Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Biomedical or Dental Material > Polyacrylamide

Polyacrylamide

Polyacrylamide is a synthetic polymer composed of repeating acrylamide units.
It has a wide range of applications in various fields, including biomedical research, water treatment, and electrophoresis.
Polyacrylamide exhibits properties such as water solubility, biocompatibility, and ease of chemical modification, making it a versatile material for numerous applications.
Researchers can optimize their polyacrylamide studies by utilizing PubCompare.ai, an AI-driven platform that helps locate the best protocols from literature, preprints, and patents, enhanceing reproducibility and accuracy in their polyacrylamide research.

Most cited protocols related to «Polyacrylamide»

1
Cellular Fractionation and Immunoblotting
All cells used in this study were obtained from the American Type Culture Collection (ATCC). HeLa (human cervical cancer, ATCC# CCL-13), HCT116 (human colorectal cancer, ATCC# CCL-247), HEK293 (adenovirus infected human embryonic kidney, ATCC# CRL-1573) and HS68 (normal HDF, ATCC# CRL-1635) cells grown as monolayers in 10 cm diameter dishes were washed in ice-cold phosphate buffer saline (PBS) pH 7.4, scraped from culture dishes on ice using a plastic cell scraper and collected in 1.5 ml micro-centrifuge tubes in 1 mL of ice-cold PBS. After centrifugation (a "pop-spin" for 10 sec in an Eppendorf table top microfuge), supernatants were removed from each sample and cell pellets were resuspended in 900 μL of ice-cold 0.1% NP40 (Calbiochem, CA, USA) in PBS and triturated 5 times using a p1000 micropipette (Gilson, WI, USA). 300 μL of the lysate was removed as "whole cell lysate" and 100 μL of 4 × Laemmli sample buffer was added to it, then kept on ice until the sonication step. The remaining (600 μL) material was centrifuged for 10 sec in 1.5 ml micro-centrifuge tubes and 300 μl of the supernatant was removed as the "cytosolic fraction". 100 μL of 4 × Laemmli sample buffer was added to this fraction and boiled for 1 min. After the remaining supernatant was removed, the pellet was resuspended in 1 ml of ice-cold 0.1% NP40 in PBS and centrifuged as above for 10 sec and the supernatant was discarded. The pellet (~20 μL) was resuspended with 180 μL of 1 × Laemmli sample buffer and designated as "nuclear fraction". Nuclear fractions and whole cell lysates that contained DNA were sonicated using microprobes (Misonix, NY, USA) at level 2, twice for 5 sec each, followed by boiling for 1 min. 10 μL, 10 μL and 5 μL of whole cell lysate, cytoplasmic and nuclear fractions, respectively, were loaded and electrophoresed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) [12 (link)] and transferred to nitrocellulose membranes (Pall Life Sciences, FL, USA). Membranes were incubated with anti-pyruvate kinase (Santa Cruz, CA, USA) or anti-α-tubulin (Calbiochem, CA, USA) antibodies as cytoplasmic markers or anti-lamin A (Santa Cruz, CA, USA) or anti-nucleoporin (Santa Cruz, CA, USA) as nuclear markers after blocking with 3% bovine serum albumin in 0.1% tween 20-PBS (t-PBS). Membranes were washed with t-PBS followed by incubation with HRP-conjugated anti-rabbit or anti-mouse secondary antibody. After washing with t-PBS, target protein signals were detected by ECL (GE Healthcare, Buckinghamshire, UK) on Kodak X-ray film.
Suzuki K., Bose P., Leong-Quong R.Y., Fujita D.J, & Riabowol K. (2010). REAP: A two minute cell fractionation method. BMC Research Notes, 3, 294.
Full text: Click here
Publication 2010
2
CRISPR Efficiency Measurement by SURVEYOR Assay
293FT and HUES9 cells were transfected with DNA as described above. Cells were incubated at 37 °C for 72 h post-transfection before genomic DNA extraction. Genomic DNA was extracted using the QuickExtract DNA Extraction Solution (Epicentre) following the manufacturer's protocol. Briefly, pelleted cells were resuspended in QuickExtract solution and incubated at 65 °C for 15 min, 68 °C for 15 min, and 98 °C for 10 min.
