> Chemicals & Drugs > Biologically Active Substance > Thymidine

Thymidine

Thymidine is a pyrimidine nucleoside that serves as a building block for DNA synthesis.
It plays a crucial role in cell division and proliferation, making it an important research target for studies on DNA replication, cell growth, and related biological processes.
The PubCompare.ai platform can help streamline your Thymidine research by identifying the most reproducible and accurate protocols from the scientific literature, preprints, and patents.
Compare methods side-by-side to find the best approach and products for your experiments, ensuring consistent, reliable results.
Visit PubCompare.ai today and take your Thymidine research to new heights.

Most cited protocols related to «Thymidine»

Site-Directed Mutagenesis Using Recombineering

Oligos used to replace the galK-targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro: 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH₂O to a final concentration of 200 ng/μl double-stranded oligo. An aliquot of 1 μl (200 ng) was used in the recombineering experiments. To introduce the G12D (G<>A) point mutation in the Nras BAC CITB 50J2, the following oligos were used for the second step (the introduced adenosine/thymidine base pair is underlined, the flanking sequences are homologous to the Nras BAC sequence): G12D S: 5′-TTTTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGATGGTGTTGGGAAAAGCGCCTTGACGATCCAGCTAATCCAGAACCACTTT-3′; G12D AS: 5′-AAAGTGGTTCTGGATTAGCTGGATCGTCAAGGCGCTTTTCCCAACACCATCTGCTCCAACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAAAA-3′. To introduce a loxP511 site in the RP23-341F12 BAC, the following oligos were used for the second step (loxP511 is underlined, the flanking sequences are homologous to the BAC sequence around position 95 kb): 95 kb loxP511 S: 5′-ACGTGTGAGCTCCGTGGACAACTCTCCCCGAAGATAACTTCGTATAGTATACATTATACGAAGTTATGTGACTCAGGGACCCTCTCAAGTGAGGCTCAGC-3′; 95 kb loxP511 AS: 5′-GCTGAGCCTCACTTGAGAGGGTCCCTGAGTCACATAACTTCGTATAATGTATACTATACGAAGTTATCTTCGGGGAGAGTTGTCCACGGAGCTCACACGT-3′.

Warming S., Costantino N., Court D.L., Jenkins N.A, & Copeland N.G. (2005). Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Research, 33(4), e36.

Publication 2005

2',5'-oligoadenylate Adenosine Base Pairing Buffers DNA, Double-Stranded Ethanol Homologous Sequences NRAS protein, human Oligonucleotides Point Mutation Thymidine

Comprehensive CRISPR Library Design

To design these libraries, we targeted protein-coding transcripts annotated by the Consensus Coding Sequence Database (CCDS), totaling 18,675 genes for the human genome and 20,077 genes for the mouse genome. When a gene had more than one CCDS ID, we picked the shortest transcript per gene. We annotated NGG protospacer adjacent motifs (PAMs) on both the plus and minus strands and then selected sgRNAs for inclusion in the library on the basis of three criteria, and divided these criteria into tiers. A most-preferred sgRNA would fulfill the first tier of all three criteria. However, not all sgRNAs can have these properties, and thus to reach a quota of 6 sgRNAs per gene, step-wise relaxation of tiers across criteria was necessary, and the properties of each step-wise round of relaxation are given in Supplementary Table 1. Additionally, we excluded sgRNAs with a BsmBI site in their sequence or with a run of four or more thymidines. We selected up to 6 sgRNAs per gene, and this resulted in a human library (Avana) of 110,257 sgRNAs and a mouse library (Asiago) of 120,453 sgRNAs (Supplementary Tables 2, 3). The final distributions of sgRNAs across these criteria within each tier chosen for inclusion in the Avana and Asiago libraries are provided.
Criterion A: Location of the target site in the protein coding sequence, with the four tiers divided by quartiles of the target: (i) 0 - 25% of the protein coding region, (ii) 25 – 50%, (iii) 50 – 75%, (iv) 75 – 100%.

