> Chemicals & Drugs > Biomedical or Dental Material > Sepharose 4B

Sepharose 4B

Sepharose 4B is a cross-linked agarose resin commonly used in chromatography and affinity purification applications.
This versatile matrix offers excellent chemical and physical stability, making it well-suited for a variety of biomolecule separations.
Researchers can leverage the power of PubCompare.ai, an AI-driven platform, to optimize their Sepharose 4B protocols and locate the best procedures from literature, preprints, and patents.
This tool enables accurate comparisons to enhance reproducibility in life science research, helping scieintists streamline their Sepharose 4B experimentation and achieve reliable results.

Most cited protocols related to «Sepharose 4B»

Rac Activity Assay using GST-PAK-CD

Cited 21 times

The Rac activity assay is based on the Rap1 activity assay described by Franke et al. (1997) (link). We used a glutathione-S-transferase (GST)–PAK-CD (PAK-CRIB domain) fusion protein, containing the Rac- and Cdc42-binding region from human PAK1B (GenBank/EMBL/DDBJ accession number AF071884). A fragment encoding amino acids 56–272 of PAK1B was generated by standard PCR using the oligos AGCTGGATCCATTTTACCTGGAGAT and AGCTGAATTCATTTCTGGCTGTTGGATGTC, and then digested with BamHI/EcoRI and inserted between the BamH1 and EcoRI sites of pGEX2TK (Pharmacia Biotech, Piscataway, NJ) to yield GST–PAK-CD.
Escherichia coli BL21 cells transformed with the GST–PAK-CD construct were grown at 37°C to an absorbance of 0.3. Expression of recombinant protein was induced by addition of 0.1 mM isopropylthiogalactoside for 2 h. Cells were harvested, resuspended in lysis buffer (50 mM Tris-HCl, pH 8, 2 mM MgCl₂, 0.2 mM Na₂S₂O, 10% glycerol, 20% sucrose, 2 mM dithiothreitol, 1 μg/ml leupeptin, 1 μg/ml pepstatin, and 1 μg/ml aprotinin), and then sonicated. Cell lysates were centrifuged at 4°C for 20 min at 45,000 g and the supernatant was incubated with glutathione-coupled Sepharose 4B beads (Pharmacia Biotech) for 30 min at 4°C. Protein bound to the beads was washed three times in lysis buffer and the amount of bound fusion protein was estimated using Coomassie-stained SDS gels.

Sander E.E., van Delft S., ten Klooster J.P., Reid T., van der Kammen R.A., Michiels F, & Collard J.G. (1998). Matrix-dependent Tiam1/Rac Signaling in Epithelial Cells Promotes Either Cell–Cell Adhesion or Cell Migration and Is Regulated by Phosphatidylinositol 3-Kinase. The Journal of Cell Biology, 143(5), 1385-1398.

Publication 1998

2',5'-oligoadenylate Amino Acids Aprotinin Biological Assay Buffers CDC42 protein, human Cells Cribs Deoxyribonuclease EcoRI Dithiothreitol Escherichia coli Gels Glutathione Glutathione S-Transferase Glycerin Homo sapiens leupeptin Magnesium Chloride pepstatin Proteins Recombinant Proteins Sepharose 4B Sucrose Tromethamine

Purification of Soluble GST Fusion Proteins

Cited 18 times

Soluble GST fusion proteins are purified easily using an immobilized glutathione Sepharose column. There are several options of immobilized glutathione chromatography media available to purify soluble GST fusion proteins from bacterial cell lysates (see Note 3). The protocol described below is an adaptation of the manufacturer’s recommendation using glutathione Sepharose 4B poured into a column and using a peristaltic pump to control flow rates. Protease inhibitors and reducing agents should be added to the buffers, as required, to minimize proteolysis of the fusion protein. An exception is that serine protease inhibitors must be removed from the glutathione buffer prior to enzymatic removal of the GST moiety, as they will inhibit enzyme activity (see Note 12). Save a small aliquot from each step of the purification for analysis by SDS-PAGE to monitor the location of the fusion protein throughout the purification (see Notes 13 and 14). A given column or batch of resin should be used exclusively with a single fusion protein to minimize potential cross contamination. As an alternative to column purification, a protocol describing batch purifications is described in Note 15. Batch purifications are quick and simple, but frequently the yield and purity of the protein obtained will be somewhat lower than that obtained through chromatographic separations. In order to minimize proteolysis, all steps of the protein purification should be carried out at 4 °C, unless otherwise noted.

Harper S, & Speicher D.W. (2011). Purification of proteins fused to glutathione S-tranferase. Methods in molecular biology (Clifton, N.J.), 681, 259-280.