The genomic region flanking the CRISPR target site for each gene was PCR amplified (target sites and primers listed in Supplementary Tables 1 and 2), and products were purified using QiaQuick Spin Column (Qiagen) following the manufacturer's protocol. 400 ng total of the purified PCR products were mixed with 2 μl 10× Taq DNA Polymerase PCR buffer (Enzymatics) and ultrapure water to a final volume of 20 μl, and subjected to a re-annealing process to enable heteroduplex formation: 95 °C for 10 min, 95 °C to 85 °C ramping at −2 °C/s, 85 °C to 25 °C at −0.25 °C/s, and 25 °C hold for 1 min. After re-annealing, products were treated with SURVEYOR nuclease and SURVEYOR enhancer S (Transgenomics) following the manufacturer's recommended protocol, and analyzed on 4–20% Novex TBE polyacrylamide gels (Life Technologies). Gels were stained with SYBR Gold DNA stain (Life Technologies) for 30 min and imaged with a Gel Doc gel imaging system (Bio-rad). Quantification was based on relative band intensities. Indel percentage was determined by the formula, 100 × (1 − (1 − (b + c)/(a + b + c))1/2), where a is the integrated intensity of the undigested PCR product, and b and c are the integrated intensities of each cleavage product.
Hsu P.D., Scott D.A., Weinstein J.A., Ran F.A., Konermann S., Agarwala V., Li Y., Fine E.J., Wu X., Shalem O., Cradick T.J., Marraffini L.A., Bao G, & Zhang F. (2013). DNA targeting specificity of RNA-guided Cas9 nucleases. Nature biotechnology, 31(9), 827-832.
Publication 2013
Buffers Cells Clustered Regularly Interspaced Short Palindromic Repeats Cytokinesis Genes Genome Gold H-DNA INDEL Mutation Oligonucleotide Primers polyacrylamide gels Stains Taq Polymerase Transfection
3
Optimizing Northern Blot Analysis for miRNA Detection
Total RNA from MCF-7 cells was loaded onto 15% SequaGel (National Diagnostics), electrophoresed and transferred to nylon membranes at 10–15 V (90 min) using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad). Membranes were cross-linked to the RNA (60°C for 1–2 h) using freshly prepared cross-linking reagent (Doc-S). For 32P-based blots, LNA–DNA mixed oligonucleotide probes were end-labeled with [γ-32P] ATP by T4 polynucleotide kinase using KinaseMaxTM Kit (Ambion). For human miRNAs, pre-synthesized LNA-modified oligonucleotides were purchased from Exiqon (http://www.exiqon.com). For the KSHV miRNA, the probes were synthesized by Integrated DNA Technologies, IA. For LED blots, probes were labeled with the non-radioactive DIG, using End Tailing Kit (Roche Applied Science, Indianapolis, IN). Probe sequences used against the human miRNAs are TCAACATCAGTCTGATAAGCTA (miR-21), CGCCAATATTTACGTGCTGCTA (miR-16), TCCATCATTACCCGGCAGTATTA (miR-200c) and CAGACTCCGGTGGAATGAAGGA (miR-205). Pre-hybridization and hybridization were carried out using various hybridization buffers at different temperatures (Supplementary Table S1). For radioactive blots, hybridization buffers contained 106 cpm/ml of probe. For both methods, after hybridization the membranes were washed (37°C) twice using a low stringency buffer solution (2× SSC, 0.1% SDS), and a high stringency buffer solution (0.1× SSC, 0.1% SDS), for five and ten minutes, respectively. During optimization of northern blot analysis, photoemissions were detected using ChemiDoc-IT Imaging System (Figures 1, 2, Supplementary Figures S2 and S4). Since ChemiDoc-IT system is not compatible with 32P-based methods, to enable an unbiased comparison between the two methods (Figures 3 and 4), we used phosphor image screens to detect signals for both methods. To study the specificity of LED method, we used synthesized single-stranded kshv-miR-K12-1 and its mutants (M1, M2, M3) containing a 5′ phosphate to closely mimic miRNAs. The sequences are (mutations underlined): 5′-/Phos/AUUACAGAAACUGGGUGUAAGC-3′ (kshv-miR-K12-1), 5′-/Phos/AUUACAGAAACAGGGUGUAAGC-3′ (M1), 5′-/Phos/AUUACAGAAAGAGGGUGUAAGC-3′ (M2) and 5′-/Phos/AUUACAGAACGAGGGUGUAAGC-3′ (M3). The DNA-LNA mixed sequence (LNA underlined) 5′-GCTTACACCCAGTTTCCTGTAAT-3′ was used as the probe sequence against all four KSHV miRNA sequences. For specificity analysis, each lane in the gel (15% of polyacrylamide gel) was loaded with K12-1 synthetic RNA (0.2 fmol) mixed with MCF7 total RNA (5 µg). For sensitivity analysis, we used serially diluted amounts (0–0.4 fmol) of K12-1 miRNA that was spiked into MCF7 total RNA (5 µg).