Tier	Description	Avana	Asiago
i	0%-25%	57%	57%
ii	25%-50%	43%	43%
ii	50%-75%	0.06%	0.04%
iv	75%-100%	0.02%	0.01%

Criterion B: To mitigate off-target effects, sequence uniqueness of various lengths, counting from the 3’ end of the sgRNA, e.g. of all possible sgRNAs targeting protein coding genes, the PAM-proximal (i) 13 nts are unique, (ii) 17 nts are unique, (iii) 20 nts are unique or (iv) the sgRNA sequence is not unique.

Tier	Description	Avana	Asiago
i	Unique 13 nts	84%	83%
ii	Unique 17 nts	13%	13%
ii	Unique 20 nts	0.2%	0.4%
iv	not unique	3%	4%

Criterion C: Rule Set 1 on-target score to maximize gene knockout efficacy, divided into deciles; e.g. (i) score of 0.9 – 1.0, (ii) score of 0.8 – 0.9, etc.

Tier	Description	Avana	Asiago
i	0.9-1.0	3%	3%
ii	0.8-0.9	14%	15%
iii	0.7-0.8	22%	23%
iv	0.6-0.7	23%	22%
v	0.5-0.6	17%	16%
vi	0.4-0.5	10%	10%
vii	0.3-0.4	6%	6%
viii	0.2-0.3	3%	3%
ix	0-0.2	1%	1%

Doench J.G., Fusi N., Sullender M., Hegde M., Vaimberg E.W., Donovan K.F., Smith I., Tothova Z., Wilen C., Orchard R., Virgin H.W., Listgarten J, & Root D.E. (2016). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nature biotechnology, 34(2), 184-191.

Publication 2015

Consensus Sequence DNA Library Gene Knockout Techniques Gene Products, Protein Genes Genome Genome, Human Homo sapiens Mus Open Reading Frames Proteins Thymidine

CRISPR Screening Data Analysis Protocol

Illlumina sequencing reads were processed by counting the number of
unique reads for each sgRNA in each experimental condition (Supplementary Tables 2,
3). With each sample for each sgRNA, “Reads per Million”
was determined by dividing the number of reads for an individual sgRNA by the
total number of sgRNA reads in that sample, multiplying by one million, adding
one, and then log2 transforming. Multiple samples for the same experimental
condition were then averaged.
For analysis of pooled screening data, log-fold-change values were
calculated for each sgRNA by subtracting the abundance in the unsorted
population from the abundance in the marker-negative population. We excluded all
sgRNAs that had a run of 4 or more thymidines, as this would be expected to
cause premature transcription termination. We also excluded all sgRNAs that were
present at less than 32 reads per million in the unsorted population. We
visually examined activity maps as a function of cut site position to exclude
from our predictive model any sgRNAs that targeted areas of generally low
activity, even if that meant excluding some outlier sgRNAs with high activity,
in order to ensure that we were not contaminating our modeling dataset with
sequences erroneously assigned as low activity by virtue of their target site
rather than their intrinsic potential efficacy.
Off-target scores (Supplementary Table 4) were obtained from crispr.mit.edu, accessed
April 24, 2014. Data from Hsu et al. were used to calculate the score, as
described on the webserver^{14 (link)}.

Doench J.G., Hartenian E., Graham D.B., Tothova Z., Hegde M., Smith I., Sullender M., Ebert B.L., Xavier R.J, & Root D.E. (2014). Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature biotechnology, 32(12), 1262-1267.

Publication 2014

Clustered Regularly Interspaced Short Palindromic Repeats Microtubule-Associated Proteins Premature Birth Thymidine Transcription Termination, Genetic

Molecular Dynamics Simulation of Protein-Ligand Complexes

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2016

Cuboid Bone dihydrofolate Diphosphates Electrostatics Friction glucosyltransferase D Halogens Homo sapiens Hydrogen Hydrogen Bonds inhibitors Ligands Mitogen-Activated Protein Kinase 10 NADP NADPH Dehydrogenase Oxidoreductase Pressure Proteins Sodium Chloride Staphylococcus aureus Tetrahydrofolate Dehydrogenase Thrombin Thymidine

