virus was prepared by co-transfecting HEK-293 T cells with pHelper, pRC (Agilent) and the respective ESR1 mutation carrying rAAV targeting plasmid: 106 cells were infected, neomycin-resistant clones were isolated using a modified PCR screening strategy [18 (link)], and the cells were then exposed to Cre-expressing recombinant adenovirus to remove the neomycin cassette. Clones were confirmed by Sanger sequencing (Additional file 2: Figure S1), and ddPCR (Fig. 1a). Single-stranded cDNA was generated using the First Strand cDNA Synthesis Kit (Amersham Biosciences). Two clones and a targeted WT control for the ESR1 exon 10 locus were isolated for each ESR1 mutation. Primer sequences for PCR amplification, mutagenesis, targeting, and sequencing are shown in the Additional file 1: Table S2.
Bahreini A., Li Z., Wang P., Levine K.M., Tasdemir N., Cao L., Weir H.M., Puhalla S.L., Davidson N.E., Stern A.M., Chu D., Park B.H., Lee A.V, & Oesterreich S. (2017). Mutation site and context dependent effects of ESR1 mutation in genome-edited breast cancer cell models. Breast Cancer Research : BCR, 19, 60.
Full text: Click here
Publication 2017
2',5'-oligoadenylate Adenovirus Vaccine Alleles Anabolism Arm, Upper Biopharmaceuticals Cells Clone Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats crRNA, Transactivating Dependovirus DNA, A-Form DNA, Complementary Estradiol estrogen receptor alpha, human Exons Fingers Fulvestrant Genome Green Fluorescent Proteins HEK293 Cells Hormones Light MCF-7 Cells Mutagenesis Mutagenesis, Site-Directed Mutation Neomycin Oligonucleotide Primers Plasmids Student Subgenomic RNA Vertebral Column Virus
5
MERS-CoV RNA Quantification by RT-qPCR
Cited 6 times
Total intracellular RNA was extracted from transfected or infected cells with the RNeasy miniprep kit (Qiagen) according to the manufacturer’s specifications. In the case of transfected cells, the residual DNA was removed from samples by treating 7 µg of each RNA with 20 U of DNase I (Roche) in 100 µl for 30 min at 37°C, and DNA-free RNAs were repurified using the RNeasy miniprep kit (Qiagen). Viral RNA synthesis was quantified by RT-qPCR. Total cDNA was synthesized with random hexamers from 100 ng of total RNA using a high-capacity cDNA reverse transcription kit (Invitrogen). Using this cDNA, the viral RNA synthesis was analyzed using two custom TaqMan assays specific for MERS-CoV gRNA (forward primer 5′ GCACATCTGTGGTTCTCCTCTCT 3′, reverse primer 5′ AAGCCCAGGCCCTACTATTAGC 3′, and MGB probe 5′ TGCTCCAACAGTTACAC 3′) and sgmRNA N (forward primer 5′ CTTCCCCTCGTTCTCTTGCA 3′, reverse primer 5′ TCATTGTTATCGGCAAAGGAAA 3′, and MGB probe 5′ CTTTGATTTTAACGAATCTC 3′). Data were acquired with an Applied Biosystems 7500 real-time PCR system and analyzed with ABI PRISM 7500 software, version 2.0.5. The relative quantifications were performed using the cycle threshold (2−∆∆CT) method (63 (link)). To normalize for differences in RNA sampling, the expression of eukaryotic 18S rRNA was analyzed using a specific TaqMan gene expression assay (Hs99999901_s1; Applied Biosystems).
Almazán F., DeDiego M.L., Sola I., Zuñiga S., Nieto-Torres J.L., Marquez-Jurado S., Andrés G, & Enjuanes L. (2013). Engineering a Replication-Competent, Propagation-Defective Middle East Respiratory Syndrome Coronavirus as a Vaccine Candidate. mBio, 4(5), e00650-13.
Publication 2013
Anabolism Biological Assay Cells Deoxyribonuclease I DNA, Complementary Eukaryotic Cells Gene Expression Middle East Respiratory Syndrome Coronavirus Oligonucleotide Primers prisma Protoplasm Reverse Transcription RNA, Ribosomal, 18S RNA, Viral Subgenomic RNA

Most recents protocols related to «Subgenomic RNA»

1
Sensitive Taqman qRT-PCR for SARS-CoV-2 Subgenomic RNA
As there were subgenomic amplicons detected at low viral titres at Day 13 and 15 that reflected non-specific amplification with SyBr Green qPCR using ARTIC primers, we wanted to compare how one-step Taqman qRT-PCR assay fared compared to RT followed by SyBr Green qPCR. Taqman PCR were designed with one primer in the TRS-L and the other primer and the Taqman probe located within the subgenomic fragment about 20,000 nuclceotides away. Taqman probes resulted in better concordance between subgenomic RNA and genomic RNA and can be is empirically more sensitive compared to the two-step qRT-PCR as seen from the ability to detect the subgenomic RNA on P07 Day 12 (Supplementary Figure S3).
