> Chemicals & Drugs > Biomedical or Dental Material > Nylon 6

← Novus

Nylons →

Nylon 6

Nylon 6 is a synthetic polymer that belongs to the polyamide family.
It is a versatile material used in a variety of applications, such as textiles, plastics, and engineering components.
Nylon 6 is characterized by its strong mechanical properties, chemical resistance, and thermal stability.
Reserach into optimizing the prodduction and performance of Nylon 6 is an active area of study, with many protocols and methods published in the scientific literature, preprints, and patents.
PubCompare.ai is an AI-driven platform that helps researchers identify the most effective Nylon 6 protocols by comparing and analyzing the available information, thereby enhancing reproducibility and accuracy in Nylon 6 reserach.
By leveraging advanced AI technology, PubCompare.ai streamlines the research workflow and enables researchers to optimize their Nylon 6 studies.

Most cited protocols related to «Nylon 6»

Accelerometer-based Motion Tracking Protocol

The accelerometer comprised a tri-axial STMicroelectronics accelerometer (LIS3LV02DL) with a dynamic range of ±6 g (1 g = 9.81 m·s⁻²), as described elsewhere [20] . The acceleration was sampled at 80 Hz and data were stored in g units for offline analyses. In the robot experiment, the accelerometer was aligned by two aluminium strips on each side of the bar (insert, Figure 1) and covered by duck-tape on top, see Figure 1. The radius length, i.e. the distance from the axis of rotation to the accelerometer chip, was assessed by measurement tape to the closest mm. The position of the accelerometer chip inside the accelerometer packaging was obtained from the manufacturer. In the human experiment, the accelerometers were attached to the wrist with a nylon weave strap and to the hip with an elastic belt. Participants were instructed to wear the accelerometer on the wrist continuously for 24 hours per day throughout the whole observation period and to remove the hip accelerometer during sleeping hours. The manufacturer calibration of all acceleration sensors was tested under static conditions (no movement, vector magnitude = 1 g) and adjusted if necessary.

van Hees V.T., Gorzelniak L., Dean León E.C., Eder M., Pias M., Taherian S., Ekelund U., Renström F., Franks P.W., Horsch A, & Brage S. (2013). Separating Movement and Gravity Components in an Acceleration Signal and Implications for the Assessment of Human Daily Physical Activity. PLoS ONE, 8(4), e61691.

Full text: Click here

Publication 2013

Acceleration Aluminum Cloning Vectors DNA Chips Ducks Epistropheus Homo sapiens Movement Nylons Radius Wrist

Optimizing Northern Blot Analysis for miRNA Detection

Total RNA from MCF-7 cells was loaded onto 15% SequaGel (National Diagnostics), electrophoresed and transferred to nylon membranes at 10–15 V (90 min) using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad). Membranes were cross-linked to the RNA (60°C for 1–2 h) using freshly prepared cross-linking reagent (Doc-S). For ³²P-based blots, LNA–DNA mixed oligonucleotide probes were end-labeled with [γ-³²P] ATP by T4 polynucleotide kinase using KinaseMaxTM Kit (Ambion). For human miRNAs, pre-synthesized LNA-modified oligonucleotides were purchased from Exiqon (http://www.exiqon.com). For the KSHV miRNA, the probes were synthesized by Integrated DNA Technologies, IA. For LED blots, probes were labeled with the non-radioactive DIG, using End Tailing Kit (Roche Applied Science, Indianapolis, IN). Probe sequences used against the human miRNAs are TCAACATCAGTCTGATAAGCTA (miR-21), CGCCAATATTTACGTGCTGCTA (miR-16), TCCATCATTACCCGGCAGTATTA (miR-200c) and CAGACTCCGGTGGAATGAAGGA (miR-205). Pre-hybridization and hybridization were carried out using various hybridization buffers at different temperatures (Supplementary Table S1). For radioactive blots, hybridization buffers contained 10⁶ cpm/ml of probe. For both methods, after hybridization the membranes were washed (37°C) twice using a low stringency buffer solution (2× SSC, 0.1% SDS), and a high stringency buffer solution (0.1× SSC, 0.1% SDS), for five and ten minutes, respectively. During optimization of northern blot analysis, photoemissions were detected using ChemiDoc-IT Imaging System (Figures 1, 2, Supplementary Figures S2 and S4). Since ChemiDoc-IT system is not compatible with ³²P-based methods, to enable an unbiased comparison between the two methods (Figures 3 and 4), we used phosphor image screens to detect signals for both methods. To study the specificity of LED method, we used synthesized single-stranded kshv-miR-K12-1 and its mutants (M1, M2, M3) containing a 5′ phosphate to closely mimic miRNAs. The sequences are (mutations underlined): 5′-/Phos/AUUACAGAAACUGGGUGUAAGC-3′ (kshv-miR-K12-1), 5′-/Phos/AUUACAGAAACAGGGUGUAAGC-3′ (M1), 5′-/Phos/AUUACAGAAAGAGGGUGUAAGC-3′ (M2) and 5′-/Phos/AUUACAGAACGAGGGUGUAAGC-3′ (M3). The DNA-LNA mixed sequence (LNA underlined) 5′-GCTTACACCCAGTTTCCTGTAAT-3′ was used as the probe sequence against all four KSHV miRNA sequences. For specificity analysis, each lane in the gel (15% of polyacrylamide gel) was loaded with K12-1 synthetic RNA (0.2 fmol) mixed with MCF7 total RNA (5 µg). For sensitivity analysis, we used serially diluted amounts (0–0.4 fmol) of K12-1 miRNA that was spiked into MCF7 total RNA (5 µg).
Figure 1.