Synchronization of Centrin-GFP Expressing Cells

L929, NIH 3T3, and HeLa-B cells were grown in DME medium (GIBCO) supplemented with 10% fetal calf serum.
Centrin cDNA was sub-cloned in the pEGFP-N1 vector (Clontech) and cells were transformed by electroporation. Stable clones expressing the centrin/GFP fusion protein were then isolated from each of the three parental cell lines, by using the limited dilution method in the presence of 500 μg/ml G418. Multiple independent clones, expressing ∼20 times the endogenous level of centrin, were kept for each of the three parental cell lines. The centrioles in all of the clones exhibited a similar behavior to that described here.
Synchronization in early G₁ was accomplished by a single thymidine block of 20 h (5 mM thymidine for L929 and 2 mM for HeLa). Mitotic cells were then collected by shakeoff 8 or 20 h after releasing the block (for L929 and HeLa, respectively). Cells were then replated on coverslips and used 2 h later. Synchronization at the G₁/S border was accomplished using the double-thymidine block technique. To determine the duration of S and G₂ we incubated cells at various times after thymidine washout with 30 μM BrdU for 15 min and then analyzed them by FACS^®. The maximum content of S cells (by BrdU incorporation) was reached 1–4 h after release. The maximum number of G₂ cells (double DNA content and no BrdU incorporation) was observed ∼5 h after release in L929 cells and 9–10 h in HeLa cells.

Piel M., Meyer P., Khodjakov A., Rieder C.L, & Bornens M. (2000). The Respective Contributions of the Mother and Daughter Centrioles to Centrosome Activity and Behavior in Vertebrate Cells. The Journal of Cell Biology, 149(2), 317-330.

Publication 2000

antibiotic G 418 Bromodeoxyuridine Cell Lines Centrioles Clone Cells Cloning Vectors DNA, Complementary Electroporation Fetal Bovine Serum HeLa Cells L929 Cells NIH 3T3 Cells Parent Proteins Technique, Dilution Thymidine Trimethoprim-Sulfamethoxazole Combination

Most recents protocols related to «Thymidine»

Proliferation Assay for Activated Immune Cells

To evaluate the proliferative capacity of activated immune cells, SEB-activated MNCs from lungs or in vitro SEB-activated splenocytes were treated with thymidine (methyl-3H; PerkinElmer Health Sciences, United States) isotope at a concentration of 1µCi/well and incubated for 16 h to and then radioactivity was measured using a liquid-scintillation counter (MicroBeta TriLux; PerkinElmer, United States).

Alghetaa H., Mohammed A., Singh N., Wilson K., Cai G., Putluri N., Nagarkatti M, & Nagarkatti P. (2023). Resveratrol attenuates staphylococcal enterotoxin B-activated immune cell metabolism via upregulation of miR-100 and suppression of mTOR signaling pathway. Frontiers in Pharmacology, 14, 1106733.

Full text: Click here

Publication 2023

Isotopes Lung Radioactivity Scintillation Counters Thymidine

Wound Healing Assay Protocol

Pretreated cells were planted in 6 well plates for about 24 h. The middle of the cells in each plate was scratched using a sterilized 200 μL pipette tip, followed by washing with 1 × PBS and then adding 2 ml DMEM containing 2% FBS and 1 mM thymidine (Sigma-Aldrich, USA) into each well. Monitoring the scratches width at 0 and 24 h, respectively.

Hu M., Feng C., Yuan Q., Liu C., Ge B., Sun F, & Zhu X. (2023). Lantern-shaped flexible RNA origami for Smad4 mRNA delivery and growth suppression of colorectal cancer. Nature Communications, 14, 1307.