Effect of various hybridization buffers on the sensitivity of LED protocol in detecting miR-21 and miR-16. Seven different hybridization buffers (A–G) based on a probe concentration of 0.2 nM were used as indicated and detailed in supplementary document (Supplementary Table S1). Varying amounts of total RNA (3, 5 and 10 µg) were used to detect mature miR-21 and miR-16 (arrowheads) for each probe concentration, and the corresponding photo-luminescence was recorded over varying lengths (1, 3 and 5 min) of time. The upper bands may correspond to the precursor and primary transcripts of the miRNAs.

Evaluation of four different nylon membranes for LED protocol. Duration of photo-exposure (1, 3 and 5 min) and amount of total RNA (3 and 6 µg) are indicated. Among the tested membranes (A–D), positively charged and neutral nylon membranes purchased from Roche (A) and GE Healthcare (B), yielded the strongest signals.

Kim S.W., Li Z., Moore P.S., Monaghan A.P., Chang Y., Nichols M, & John B. (2010). A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Research, 38(7), e98.
Publication 2010
4
Electrophoretic Separation and Blotting of RNA
All RNA samples were separated by electrophoresis using either 10 or 15% polyacrylamide (19:1) gels cast in 7 M urea and buffered with 20 mM MOPS/NaOH (pH 7) using a Protean II rig (Bio-Rad). Tris-based buffers were avoided as it was anticipated that these might interfere with the EDC-mediated cross-linking step. The electrophoresis buffer was 20 mM MOPS/NaOH (pH 7). RNA markers were 32γP-end-labelled Decade® RNA markers (Ambion) prepared according to the manufacturer's instructions. After gel electrophoresis, gels were stained with ethidium bromide (EtBr) or SybrGold® (Molecular Probes) and imaged on a FLA-5000 system (Fuji) with Aida Image Analyser software to visualize and record the amount and distribution of the RNA.
For blotting, gels were placed over a sheet of nylon hybridization membrane (Hybond-NX®, Amersham/Pharmacia) that had been pre-wetted in distilled water. This was then sandwiched between pieces of 3MM® Whatman filter paper (three layers on each side), also pre-wetted in distilled water and placed in a ‘semidry’ electroblotter (SciPlas). Excess liquid and air bubbles were squeezed from the sandwich by rolling the surface with a clean pipette. Electrophoretic transfer of RNA from the gel to the membrane was carried out at 20 V at 4°C for 30–60 min.
Pall G.S., Codony-Servat C., Byrne J., Ritchie L, & Hamilton A. (2007). Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Research, 35(8), e60.
Publication 2007
Buffers CD3EAP protein, human Crossbreeding Edema Electrophoresis Ethidium Bromide Molecular Probes morpholinopropane sulfonic acid Nylons polyacrylamide Tissue, Membrane Transfer RNA Urea
5
Labeling and Purification of Oligonucleotide Substrates
Oligonucleotides C80, G80, and G95 were purchased from Integrated DNA Technologies (Coralville, IA) and their sequences, in 5' to 3' orientation, are as follows: C80 = GCTGATCAACCCTACATGTGTAGGTAACCCTAACCCTAACCCTAAGGACAACCCTAGTGAAGCTTGTAACCCTAGGAGCT, G80 = AGCTCCTAGGGTTACAAGCTTCACTAGGGTTGTCCTTAGGGTTAGGGTTAGGGTTACCTACACATGTAGGGTTGATCAGC, G95 = AGCTCCTAGGGTTACAAGCTTCACTAGGGTTGTCCTTAGGGTTAGGGTTAGGGTTACCTACACATGTAGGGTTGATCAGCTACGTCATGCTCAGA, and NC77 = AGCTGAGCATGTCCAGACATGTCCGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTGAGTGTGAG. The C80 oligomer was radiolabeled at its 5' end with 32P-γ-ATP (3000 Ci/mmol) and polynucleotide kinase, 3' phosphatase-free (Roche Biochemicals) and unincorporated nucleotides were removed using standard procedures. For construction of the blunt-ended or 15 nt 3' tail 80 bp substrates, labeled C80 was annealed to a twofold excess of unlabeled G80 or G95, respectively. After separation by non-denaturing polyacrylamide (12%) gel electrophoresis (PAGE), labeled oligomers and annealed duplex substrates were then purified using a gel extraction kit (Qiagen). The concentration of labeled, purified C80 was determined from the amount of unlabeled complementary G80 required to completely convert this oligomer to duplex over a 24 h period; concentrations of duplex substrates were then calculated using the specific activity of the isotope.
Machwe A., Lozada E.M., Xiao L, & Orren D.K. (2006). Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins. BMC Molecular Biology, 7, 1.
Full text: Click here
Publication 2006
Electrophoresis Isotopes Nucleotides Oligonucleotides Phosphoric Monoester Hydrolases polyacrylamide Polynucleotide 5'-Hydroxyl-Kinase Tail