Effect of various hybridization buffers on the sensitivity of LED protocol in detecting miR-21 and miR-16. Seven different hybridization buffers (A–G) based on a probe concentration of 0.2 nM were used as indicated and detailed in supplementary document (Supplementary Table S1). Varying amounts of total RNA (3, 5 and 10 µg) were used to detect mature miR-21 and miR-16 (arrowheads) for each probe concentration, and the corresponding photo-luminescence was recorded over varying lengths (1, 3 and 5 min) of time. The upper bands may correspond to the precursor and primary transcripts of the miRNAs.

Figure 2.

Evaluation of four different nylon membranes for LED protocol. Duration of photo-exposure (1, 3 and 5 min) and amount of total RNA (3 and 6 µg) are indicated. Among the tested membranes (A–D), positively charged and neutral nylon membranes purchased from Roche (A) and GE Healthcare (B), yielded the strongest signals.

Kim S.W., Li Z., Moore P.S., Monaghan A.P., Chang Y., Nichols M, & John B. (2010). A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Research, 38(7), e98.

Publication 2010

Validating Canine Osteoarthritis Assessment Tools

The study protocol was approved by the University of Liverpool Research Ethics Committee. A public awareness campaign was run targeting the hinterlands of the University of Liverpool Small Animal Teaching Hospital (SATH) in the Northwest of England, a region with a human population in the region of five million. This included press advertisements and editorials, local radio coverage, poster campaigns, and a letter-drop to previous clients of the SATH’s orthopedic service. Interested pet owners then contacted study personnel and completed a preliminary telephone screening interview. Primary care veterinarians of potential participants were then contacted in writing to request referral for inclusion in the study, in a process approved by the Professional Conduct Department of the Royal College of Veterinary Surgeons. Prospective participants then attended the SATH for a screening visit.
At the screening visit, clinical history was collected and a clinical examination was completed by a veterinarian with experience in orthopedics, and recorded in a standardized data-capture form (DCF). For this study, data from two cohorts, one cross sectional and one longitudinal, were used. The longitudinal cohort is a sub-population of the cross-sectional cohort. Inclusion criteria for the cross-sectional cohort were different than those for the longitudinal cohort. Both are summarized in table 2. Inclusion criteria for the longitudinal cohort were defined by research activity other than that currently reported.
Owners received the instructions, as published for each CMI, before being given ample time in a quiet space to complete the CMIs. For the longitudinal cohort, the same person completed the CMIs at each subsequent assessment.
Force-platform analysis was performed in a dedicated canine gait analysis laboratory. This consisted of a force-platform (Kistler, Switzerland) set in a low-level runway constructed of hard foam. The force platform and runway were covered with the same non-slip surface. Four high-speed, infra-red motion capture cameras (Proreflex, Qualisys, Sweden) were arranged in an arc around the force platform, creating a calibrated motion capture volume approximately four meters long with the force platform at the center. A digital video camera (Sony Corporation, Japan) was directed at the force platform to record each trial for validation purposes. At each session, dogs were allowed a minimum of five minutes to familiarize with the space, and several “practice” trials were performed. Reflective markers were placed bilaterally at the dorsoventral midpoint of the tenth rib of each dog to facilitate velocity measurement of each trial. For each trial, four seconds of force data, motion capture data, and digital video footage were collected simultaneously. Video footage was examined to confirm satisfactory foot placement and motion data were used to measure forward velocity and acceleration: these were both performed using proprietary software (Qualisys Track Manager, Qualisys, Sweden). Force data were analyzed using dedicated software (Bioware, Kistler, USA). Dogs were allowed to move at the gait and velocity that was most comfortable for them and which allowed for most consistent foot placement on the force platform. Once this gait and velocity were identified, it was recorded and kept constant for every trial and, for dogs in the longitudinal cohort, for all subsequent sessions.