Full text: Click here

Publication 2023

Thymidine

Monoclonal Antibody Development against SARS-CoV-2 Spike Protein

Six- to seven-week-old female Balb/c mice (Harlan Laboratories) were immunized subcutaneously with 50 µg of recombinant trimeric prefusion-stabilized spike protein emulsified with Incomplete Freund’s adjuvant (Sigma, USA) and boosted 4 weeks later with the same dose of spike protein with Complete Freund’s Adjuvant. Mice with high antibody titer as determined by ELISA were selected for fusion. Four days before the fusion, the mice received three intravenous boosts of 100 µg of spike protein without adjuvant. Mouse splenocytes were harvested and fused with Sp2/0 myeloma cells (ATCC, CRL-1581) to generate antibody-producing hybridoma cells. After hypoxanthine–aminopterin–thymidine (HAT) selective culture, the hybridomas were screened by direct ELISA using MaxiSorp microtiter plates (VWR, USA) coated with 1 µg/ml of recombinant spike protein. Five positive primary hybridoma clones were sub-cloned twice by limiting dilution to obtain stable cell lines secreting monoclonal antibodies. The class and subclass of the mAbs were identified using a mouse isotype kit (Roche, USA). Ten hybridoma cell lines exhibiting high reactivity against Spike protein (S) belonging to the IgG subclass IgG1 were selected and two of them, SpMA-01 and SpMA-02, were investigated further to develop the LFIA.

Mohammad S., Wang Y., Cordero J., Watson C., Molestina R., Rashid S, & Bradford R. (2023). Development and validation of a rapid and easy-to-perform point-of-care lateral flow immunoassay (LFIA) for the detection of SARS-CoV-2 spike protein. Frontiers in Immunology, 14, 1111644.

Full text: Click here

Publication 2023

Aminopterin Antibody-Producing Cells ATP8A2 protein, human Cell Lines Cells Enzyme-Linked Immunosorbent Assay Females Freund's Adjuvant Hybridomas Hypoxanthine IgG1 Immunoglobulin Isotypes Immunoglobulins Mice, Inbred BALB C Monoclonal Antibodies M protein, multiple myeloma Multiple Myeloma Mus Pharmaceutical Adjuvants S-phenyl-N-acetylcysteine Technique, Dilution Thymidine

Cell Proliferation Dynamics in Lizard Telencephalon

To assess the distribution of proliferating cells in the VZ, lizards injected with [³H]-thymidine with a survival time of 1.5 h were used (n = 5). The VZ was divided in six different regions, including three sulcal zones (sulcus medalis, sulcus lateralis and sulcus ventralis/terminalis) and three intersulcal zones (intersulcus corticalis, intersulcus lateralis, and intersulcus septalis) (Figure 1B). The number of [³H]-thymidine labeled cells was counted in all these regions relative to the total number of cells. This quantification was performed in two telencephalic levels: one pre-commissural (anterior) and one post-commissural (posterior), analyzing for each level a total of 7 semithin sections which were 9 μm apart to avoid counting the same cell twice. Different types of counts were performed by quantifying the total number of labeled cells/1000 cells considering sulci vs. intersulcal regions, comparing between the different sulci and intersulcal regions and differentiating between the pre- and post-commissural levels for each animal.
To characterize the ultrastructure of VZ proliferative cells and their derivatives, the brains of specimens with 1.5, 6, 12, 24, and 72 h survival times were examined. Between 50 and 150 [³H]-thymidine-positive ([³H]-thy⁺) cells were analyzed for each survival time, including at least two different antero-posterior levels per lizard. These cells were studied by transmission electron microscopy (TEM) to determine their ultrastructural characteristics. Counts were also made of the number of cells in mitosis (M phase) labeled relative to the total number of [³H]-thy⁺ cells.
The analysis of specimens with long survival times (1, 3, 6, and 12 months) focused mainly on the cell layer of the MC, although we also investigated whether there were labeled cells in the walls of the LVs. Within the MC we analyzed the ultrastructure of 25–50 [³H]-thy⁺ cells from each survival time to see to which neuronal type they corresponded.

González-Granero S., Font E., Desfilis E., Herranz-Pérez V, & García-Verdugo J.M. (2023). Adult neurogenesis in the telencephalon of the lizard Podarcis liolepis. Frontiers in Neuroscience, 17, 1125999.