Real time probe qPCR measurements were performed Applied Biosystems QuantStudio system. Primers were designed to span 7b-mrna (seq_143) and E-mRNA (seq_133) respectively (Table 2) and the experiment was conducted as per TOYOBO THUNDERBIRD™ Probe qPCR Master Mix instructions. For SARS-COV-2 genomic RNA, 1 µl of heat-inactivated RNA was amplified using a 10 µl Fortitude 2.1 mix (MiRXES) as per manufacturer’s instructions (scaled to 10 µl reaction). For subgenomic RNA, 1 µl of heat-inactivated RNA was mixed with 5 µl qPCR mastermix, 0.25 µl DNA polymerase, 0.25µl RT, 0.25 µl 10 µM probe, 0.5 µl 10 µM primers in a 10 µl reaction. For both reactions, the cycling conditions were as followed, 48°C 15 min, 95°C 2 min, and 45 cycles of 95°C 10s, 59°C 30s.
Koh L.C., Seow Y., Kong K.W., Lau M.L., Kumar S.K., Yan G., Lee C.K., Yan B., Tambyah P.A, & Hoon S. (2023). Sub genomic analysis of SARS-CoV-2 using short read amplicon-based sequencing. Frontiers in Genetics, 14, 1086865.
Full text: Click here
Publication 2023
Biological Assay DNA-Directed DNA Polymerase Genome Oligonucleotide Primers RNA, Messenger SARS-CoV-2 Subgenomic RNA SYBR Green I Vision
2
Real-time qPCR for SARS-CoV-2 Subgenomic RNA
Real-time PCR with SyBr Green was performed with 10 µl reactions using the FirePol MasterMix (Solis Biodyne) with 1 µl of 1:5 dilution of cDNA prepared previously for sequencing and 0.5 µl of 10 µM primers. For subgenomic RNA, we used covid_1 primer_left and covid_113/133/137/139/143/145/146/148 primer_right from the pool PCR primer set (Table 1) for qPCR.
Koh L.C., Seow Y., Kong K.W., Lau M.L., Kumar S.K., Yan G., Lee C.K., Yan B., Tambyah P.A, & Hoon S. (2023). Sub genomic analysis of SARS-CoV-2 using short read amplicon-based sequencing. Frontiers in Genetics, 14, 1086865.
Full text: Click here
Publication 2023
DNA, Complementary Oligonucleotide Primers Real-Time Polymerase Chain Reaction Subgenomic RNA SYBR Green I Technique, Dilution
3
RNA Isolation and Northern Blot Analysis
Total RNA was isolated from cells lysed in 20 mM Tris-HCl (pH 7.4), 100 mM LiCl, 2 mM EDTA, 5 mM DTT, 5% (w/v) lithium dodecyl sulfate, and 100 mg/ml proteinase K as described previously [21 (link)]. RNA was separated in 1.5% denaturing formaldehyde-agarose gels using the MOPS buffer system as described previously [114 (link)]. RNA molecules were detected by direct hybridization of the dried gel with 32P-labeled oligonucleotides essentially as described previously [115 (link)]. CHIKV positive- or negative-stranded RNAs were visualized as described previously [21 (link)] using probe CHIKV-hyb4 or CHIKV-hyb2, which are complementary to the 3’ end of the genome (detects genome and subgenomic mRNA) and anti-genome (detects negative-stranded RNA), respectively. 18S ribosomal RNA was used as loading control. Storage Phosphor screens were exposed to hybridized gels and scanned with a Typhoon-9410 scanner (GE Healthcare).
Treffers E.E., Tas A., Scholte F.E., de Ru A.H., Snijder E.J., van Veelen P.A, & van Hemert M.J. (2023). The alphavirus nonstructural protein 2 NTPase induces a host translational shut-off through phosphorylation of eEF2 via cAMP-PKA-eEF2K signaling. PLOS Pathogens, 19(2), e1011179.