For dogs recruited to the longitudinal study, an accelerometer-based activity monitor (AM) (Actical, Philips Respironics, The Netherlands) was attached at the ventral aspect of the collar using nylon cable ties at the end of the screening visit.
For each longitudinal-cohort participant, the study began with a fourteen-day “baseline period”. During this time, no NSAID medication was administered. Owners were provided with a supply of veterinary-licensed paracetamol/codeine tablets (Pardale V, Dechra Animal Health, UK) to use as “rescue analgesia” if they felt necessary. After this baseline period, participants attended “Visit 1″. At this visit, and all subsequent visits, CMI and force platform data were collected as described above, and activity data were downloaded from the AM. Data collected at this visit were used as the ‘off-treatment’, or baseline, data. At Visit 1, dogs were randomly allocated to receive one of two NSAIDs, both licensed in Europe for the long-term treatment of canine OA. Dogs received the allocated NSAID for the next 12 weeks, administered on-label. Data were collected after six weeks of treatment at “Visit 2″, and at the end of the treatment period at “Visit 3”.
Criterion validity was tested in two ways. Primarily, CMI scores were compared against the left-right symmetry index (SI) for the worst affected limb. Symmetry index for PVF was calculated thus: where PVF_R is the PVF for the right limb and PVF_L is the PVF for the left limb. If the index joint was an elbow, for example, then the SI for the thoracic limbs was calculated. If the index joint was a hip or stifle (knee), the SI for the pelvic limbs was calculated. Negative values (i.e. produced for right limb lameness) were made positive. Total CMI scores were compared against SI. Further to this, following factor analysis, a LOAD “lameness index” was generated and also compared against SI. Secondarily, criterion validity was tested in the longitudinal cohort by comparing change in CMI scores against change in PVF for the index limb, and against change in activity parameters from the AMs, from Visit 1 (baseline) to Visit 2 (six weeks of treatment). Activity parameters used were total weekly count (TWC), and weekly average counts for four quarters of the day: Q1 = 12 am to 6 am, Q2 = 6 am to 12 pm, Q3 = 12 pm to 6 pm, and Q4 = 6 pm to 12 am.
Construct validity was tested, primarily, by comparing LOAD, CBPI and HCPI scores against each other. Additionally, factor analysis was performed for all CMIs and reported for the first time for LOAD, and was compared against that previously reported for CBPI and HCPI. For factor analysis, data from the cross-sectional cohort was used and a Kaiser-Meyer-Olin measure of sampling adequacy >0.6 was used as an indicator for sampling adequacy. Extracted factors were assessed by Eigenvalue, scree-plot analysis and theoretical interpretability. Item loading on extracted components was based on a varimax-rotated model of the factor analysis, with a communality cut-off value of 0.4.
For all comparisons, Spearman’s rank correlation was used and significance was set at p≤0.05 (two-tailed). Internal consistency for all CMIs was tested for the cross-sectional cohort, using Cronbach’sα.
It should be noted that CBPI is reported as a three factor CMI, made up of a Pain Severity Score (CBPI PSS), Pain Interference Score (CBPI PIS), and an Overall Quality of Life Score (CBPI QOL). For all analyses except factor analysis, each CBPI factor was tested individually.

Walton M.B., Cowderoy E., Lascelles D, & Innes J.F. (2013). Evaluation of Construct and Criterion Validity for the ‘Liverpool Osteoarthritis in Dogs’ (LOAD) Clinical Metrology Instrument and Comparison to Two Other Instruments. PLoS ONE, 8(3), e58125.