Most recents protocols related to «Polyacrylamide»

1
SDS-PAGE and Casein Zymography Protocol

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2024
2
Polyacrylamide Gel Functionalization for Cell Adhesion
Not available on PMC !
We prepared polyacrylamide gels with a stiffness of 18kPa according to a previously established protocol and functionalized them with Sulpho-SANPAH (Thermo Fisher Scientific) 72 . For the gels we prepared a solution of 0.16% bis-acrylamide and 7.5% acrylamide, 0.01% v/v 200-nm-diameter dark-red fluorescence carboxylate-modified beads (Fluospheres, Thermo Fisher Scientific), 0.5% v/v ammonium persulfate (Sigma Aldrich) and 0.05% tetramethylethylenediamine (Sigma Aldrich), in PBS. We placed a 22ul drop of unpolymerized gel on a glass-bottom MatTek 35 mm dish and immediately covered it with an 18mm circular coverslip. The gels were then allowed to polymerize at room temperature for 1 hour and then covered with PBS before removing the circular coverslip. Functionalization of the gel surface was achieved by incubation with a solution of 2 mg/ml Sulpho-SANPAH under ultraviolet light for 7 minutes (wavelength of 365 nm at a distance of 5 cm). Then, two washes of PBS were performed for 2.5 minutes under mild agitation to remove excess Sulpho-SANPAH. The gels were then immediately used for microcontact printing of fibronectin lines.
Rossetti L., Grosser S., Abenza J.F., Valon L., Roca‐Cusachs P., Alert R., & Trepat X. (2024). Optogenetic generation of leader cells reveals a force-velocity relation for collective cell migration.
Publication 2024
3
SDS-PAGE Gel Electrophoresis Protocol
Not available on PMC !
Sodium dodecyl sulfate polyacrylamide gel electrophoresis was performed in a 12% (w/v) (pH 8.8) separating gel and 5% (w/v) (pH 6.8) stacking gel as described previously. 36
AL-Jaddawi A.A., Alkenani N.A., Alghamdi K.M., & Elbeshehy E.K.F. (2024). Effect of New Bio-component of Cytoplasmic Polyhedrosis Virus (Cypovirus1) with Silver Nanoparticles against Four Pests in Stored Food Products. Journal of Pure and Applied Microbiology, 18(1), 626-637.
Publication 2024
4
Polyacrylamide Gel Substrates for Cell Mechanics
Polyacrylamide gels (PAA) were used to form substrates with different Young’s modulus ranging from 0.5 to 30 kPa. Glass-bottom 35 mm dishes or 6-well glass-bottom plates (Mattek) were incubated with a solution of Bind-silane (Sigma-Aldrich), acetic acid (Sigma-Aldrich) and absolute ethanol (PanReac) at volume proportions of 1:1:12 for 10 min at RT. After 2 washes with absolute ethanol, 20 μl of polyacrylamide solution (Supplementary Table 3) were placed on the dish glass bottom and covered with 18 mm glass coverslip. For TFM, the gel substrates contained 0.2 μm green, fluorescent carboxylate-modified beads (FluoSpheres, Thermofisher). After 1 h polymerization at RT, the gels were covered with PBS and the coverslips removed. The gel surface was activated with Sulfo-SANPAH and coated with 150 μg.ml−1 of Collagen I overnight.