Full text: Click here

Publication 2023

Animals Brain Cells Cell Survival Cell Wall derivatives Division Phase, Cell Lizards Mitosis Neurons Telencephalon Thymidine Transmission Electron Microscopy

Lizard Brain Cell Proliferation Study

Lizards received intraperitoneal injections of [³H]-thymidine (Amersham; specific activity 5 Ci/mmol). Depending on their survival time, the final dose was different. For survival times of 1.5 h to 3 days, the animals received a single injection with a dose of 5 μCi/g body weight (b. wt.), while for longer survival times (1–12 months) animals received daily injections (5 μCi/g b. wt.) during three consecutive days, up to a total dose of 15 μCi/g b. wt.
For short survival times, we injected four lizards (n = 4) for each survival time (6, 12, 24, and 72 h), except for the 1.5 h survival time, for which we injected five (n = 5). For long survival times (1, 3, 6, and 12 months) we injected 3 animals for each time (n = 3).
Following their corresponding survival time, the animals were deeply anesthetized with Ketolar (ketamine hydrochloride, 0.6 mg/g b. wt.) and perfused with saline (0.9% NaCl), followed by a fixative consisting of 4% PFA and 2% GA. The complete bodies of the lizards were postfixed in the same fixative during 24 h. The brains were removed from the skull, sectioned frontally or longitudinally on a vibratome at 200 μm, postfixed in 2% osmium tetroxide for 2 h, rinsed, dehydrated, and embedded in epoxy resin (Durcupan, Sigma, San Luis, MO, USA). Semithin sections were cut at 1.5 μm with an ultramicrotome (UC6 Ultracut, Leica, Wetzlar, Germany) and mounted on gelatin-coated glass-slides, which were dipped in LM-1 hypercoat emulsion (Amersham), dried in the dark, and stored at 4°C for 30 days. The autoradiographs were developed using standard methods and counterstained with 1% toluidine blue.

Full text: Click here

Publication 2023

Animals Autoradiography Body Weight Brain Cranium Desiccation Durcupan Emulsions Epoxy Resins Fixatives Gelatins Human Body Injections, Intraperitoneal Ketamine Hydrochloride Lizards Normal Saline Osmium Tetroxide Saline Solution Thymidine Tolonium Chloride Ultramicrotomy

Top products related to «Thymidine»

Thymidine by Merck Group

Sourced in United States, Germany, United Kingdom, Sao Tome and Principe, France, Italy, Japan, China

Thymidine is a nucleoside that is a component of DNA. It serves as a building block for DNA synthesis and is essential for cellular division and growth.

3h thymidine by PerkinElmer

Sourced in United States, Germany, United Kingdom, Belgium, Australia, Israel, Canada, France

3H-thymidine is a radioactively labeled nucleoside that can be used as a tracer in biological research. It is a stable isotope of the DNA base thymine, with the hydrogen atom at the 3' position of the deoxyribose sugar being replaced with a tritium (hydrogen-3) atom. 3H-thymidine can be incorporated into newly synthesized DNA during cellular replication, allowing for the identification and quantification of proliferating cells.

Nocodazole by Merck Group

Sourced in United States, Germany, United Kingdom, Japan, Sao Tome and Principe, Canada, China, Switzerland, France, Poland, Macao, Australia

Nocodazole is a synthetic compound that acts as a microtubule-destabilizing agent. It functions by binding to and disrupting the polymerization of microtubules, which are essential components of the cytoskeleton in eukaryotic cells. This property makes Nocodazole a valuable tool in cell biology research for studying cell division, cell motility, and other cellular processes that rely on the dynamics of the microtubule network.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

3h thymidine by Cytiva

Sourced in United Kingdom, United States, Sweden, Germany, France, Austria, Italy, Hungary, Australia, Switzerland

3H-thymidine is a radioactive compound used in biological research. It is a tritium-labeled form of the nucleoside thymidine, which is incorporated into DNA during cell division. 3H-thymidine can be used to measure cellular proliferation and DNA synthesis.

Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica

DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

Penicillin streptomycin by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia

Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.