Full text: Click here

Publication 2013

Accelerometer Wearable Protocol for Physical Activity Measurement

The accelerometer (GENEA, Unilever Discover, Sharnbrook Bedfordshire, UK) comprised a tri-axial STMicroelectronics accelerometer (LIS3LV02DL) with a dynamic range of ±6 g (1 g = 9.81 m·s⁻²), as described elsewhere [13] . The acceleration was sampled at 40 Hz (Sweden) and 80 Hz (UK) and data were stored in g units for offline analyses. The accelerometer (12×29×37 mm) was attached to the wrist with a nylon weave strap (both groups) and to the hip with an elastic belt (UK sample only). In order to ensure an even balance of left and right wrist positioning in the Swedish study, every second participant entering the study was asked to wear the accelerometer on the left wrist and every other to wear it on their right wrist, irrespective of hand dominancy. In the British study, both accelerometers were worn on the non-dominant body side. Participants were instructed to wear the accelerometer on the wrist continuously but to remove the hip-placed accelerometer during water-based activities and sleeping. A diary was provided to assess monitor non-wear time.

van Hees V.T., Renström F., Wright A., Gradmark A., Catt M., Chen K.Y., Löf M., Bluck L., Pomeroy J., Wareham N.J., Ekelund U., Brage S, & Franks P.W. (2011). Estimation of Daily Energy Expenditure in Pregnant and Non-Pregnant Women Using a Wrist-Worn Tri-Axial Accelerometer. PLoS ONE, 6(7), e22922.

Full text: Click here

Publication 2011

Acceleration Human Body Nylons Wrist

Phytohormone Analysis by HPLC-MS

Cytokinins (zeatin, Z, and zeatin riboside, ZR), indole-3-acetic acid (IAA), and abscisic acid (ABA) were extracted and purified according to the method of Dobrev and Kaminek (2002) (link). One gram of fresh plant material (leaf or root) was homogenized in liquid nitrogen and placed in 5 ml of cold (–20 °C) extraction mixture of methanol/water/formic acid (15/4/1 by vol., pH 2.5). After overnight extraction at –20 °C solids were separated by centrifugation (20 000 g, 15 min) and re-extracted for 30 min in an additional 5 ml of the same extraction solution. Pooled supernatants were passed through a Sep-Pak Plus †C₁₈ cartridge (SepPak Plus, Waters, USA) to remove interfering lipids and plant pigments and evaporated to dryness. The residue was dissolved in 5 ml of 1 M formic acid and loaded on an Oasis MCX mixed mode (cation-exchange and reverse phase) column (150 mg, Waters, USA) preconditioned with 5 ml of methanol followed by 5 ml of 1 M formic acid. To separate different CK forms (nucleotides, bases, ribosides, and glucosides) from IAA and ABA, the column was washed and eluted stepwise with different appropriate solutions indicated in Dobrev and Kaminek (2002) (link). ABA and IAA were analysed in the same fraction. After each solvent was passed through the columns, they were purged briefly with air. Solvents were evaporated at 40 °C under vacuum. Samples then dissolved in a water/acetonitrile/formic acid (94.9:5:0.1 by vol.) mixture for HPLC/MS analysis. Analyses were carried out on a HPLC/MS system consisting of an Agilent 1100 Series HPLC (Agilent Technologies, Santa Clara, CA, USA) equipped with a μ-well plate autosampler and a capillary pump, and connected to an Agilent Ion Trap XCT Plus mass spectrometer (Agilent Technologies, Santa Clara, CA, USA) using an electrospray (ESI) interface. Prior to injection, 100 μl of each fraction extracted from tissues or a similar volume of xylem sap were filtered through 13 mm diameter Millex filters with 0.22 μm pore size nylon membrane (Millipore, Bedford, MA, USA). 8 μl of each sample, dissolved in mobile phase A, was injected onto a Zorbax SB-C18 HPLC column (5 μm, 150×0.5 mm, Agilent Technologies, Santa Clara, CA, USA), maintained at 40 °C, and eluted at a flow rate of 10 μl min⁻¹. Mobile phase A, consisting of water/acetonitrile/formic acid (94.9:5:0.1 by vol.), and mobile phase B, consisting of water/acetonitrile/formic acid (10:89.9:0.1 by vol.), were used for the chromatographic separation. The elution programme maintained 100% A for 5 min, then a linear gradient from 0% to 6% B in 10 min, followed by another linear gradient from 6% to 100% B in 5 min, and finally 100% B maintained for another 5 min. The column was equilibrated with the starting composition of the mobile phase for 30 min before each analytical run. The UV chromatogram was recorded at 280 nm with a DAD module (Agilent Technologies, Santa Clara, CA, USA). The mass spectrometer was operated in the positive mode with a capillary spray voltage of 3500 V, and a scan speed of 22 000 m/z s⁻¹ from 50–500 m/z. The nebulizer gas (He) pressure was set to 30 psi, whereas the drying gas was set to a flow of 6.0 l min⁻¹ at a temperature of 350 °C. Mass spectra were obtained using the DataAnalysis program for LC/MSD Trap Version 3.2 (Bruker Daltonik GmbH, Germany). For quantification of Z, ZR, ABA, and IAA, calibration curves were constructed for each component analysed (0.05, 0.075, 0.1, 0.2, and 0.5 mg l⁻¹) and corrected for 0.1 mg l⁻¹ internal standards: [²H₅]trans-zeatin, [²H₅]trans-zeatin riboside, [²H₆]cis,trans-abscisic acid (Olchemin Ltd, Olomouc, Czech Republic), and [¹³C₆]indole-3-acetic acid (Cambridge Isotope Laboratories Inc., Andover, MA, USA). Recovery percentages ranged between 92% and 95%.
ACC (1-aminocyclopropane-1-carboxylic acid) was determined after conversion into ethylene by gas chromatography using an activated alumina column and a FID detector (Konik, Barcelona, Spain). ACC was extracted with 80% (v/v) ethanol and assayed by degradation with alkaline hypochlorite in the presence of 5 mM HgCl₂ (Casas et al., 1989 ). A preliminary purification step was performed by passing the extract through a Dowex 50W-X8, 50–100 mesh, H⁺-form resin and later recovered with 0.1 N NH₄OH. The conversion efficiency of ACC into ethylene was calculated separately by using a replicate sample containing 2.5 nmol of ACC as an internal standard and used for the correction of data.