Full text: Click here
Publication 2023
Buffers Cells Crossbreeding dodecyl sulfate, lithium salt Edetic Acid Endopeptidase K Formaldehyde Gels Genome morpholinopropane sulfonic acid Oligonucleotides Phosphorus RNA, Ribosomal, 18S Sepharose Subgenomic RNA Tromethamine Typhoons
4
Quantitative SARS-CoV-2 Detection and Subgenomic RNA Assay
Post-challenge oral swabs were analyzed at the DUKE Human Vaccine Center IVQAC. The assay for SARS-CoV-2 quantitative Polymerase Chain Reaction (qPCR) detects total RNA using the WHO primer/probe set E_Sarbeco (Charité/Berlin). A QIAsymphony DSP, automated sample preparation platform along with a virus/pathogen DSP midi kit, were used to extract viral RNA from 800 μL of sample. A reverse primer specific to the envelope gene of SARS-CoV-2 (5′-ATA TTG CAG CAG TAC GCA CAC A-3′) was annealed and then reverse transcribed into cDNA using SuperScript™ III Reverse Transcriptase with RNase Out. The resulting cDNA was treated with RNase H (Thermo Fisher Scientific) and then added to a custom 4x TaqMan™ Gene Expression Master Mix containing primers and a fluorescently labeled hydrolysis probe specific for the envelope gene of SARS-CoV-2 (forward primer 5′-ACA GGT ACG TTA ATA GTT AAT AGC GT-3′, reverse primer 5′-ATA TTG CAG CAG TAC GCA CAC A-3′, probe 5′-6FAM/AC ACT AGC C/ZENA TCC TTA CTG CGC TTC G/IABkFQ-3′). SARS-CoV-2 RNA copies per reaction were interpolated using quantification cycle data and a serial dilution of a highly characterized custom DNA plasmid containing the SARS-CoV-2 envelope gene sequence. Mean RNA copies per milliliter were then calculated by applying the assay dilution factor with a limit of detection (LOD) approximately 62 RNA copies per mL of sample.
SARS-CoV-2 N gene subgenomic mRNA was measured by a one-step RT-qPCR. To generate standard curves, a SARS-CoV-2 E gene sgRNA sequence, including the 5′UTR leader sequence, transcriptional regulatory sequence, and the first 228 bp of E gene, was cloned into a pcDNA3.1 plasmid. For generating SARS-CoV-2 N gene sgRNA, the E gene was replaced with the first 227 bp of N gene. The respectively pcDNA3.1 plasmids were linearized, transcribed using MEGAscript T7 Transcription Kit, and purified with MEGAclear Transcription Clean-Up Kit. The purified RNA products were quantified on Nanodrop, serial diluted, and aliquoted as E sgRNA or N sgRNA standards. RNA extracted from samples or standards were then measured in Taqman custom gene expression assays using TaqMan Fast Virus 1-Step Master Mix and custom primers/probes targeting the E gene sgRNA (F primer: 5′ CGATCTCTTGTAGATCTGTTCTCE 3′; R primer: 5′ ATATTGCAGCAGTACGCACACA 3′; probe: 5′ FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 3′) or the N gene sgRNA (F primer: 5′ CGATCTCTTGTAGATCTGTTCTC 3′; R primer: 5′ GGTGAACCAAGACGCAGTAT 3′; probe: 5′ FAM-TAACCAGAATGGAGAACGCAGTG GG-BHQ1 3′). Standard curves were used to calculate E sgRNA in copies per mL; the limit of detections (LOD) for N sgRNA assays were approximately 31 copies per mL of sample.
Braun M.R., Martinez C.I., Dora E.G., Showalter L.J., Mercedes A.R, & Tucker S.N. (2023). Mucosal immunization with Ad5-based vaccines protects Syrian hamsters from challenge with omicron and delta variants of SARS-CoV-2. Frontiers in Immunology, 14, 1086035.
Full text: Click here
Publication 2023
5' Untranslated Regions Biological Assay DNA, A-Form DNA, Complementary factor A Gene Expression Genes Genes, env Homo sapiens Hydrolysis Oligonucleotide Primers Pathogenicity Plasmids Polymerase Chain Reaction Ribonuclease H Ribonuclease III RNA, Viral RNA-Directed DNA Polymerase SARS-CoV-2 Signal Peptides Subgenomic RNA Technique, Dilution Transcription, Genetic Vaccines Virus
5
Quantifying SARS-CoV-2 RNA Levels
The RNeasy Mini Kit (Qiagen) was utilized to extract RNA from cell supernatants and lysates. For evaluating viral RNA levels, the PrimerScript RT Reagent Kit (TaKaRa) was used to perform the first reverse transcription following the manufacturer's instructions. RT–qPCR reactions were performed using the PowerUp SYBG Green Master Mix Kit (Applied Biosystems) and the following cycling protocol: 50°C for 2 minutes, 95°C for 2 min, then 40 cycles of 95°C for 15 s and 60°C for 30 s, followed by 95°C for 15 s, 60°C for 1 minute, and 95°C for 45 s. The following primer sequences were used for RT–qPCR to target the envelope (E) gene of SARS‐CoV‐2:
forward: 5′‐TCGTTTCGGAAGAGACAGGT‐3′,
reverse: 5′‐GCGCAGTAAGGATGGCTAGT‐3′.