Bromodeoxyuridine (brdu) by Merck Group

Sourced in United States, Germany, United Kingdom, France, Spain, China, Sao Tome and Principe, Switzerland, Macao, Australia, Canada, Belgium, Japan, Israel, Poland

BrdU is a synthetic nucleoside that is an analog of the DNA base thymidine. It can be incorporated into the newly synthesized DNA of replicating cells, substituting for thymidine during the DNA synthesis phase of the cell cycle.

Methyl 3h thymidine by PerkinElmer

Sourced in United States, United Kingdom, Italy, Japan, Germany, France

[methyl-3H]-thymidine is a radiolabeled nucleoside used as a tracer in biological research applications. It is commonly used to study cell proliferation and DNA synthesis.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

What are the different types or variations of Thymidine?

Thymidine, also known as 2'-deoxythymidine, is the pyrimidine nucleoside that serves as a building block for DNA synthesis. While there is primarily one form of Thymidine, there are some related nucleosides that can have slightly different properties or applications, such as 5-Bromo-2'-deoxyuridine (BrdU) and 5-Iodo-2'-deoxyuridine (IdU), which can be used as thymidine analogs for labeling and tracking DNA replication.

What are the key applications of Thymidine in biological research?

Thymidine plays a crucial role in cell division and proliferation, making it an important research target for studies on DNA replication, cell growth, and related biological processes. Some common applications of Thymidine include: - Studying DNA synthesis and cell cycle dynamics - Tracking cell proliferation and cell division using thymidine analogs like BrdU or IdU - Investigating DNA repair mechanisms - Evaluating the effects of potential anticancer or anti-proliferative drugs

What are some common challenges in using Thymidine for research?

One of the main challenges in using Thymidine for research is ensuring consistent, reproducible results. Factors like protocol variations, reagent quality, and experimental conditions can all impact the effectiveness and reliability of Thymidine-based assays. Researchers may also encounter issues with Thymidine toxicity or non-specific labeling when using thymidine analogs.

How can PubCompare.ai help with Thymidine research?

PubCompare.ai is a powerful tool that can help streamline your Thymidine research by identifying the most reproducible and accurate protocols from the scientific literature, preprints, and patents. The platfrom's AI-driven analysis can: 1. Scren protocol literature more efficiently by rapidly comparing dozens of Thymidine-related methods side-by-side. 2. Leverge AI to pinpoint critical insights, such as key differences in protocol effectiveness, that can help you choose the best option for reproducibility and accuracy. By using PubCompare.ai, you can save time, reduce experimentation costs, and ensure consistent, reliable results in your Thymidine research.

More about "Thymidine"

Thymidine, also known as dThd or dT, is a pyrimidine nucleoside that plays a crucial role in DNA synthesis and cell division.
It serves as a fundamental building block for DNA replication, making it an essential component in cellular growth and proliferation. 3H-thymidine, a radioactive isotope of thymidine, is commonly used as a tracer to study DNA synthesis and cell cycle dynamics.
The incorporation of thymidine or its analogs, such as BrdU (5-bromo-2'-deoxyuridine), into newly synthesized DNA is a widely used technique to assess cell proliferation and track the progression of the cell cycle.
Nocodazole, a microtubule-disrupting agent, can be used in combination with thymidine to synchronize cells in the G2/M phase, allowing for the investigation of specific cell cycle events.
Thymidine research often involves cell culture techniques, where it is supplemented in growth media like DMEM (Dulbecco's Modified Eagle Medium) and used in conjunction with other components such as fetal bovine serum (FBS) and penicillin/streptomycin antibiotics.
The use of [methyl-3H]-thymidine, a radiolabeled version of thymidine, enables the quantification of DNA synthesis and cell proliferation through techniques like scintillation counting.
Optimizing thymidine-based protocols can be streamlined using the PubCompare.ai platform, which helps researchers identify the most reproducible and accurate methods from the scientific literature, preprints, and patents.
By comparing protocols side-by-side, researchers can select the best approaches and products for their thymidine-related experiments, ensuring consistent and reliable results.
Whether you're studying DNA replication, cell growth, or related biological processes, PubCompare.ai can elevate your thymidine research to new heights.