Albacete A., Ghanem M.E., Martínez-Andújar C., Acosta M., Sánchez-Bravo J., Martínez V., Lutts S., Dodd I.C, & Pérez-Alfocea F. (2008). Hormonal changes in relation to biomass partitioning and shoot growth impairment in salinized tomato (Solanum lycopersicum L.) plants. Journal of Experimental Botany, 59(15), 4119-4131.

Publication 2008

1-aminocyclopropane-1-carboxylic acid Abscisic Acid acetonitrile Capillaries Centrifugation Chaperone-Mediated Autophagy Chromatography cis-acid Cold Temperature CREB3L1 protein, human Cytokinins DNA Replication Dowex Ethanol Ethylenes formic acid Gas Chromatography Glucosides High-Performance Liquid Chromatographies Hypochlorite indoleacetic acid Isotopes Lipids Mass Spectrometry Mercuric Chloride Methanol Nebulizers Nitrogen Nucleotides Nylons Oxide, Aluminum Pigmentation Plant Leaves Plant Roots Plants Pressure Radionuclide Imaging Resins, Plant Sep-Pak C18 Solvents Strains Tissue, Membrane Tissues Vacuum Xylem Zeatin zeatin riboside

Most recents protocols related to «Nylon 6»

Fabrication of Liquid Crystal Cells

Glass cells consisted of two indium-tin-oxide (ITO) coated ultraflat glass substrates assembled into a 10 µm thick sandwich cell. The ITO coated glass substrates were covered with nylon 6 polyamide, thermally conditioned, and rubbed in antiparallel configuration. Then, BP mixtures were filled into the cells by capillarity in isotropic phase. Polyamide nylon 6, as well as nylon 6–6, produced excellent monocrystalline and oriented BP crystals.

Oton E., Cigl M., Morawiak P., Mironov S., Bubnov A, & Piecek W. (2024). All-optical 3D blue phase photonic crystal switch with photosensitive dopants. Scientific Reports, 14, 9910.

Full text: Click here

Publication 2024

Comparative Analysis of Filter Media

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2024

Customized Fly Transfer Lid Design

The fly transfer lid was constructed from a sheet of 0.6 mm nylon mesh mounted between a lower array of cups (8mm diameter, 10 mm deep, 6-degree taper) and an upper array of gas exchange holes. The lower and upper layers were designed with Tinkercad (www.tinkercad.com) and stereo lithographically 3D printed with LEDO 6060 resin (www.jlcpcb.com). Studs (3 mm tall, 2.5 mm diameter) in the upper layer fit into matching holes (3 mm diameter) in the nylon sheet and lower layer, sealed together with cyanoacrylate glue. The holes in the nylon mesh were formed by melting the desired nylon hole locations with a hot soldering iron guided by a metal template.

Gomez A., Gonzalez S., Oke A., Luo J., Duong J.B., Esquerra R.M., Zimmerman T., Capponi S., Fung J.C, & Nystul T.G. (2024). A high-throughput method for quantifying Drosophila fecundity. bioRxiv.