We assessed viral E subgenomic mRNA (sgRNA) loads using a one‐step RT–qPCR based on previously described methods.6, 7 Briefly, the primer sequences consist of the following:
forward: 5′CGATCTCTTGTAGATCTGTTCTCE3′;
reverse: 5′ATATTGCAGCAGTACGCACACA3′;
probe: 5′ FAM‐ACACTAGCCATCCTTACTGCGCTTCG‐BHQ1 3′.
Zhang Y., Lv Q., Qi F., Li F., Deng R., Liang X., Liu M., Yan Y, & Bao L. (2023). Comparison of the replication and neutralization of different SARS‐CoV‐2 Omicron subvariants in vitro. Animal Models and Experimental Medicine, 6(1), 51-56.
Full text: Click here
Publication 2023
Cells Genes Oligonucleotide Primers Reverse Transcription RNA, Viral SARS-CoV-2 Subgenomic RNA

Top products related to «Subgenomic RNA»

1
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
2
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
3
Qiaamp viral rna mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, France, Spain, Japan, China, Netherlands, Italy, Australia, Canada, Switzerland, Belgium
The QIAamp Viral RNA Mini Kit is a laboratory equipment designed for the extraction and purification of viral RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and isolate viral RNA, which can then be used for downstream applications such as RT-PCR analysis.
4
Custom taqman gene expression assay by Thermo Fisher Scientific
Sourced in United States
Custom TaqMan® Gene Expression Assays are pre-designed and made-to-order qPCR assays for the detection and quantification of specific gene targets. These assays utilize TaqMan® probe technology to provide sensitive and specific gene expression analysis.
5
Superscript 3 vilo by Thermo Fisher Scientific
Sourced in United Kingdom
Superscript III VILO is a reverse transcription reagent system designed for first-strand cDNA synthesis from RNA templates. It utilizes Superscript III reverse transcriptase and VILO (Vanadium Ribonuclease Inhibitor) technology to enable efficient and sensitive cDNA synthesis.
6
Quantstudio 6 and 7 flex real time pcr system by Thermo Fisher Scientific
Sourced in United States, China
The QuantStudio 6 and 7 Flex Real-Time PCR Systems are thermal cycler instruments designed for real-time PCR applications. They provide precise temperature control and optical detection capabilities for quantitative gene expression analysis, genotyping, and other real-time PCR assays.
7
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
8
High capacity cdna reverse transcription kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia
The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.
9
Amplicap max t7 high yield message maker kit by CellScript
Sourced in United States
The AmpliCap-Max T7 High Yield Message Maker Kit is a laboratory equipment product designed for in vitro transcription of messenger RNA (mRNA). The kit provides the necessary components, including the T7 RNA polymerase enzyme, to generate high-yield mRNA transcripts from DNA templates.
10
Rotor gene probe kit by Qiagen
The Rotor-Gene probe kit is a laboratory equipment product designed for real-time PCR analysis. It provides the necessary components to perform quantitative analysis of nucleic acid targets using probe-based detection.

More about "Subgenomic RNA"

Subgenomic RNA (sgRNA) refers to the smaller RNA molecules produced during the replication of certain viruses, such as coronaviruses.
These subgenomic RNAs are essential for the expression of viral genes and the production of new viral particles.
Understanding the dynamics and regulation of subgenomic RNA is crucial for developing effective treatments and interventions against viral infections.
Subgenomic RNA is a key area of study in virology and molecular biology.
It is closely related to other important concepts like genomic RNA, transcription, translation, and viral replication.
Researchers often use techniques like RT-qPCR, RNA extraction (e.g., RNeasy Mini Kit, TRIzol reagent, QIAamp Viral RNA Mini Kit), and gene expression analysis (e.g., Custom TaqMan® Gene Expression Assays, Superscript III VILO, QuantStudio 6 and 7 Flex Real-Time PCR System) to investigate subgenomic RNA dynamics and regulation.
Some common abbreviations and related terms include: sgRNA, mRNA, viral RNA, coronavirus, SARS-CoV-2, qRT-PCR, RT-qPCR, RNA extraction, gene expression, transcription, translation, and viral replication.
Key subtopics include viral genome organization, transcription initiation, subgenomic RNA synthesis, RNA stability, and the role of subgenomic RNAs in viral gene expression and particle assembly.
To enhance reproducibility and research accuracy, tools like PubCompare.ai can help researchers identify the best protocols from literature, preprints, and patents for subgenomic RNA studies.
By leveraging AI-driven protocol optimization, scientists can improve the quality and reliability of their subgenomic RNA research.
Experince the power of AI-driven protocol optimization today!