Conti S., Venturini V., Cañellas-Socias A., Cortina C., Abenza J.F., Stephan-Otto Attolini C., Middendorp Guerra E., Xu C.K., Li J.H., Rossetti L., Stassi G., Roca-Cusachs P., Diz-Muñoz A., Ruprecht V., Guck J., Batlle E., Labernadie A, & Trepat X. (2024). Membrane to cortex attachment determines different mechanical phenotypes in LGR5+ and LGR5- colorectal cancer cells. Nature Communications, 15, 3363.
Full text: Click here
Publication 2024
5
Polyacrylamide Hydrogel Fabrication and Functionalization
First, 13 mm glass coverslips were activated by immersion in 0.1 M NaOH and allowed to dry. The coverslips were coated with an amine-reactive film using (3-aminopropyl) triethoxysilane 4.0% (Sigma-Aldrich, St. Louis, MO, USA) and then washed with distilled water for 10 min. After drying, the coverslips were coated with 2.5% glutaraldehyde (Sigma-Aldrich) for 30 min. They were then washed twice in distilled water for 10 min to produce a coating of aldehyde functional groups. Prepolymerization solutions containing varying ratios of acrylamide to bisacrylamide (Bio-Rad, Hercules, CA, USA) were utilized. The ratios used were 7.5:0.05 (1.6 kPa) and 12:0.24 (25.6 kPa) for %acrylamide–%bisacrylamide, respectively. The hydrogels were incubated in a sterile solution of dopamine hydrochloride at a concentration of 1 mg/mL in 50 mM HEPES buffer (pH 8.5) for 15 min to coat the gel surface with polymerized dopamine. The gels were washed three times with 50 mM HEPES (pH 8.5) to eliminate any remaining dopamine and then functionalized by incubating them for 30 min with 0.05 mg/mL sterile collagen I (PureCol, Advanced BioMatrix, Carlsbad, CA, USA) in Dulbecco’s phosphate-buffered saline (PBS).
For these experiments, commercially available polyacrylamide hydrogels of varying stiffness (0.5–32 kPa; Cytosoft 6-well plate, Advanced Biomatrix) were used. The hydrogels were bound to 6-well polystyrene plates or polystyrene dishes coated with type I collagen (C3867, Sigma-Aldrich).
Park Y., Lee D., Lee J.E., Park H.S., Jung S.S., Park D., Kang D.H., Lee S.I., Woo S.D, & Chung C. (2024). The Matrix Stiffness Coordinates the Cell Proliferation and PD-L1 Expression via YAP in Lung Adenocarcinoma. Cancers, 16(3), 598.
Full text: Click here
Publication 2024

Top products related to «Polyacrylamide»