Publication Preprint 2024

Thermal Analysis of Modified Nylon-6 Substrates

PA6 substrates were prepared as follows: in their unmodified state, as obtained from the manufacturer, or as prepared in-house; washed state, following washing in DI water prior to reactions; or their incubated state where PA6 substrates were incubated in reaction buffer under the same conditions as an enzymatic assay from 40-70 °C (Supplementary Fig. 3). Substrates were also assessed after enzyme reactions, following incubation with 1 µM NylC_K-TS at 60 °C for 10 days. Prior to analysis, other than the unmodified substrates, all samples were rinsed in DI water to remove salts and enzymes. All substrates were then dried for 4 h at 50 °C to remove residual water. The thermal stability of nylon samples was assessed by thermogravimetric analysis (TGA) using a Discovery TGA 5500 (TA Instruments). For each run, 6-10 mg of polymer sample was placed in a platinum TGA pan. Samples were heated under nitrogen from ambient temperature to 200 °C at a rate of 4 °C/min, then from 200 °C to 800 °C at a rate of 20 °C/min. TRIOS software (TA Instruments, v5.1.1.46572) was used to characterize the onset temperature of polymer degradation (T_D,50) and the weight percent of residual char at 800 °C. The mass percent loss and temperature of the derivative maximum were determined for each mass loss event.
Differential scanning calorimetry (DSC) was used to measure the thermal properties and crystallinity of unmodified and treated nylons. Samples were dried at 40 °C for 24 h in a vacuum oven to remove absorbed water immediately prior to analysis^{60 (link)}. DSC measurements were performed on a Discovery X3 Differential Scanning Calorimeter (TA Instruments) using 4-8 mg of sample in hermetically sealed aluminum pans (DSC Consumables). Each DSC run consisted of two heating and cooling cycles between 0 °C and 290 °C at a rate of 10 °C/min with 5 min isothermal holds between each heating and cooling ramp. The glass transition temperature (T_g), melting temperature (T_m), enthalpy of melting (ΔH_m), crystallization temperature (T_c), temperature of cold crystallization (T_c), and enthalpy of cold crystallization (ΔH_c) for each sample was determined when applicable with TRIOS software (Universal Analysis, v5.4.0.300). Integration bounds and baselines were determined following the procedure described by Khanna and Kuhn^{60 (link)}. The following equation was used to calculate percent crystallinity, where ΔH_m°, the reference enthalpy of melting, is 230.1 J/g for nylon-6¹¹⁴.

% Crystallinity = (\frac{△ H_{m} - △ H_{c}}{△ H_{m}^{\circ}}) 100 %

Gel permeation chromatography (GPC) with multi-angle light scattering (MALS) and differential refractive index (dRI) detectors was used to measure the weight average molar mass (M_w), number average molar mass (M_n), and molar mass dispersity (Đ) values of PA6 samples. Samples were dissolved in 1,1,1,3,3,3-hexafluoroisopropanol (HFIP) with 20 mM of sodium trifluoroacetate (NaTFAc) at a concentration of ~ 5 mg/mL, then filtered through 0.2 µm PTFE syringe filters (Agilent). GPC was conducted using a 1260 Infinity II LC system (Agilent), three PL HFIPgel 250 × 4.6 mm columns, and a matching guard column (Agilent). HFIP supplemented with 20 mM NaTFAc was used as the mobile phase at a flow rate of 0.35 mL/min. Due to HFIP’s viscosity, the HPLC column oven was heated to 40 °C to decrease column backpressure. An Optilab T-Rex refractive index detector (Wyatt Technology) and miniDawn TREOS MALS detector (Wyatt Technology) were attached in line. M_n, M_w, and Đ were calculated with ASTRA (Wyatt Technologies, version 8.2.0), using 0.2375 as the dn/dc of PA6 in HFIP (Wyatt Technologies Database of dn/dc values).

Bell E.L., Rosetto G., Ingraham M.A., Ramirez K.J., Lincoln C., Clarke R.W., Gado J.E., Lilly J.L., Kucharzyk K.H., Erickson E, & Beckham G.T. (2024). Natural diversity screening, assay development, and characterization of nylon-6 enzymatic depolymerization. Nature Communications, 15, 1217.

Full text: Click here

Publication 2024

Endoscopic Double-Nylon Purse-String Suture

Within this study, the selection of employing double-nylon to strengthen the purse suture was determined by the wound condition after the single-nylon purse-string suture. Factors taken into consideration encompassed intraoperative sutures, creases, tension, and other pertinent variables.
The whole endoscopic procedure consisted of six main steps: (1) The location of the tumor was confirmed under endoscopic guidance, and the mucosa was incised to reveal the lesion; (2) Complete resection of the tumor through EFTR; (3) Wound treatment, observation, and evaluation of the gastric wall defect; (4) The gastric wall defect was closed with a single-nylon rope “purse-string suture;” (5) A second nylon rope was inserted to reinforce and close the treated wound again; and (6) The endoscope was removed after confirming satisfactory closure, and the surgery was completed.
The process of executing double-nylon purse-string sutures was as follows (Figures 1 and 2): (1) The nylon rope was clamped using foreign body forceps inserted in the stomach cavity along with the endoscope and placed at the wound. The foreign body clamp was removed, and the titanium clamp was pushed through the biopsy channel. A titanium clip was used to clamp the distal end of the nylon rope on the normal mucosal tissue around the wound. The titanium clips were continued to be fixed around the wound in an annular shape at equal distances. The nylon-string outer casing was pushed forward, keeping the titanium clips vertical. The nylon rope was tightened to close the wound’s distal and proximal gastric wall. The procedure of single-nylon purse-string sutures can be seen in our previous study[10 (link)]; (2) The second nylon rope was advanced through the biopsy channel into the stomach cavity. Care was taken that the second nylon rope could wrap around the wound closure and all titanium clips; (3) The nylon loop was pushed down to tighten the nylon rope. Whenever it was found that the nylon rope might slip from the holding place of the titanium clip, the position of the titanium clip was adjusted using the foreign body forceps to help the nylon rope reach the base of the wound; and (4) When the position of the second nylon rope was correct and not easy to move, the nylon rope was tightened to complete the secondary closure of the wound. Finally, the stomach was injected with CO₂ to observe whether the stomach cavity was inflated and filled to evaluate the success of the perforation closure. This closure process can be summarized as two main steps: (1) The initial closure of the wound surface using the single-nylon rope and the titanium clip; and (2) the reinforcement and closure of the second nylon rope.

Wang S.S., Ji M.Y., Huang X., Li Y.X., Yu S.J., Zhao Y, & Shen L. (2024). Double-nylon purse-string suture in closing postoperative wounds following endoscopic resection of large (≥ 3 cm) gastric submucosal tumors. World Journal of Gastroenterology, 30(9), 1143-1153.

Publication 2024

Top products related to «Nylon 6»

Lightshift chemiluminescent emsa kit by Thermo Fisher Scientific

Sourced in United States, China, Germany

The LightShift Chemiluminescent EMSA Kit is a laboratory tool designed to detect and analyze protein-DNA interactions. It uses chemiluminescent detection to visualize and quantify the binding of proteins to specific DNA sequences.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Penicillin streptomycin by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia

Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.

Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica

DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

Nylon cell strainer by BD

Sourced in United States, Germany, United Kingdom, Canada

The Nylon cell strainer is a laboratory equipment designed to separate cells or other particles from a liquid suspension. It features a nylon mesh screen that filters the liquid, trapping the desired cells or particles while allowing the rest of the liquid to pass through. The strainer's core function is to facilitate the isolation and purification of specific cell types or other biological components from complex mixtures.

Hybond n nylon membrane by GE Healthcare

Sourced in United States, United Kingdom, Germany, France, Japan, Sweden

Hybond-N+ is a nylon membrane used in molecular biology for the transfer and immobilization of nucleic acids, such as DNA and RNA, during techniques like Northern and Southern blotting. It provides a stable support for the capture and detection of target sequences.

Chemiluminescent nucleic acid detection module by Thermo Fisher Scientific

Sourced in United States, China

The Chemiluminescent Nucleic Acid Detection Module is a laboratory equipment designed to detect and quantify nucleic acids, such as DNA and RNA, based on chemiluminescent signals. The module provides a sensitive and reliable method for analyzing the presence and abundance of specific nucleic acid sequences in various samples.

Ethilon by Johnson & Johnson

Sourced in United States, Germany, United Kingdom

Ethilon is a monofilament suture material manufactured by Johnson & Johnson. It is made from nylon and is designed for use in general soft tissue approximation and/or ligation.

Dnase 1 by Roche

Sourced in United States, Switzerland, Germany, Japan, United Kingdom, France, Canada, Italy, Macao, China, Australia, Belgium, Israel, Sweden, Spain, Austria

DNase I is a lab equipment product that serves as an enzyme used for cleaving DNA molecules. It functions by catalyzing the hydrolytic cleavage of phosphodiester bonds in the DNA backbone, effectively breaking down DNA strands.