1
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
2
Polyvinylidene difluoride membrane by Merck Group
Sourced in United States, Germany, United Kingdom, China, Morocco, Japan, Ireland, Canada, France, Spain, Australia, Switzerland, Israel
Polyvinylidene difluoride (PVDF) membranes are a type of lab equipment used for various applications. PVDF membranes are known for their chemical resistance, thermal stability, and mechanical strength. They are commonly used in filtration, separation, and transfer processes in laboratory settings.
3
Polyvinylidene fluoride membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, Japan, Canada
Polyvinylidene fluoride (PVDF) membranes are a type of lab equipment used for a variety of filtration and separation applications. They are made from a thermoplastic fluoropolymer material and offer high chemical and thermal resistance. PVDF membranes are commonly used in processes such as microfiltration, ultrafiltration, and sample preparation.
4
Ripa lysis buffer by Beyotime
Sourced in China, United States, Switzerland, Germany, Japan, United Kingdom
RIPA lysis buffer is a detergent-based buffer solution designed for the extraction and solubilization of proteins from cells and tissues. It contains a mixture of ionic and non-ionic detergents that disrupt cell membranes and solubilize cellular proteins. The buffer also includes additional components that help to maintain the stability and activity of the extracted proteins.
5
Bca protein assay kit by Beyotime
Sourced in China, United States, Germany, Puerto Rico, United Kingdom, Switzerland, Japan, Sweden
The BCA protein assay kit is a colorimetric-based method for the quantitative determination of total protein concentration in a sample. It uses bicinchoninic acid (BCA) to detect and quantify the presence of protein.
6
Bca protein assay kit by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Japan, Belgium, France, Switzerland, Italy, Canada, Australia, Sweden, Spain, Israel, Lithuania, Netherlands, Denmark, Finland, India, Singapore
The BCA Protein Assay Kit is a colorimetric detection and quantification method for total protein concentration. It utilizes bicinchoninic acid (BCA) for the colorimetric detection and quantification of total protein. The assay is based on the reduction of Cu2+ to Cu1+ by protein in an alkaline medium, with the chelation of BCA with the Cu1+ ion resulting in a purple-colored reaction product that exhibits a strong absorbance at 562 nm, which is proportional to the amount of protein present in the sample.
7
Protease inhibitor cocktail by Roche
Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel
Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.
8
Nitrocellulose membrane by Bio-Rad
Sourced in United States, Germany, Italy, United Kingdom, Canada, France, China, Switzerland, Japan, Spain, Australia, Sweden, Portugal, Israel, Netherlands, Belgium
Nitrocellulose membranes are a type of laboratory equipment designed for use in protein detection and analysis techniques. These membranes serve as a support matrix for the immobilization of proteins, enabling various downstream applications such as Western blotting, dot blotting, and immunodetection.
9
Protease inhibitor cocktail by Merck Group
Sourced in United States, Germany, China, United Kingdom, Italy, Japan, Sao Tome and Principe, France, Canada, Macao, Switzerland, Spain, Australia, Israel, Hungary, Ireland, Denmark, Brazil, Poland, India, Mexico, Senegal, Netherlands, Singapore
The Protease Inhibitor Cocktail is a laboratory product designed to inhibit the activity of proteases, which are enzymes that can degrade proteins. It is a combination of various chemical compounds that work to prevent the breakdown of proteins in biological samples, allowing for more accurate analysis and preservation of protein integrity.
10
Pvdf membrane by Bio-Rad
Sourced in United States, Germany, China, United Kingdom, Japan, France, Canada, Spain, Italy, Australia, Switzerland, Austria, Belgium
PVDF membranes are a type of laboratory equipment used for protein transfer and detection in Western blot analysis. They provide a stable and durable surface for the immobilization of proteins, enabling effective identification and quantification of target proteins in complex biological samples.

More about "Polyacrylamide"

Polyacrylamide is a synthetic polymer composed of repeating acrylamide units.
It is a versatile material with a wide range of applications in various fields, including biomedical research, water treatment, and electrophoresis.
Polyacrylamide (PAA) exhibits properties such as water solubility, biocompatibility, and ease of chemical modification, making it a popular choice for numerous applications.
In addition to polyacrylamide, other related materials that are commonly used in research and industrial applications include PVDF (Polyvinylidene difluoride) membranes, RIPA lysis buffer, BCA protein assay kits, and nitrocellulose membranes.
PVDF membranes are often used for protein transfer and Western blotting, while RIPA lysis buffer is a detergent-based buffer used for extracting proteins from cells.
The BCA protein assay kit is a colorimetric method for determining the total protein concentration in a sample, and nitrocellulose membranes are widely used for protein immobilization and detection.
To optimize your polyacrylamide research, you can utilize PubCompare.ai, an AI-driven platform that helps researchers locate the best protocols from literature, preprints, and patents.
This tool can enhance the reproducibility and accuracy of your polyacrylamide studies by providing access to a vast database of protocols and experimental procedures.
By leveraging the power of artificial intelligence, PubCompare.ai can assist you in finding the most suitable and reliable protocols for your polyacrylamide-related experiments, ultimately improving the quality and efficiency of your research.