Nylon membrane by Merck Group

Sourced in United States, Germany, Italy

Nylon membrane is a type of lab equipment used for filtration and separation processes. It is a thin, porous material made from nylon that is designed to allow the passage of certain molecules or particles while retaining others, depending on their size and other physical characteristics. The core function of the nylon membrane is to facilitate the separation and purification of various substances in a laboratory setting.

What is Nylon 6 and how is it used?

What are the different types or variations of Nylon 6?

Nylon 6 is available in different forms and grades, each optimized for specific applications. These include: - Nylon 6 fibers: Used in textiles and apparel for their strength, flexibility, and resistance to wear and tear. - Nylon 6 resins: Utilized in the production of injection-molded plastic parts, such as automotive components and electrical/electronic enclosures. - Nylon 6 engineering plastics: Engineered for high-performance applications requiring exceptional mechanical properties, chemical resistance, and thermal stability.

What are some common challenges in using Nylon 6?

While Nylon 6 is a versatile and durable material, there are some challenges that researchers and users may encounter: - Moisture absorption: Nylon 6 can absorb moisture, which can affect its mechanical properties and dimensional stability. Proper drying and storage techniques are important. - Thermal sensitivity: Nylon 6 can be sensitive to high temperatures, which can lead to degradation or discoloration. Careful processing and temperature control are necessary. - Compatibility with other materials: Nylon 6 may not be compatible with certain chemicals or coatings, so it's important to consider its chemical resistance and adhesion properties when used in combination with other materials.

How can PubCompare.ai help with Nylon 6 research and optimization?

PubCompare.ai is an AI-driven platform that can assist researchers in optimizing their Nylon 6 studies and protocols. By leveraging advanced AI technology, PubCompare.ai helps researchers in the following ways: 1. Screen protocol literature more efficiently: The platform can quickly and thoroughly search through scientific literature, preprints, and patents to identify the most relevant Nylon 6 protocols and methods. 2. Leverage AI to pinpoint Critical Insights: PubCompare.ai's AI-driven analysis can highlight key differences in protocol effectiveness, enabling researchers to choose the best option for reproducibility and accuracy in their Nylon 6 research. 3. Identify the most effective protocols: The platform's comparative analysis helps researchers locate the most effective Nylon 6 protocols from the available information, improving the quality and efficacy of their research.

What are the benefits of using PubCompare.ai for Nylon 6 research?

By using PubCompare.ai, researchers can enjoy several benefits in their Nylon 6 studies: - Improved reproducibility: PubCompare.ai's AI-driven comparisons help identify the most effective and reliable Nylon 6 protocols, enhancing the reproducibility of research findings. - Increased accuracy: The platform's ability to pinpoint critical insights and differences in protocol effectiveness allows researchers to select the most accurate and optimized methods for their Nylon 6 experiments. - Streamlined workflow: PubCompare.ai streamlines the research process by automating the literature search and protocol comparison, saving time and effort for researchers. - Enhanced productivity: With PubCompare.ai's assistance, researchers can focus on the core aspects of their Nylon 6 research, rather than spending time on manual protocol screening and comparison.

More about "Nylon 6"

Nylon 6, also known as polyamide 6 or polycaprolactam, is a versatile synthetic polymer that belongs to the polyamide family.
This durable material is widely used in a variety of applications, including textiles, plastics, and engineering components, thanks to its strong mechanical properties, chemical resistance, and thermal stability.
Researchers are actively exploring ways to optimize the production and performance of Nylon 6, with a wealth of protocols and methods published in scientific literature, preprints, and patents.
PubCompare.ai, an AI-driven platform, helps streamline this research process by comparing and analyzing the available information, enhancing reproducibility and accuracy in Nylon 6 studies.
The platform leverages advanced AI technology to identify the most effective Nylon 6 protocols, enabling researchers to optimize their studies and workflows.
This can be particularly useful when working with related products and materials, such as the LightShift Chemiluminescent EMSA Kit, FBS, Penicillin/streptomycin, DMEM, Nylon cell strainers, Hybond-N+ nylon membranes, Chemiluminescent Nucleic Acid Detection Modules, Ethilon, and DNase I.
By using PubCompare.ai, researchers can quickly and easily find the best protocols and methods for their Nylon 6 research, ultimately improving the quality and efficiency of their work.
Experience the power of this cutting-edge platform and take your Nylon 6 studies to the next level.