Publication 2011

Acclimatization Buffers Cardiac Arrest Chromatography enzyme activity Enzymes Glutathione Peristalsis polyvalent mechanical bacterial lysate Protease Inhibitors Proteins Proteolysis Reducing Agents Resins, Plant SDS-PAGE Sepharose Sepharose 4B Serine Proteinase Inhibitors Staphylococcal Protein A

Co-Immunoprecipitation and VIP Assay in HEK293T Cells

Cited 15 times

HEK293T cells (kindly provided by Hiroyuki Takatsu, Kyoto University) were plated on 6-cm dishes and cultured in DMEM with high glucose (Nacalai Tesque) supplemented with 10% fetal bovine serum (FBS). The cells were transfected with expression vectors for an EGFP fusion construct and a hemagglutinin (HA) fusion construct using Polyethylenimine Max and cultured for 24 h. The cells were then lysed in lysis buffer (50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES]-KOH, pH 7.4, 100 mM KCl, 5 mM NaCl, 3 mM MgCl₂, 0.5% Triton X-100, 10% glycerol, and 1 mM dithiothreitol [DTT]) containing a protease inhibitor cocktail (Nacalai Tesque). The cell lysates were immunoprecipitated with GST–anti-GFP Nb prebound to glutathione–Sepharose 4B beads, and bound proteins were subjected to SDS–PAGE and immunoblotting analysis using anti-HA, anti-mRFP, anti-tRFP, or anti-GFP antibodies as described previously (Katoh et al., 2015 (link), 2016 (link); Nozaki et al., 2017 (link)).
The VIP assay was performed as described previously (Katoh et al., 2015 (link), 2016 (link)) with a slight modification; in this study, cells expressing EGFP-tagged and mChe-tagged proteins were lysed in the HMDEKN cell lysis buffer (10 mM HEPES, pH 7.4, 5 mM MgSO₄, 1 mM DTT, 0.5 mM EDTA, 25 mM KCl, 0.05% NP-40; Cole et al., 1998 (link)).

Nishijima Y., Hagiya Y., Kubo T., Takei R., Katoh Y, & Nakayama K. (2017). RABL2 interacts with the intraflagellar transport-B complex and CEP19 and participates in ciliary assembly. Molecular Biology of the Cell, 28(12), 1652-1666.

Publication 2017

Acids Anti-Antibodies Biological Assay Buffers Cells Cloning Vectors Dithiothreitol Edetic Acid Fetal Bovine Serum Glucose Glutathione Glycerin Hemagglutinin HEPES Hyperostosis, Diffuse Idiopathic Skeletal Immunoblotting Magnesium Chloride Nonidet P-40 Polyethyleneimine Protease Inhibitors Proteins SDS-PAGE Sepharose 4B Sodium Chloride Sulfate, Magnesium Triton X-100

Purification and Characterization of Envelope Proteins

Cited 15 times

Env proteins were purified from the supernatants by affinity chromatography using either a 2G12 column or a Galanthus nivalis (GN)-lectin column [25] (link), [27] (link), [46] (link), [64] (link). Briefly, transfection supernatants were vacuum filtered through 0.2-µm filters and then passed (0.5–1 ml/min flow rate) over the column. The 2G12 column was made from CNBr-activated Sepharose 4B beads (GE Healthcare) coupled to the bNAb 2G12 (Polymun Sciences, Klosterneuburg, Austria). Purification using this column was performed as follows: the beads were washed with 2 column volumes of buffer (0.5 M NaCl, 20 mM Tris, pH 8.0) before eluting bound Env proteins using 1 column volume of 3 M MgCl₂. The eluted proteins were immediately buffer exchanged into 75 mM NaCl, 10 mM Tris, pH 8.0, using Snakeskin dialysis tubing (10K WCMO) (Thermo Scientific). The buffer-exchanged proteins were further concentrated using Vivaspin columns with a 30-kDa cut off (GE Healthcare). For GN-lectin affinity purification, the wash buffer was Dulbecco's phosphate buffer saline (DPBS) supplemented with 0.5 M NaCl was used, and elution was carried out using DPBS supplemented with 1 M methyl mannopyranoside.
In both cases, the affinity-purified Env proteins were further purified to size homogeneity using size exclusion chromatography (SEC) on a Superdex 200 26/60 column (GE Healthcare). A Superose 6 column was sometimes used for analytical or preparative purposes. The trimer fractions and, occasionally also the SOSIP gp140 monomer fractions, were collected and pooled. Protein concentrations were determined using either a bicinchonic acid-based assay (BCA assay; Thermo Scientific, Rockford, IL) or UV₂₈₀ absorbance using theoretical extinction coefficients [66] .

Sanders R.W., Derking R., Cupo A., Julien J.P., Yasmeen A., de Val N., Kim H.J., Blattner C., de la Peña A.T., Korzun J., Golabek M., de los Reyes K., Ketas T.J., van Gils M.J., King C.R., Wilson I.A., Ward A.B., Klasse P.J, & Moore J.P. (2013). A Next-Generation Cleaved, Soluble HIV-1 Env Trimer, BG505 SOSIP.664 gp140, Expresses Multiple Epitopes for Broadly Neutralizing but Not Non-Neutralizing Antibodies. PLoS Pathogens, 9(9), e1003618.

Publication 2013

Acids Biological Assay Broadly Neutralizing Antibodies Buffers Chromatography, Affinity Cyanogen Bromide Dialysis Extinction, Psychological Gel Chromatography Gene Products, env GP 140 Magnesium Chloride Mannose Phosphates Proteins Saline Solution Sepharose 4B snowdrop lectin Sodium Chloride Transfection Tromethamine Vacuum

Affinity Purification of SMG-9 Protein Complexes

Cited 14 times

pEF_Flag-HA-SBP-SMG-9 (2–520) (for Figure 5B), pEF_Flag-HA-SBP-NT-SMG-9 (2–181), pEF_Flag-HA-SBP-CT1-SMG-9 (185–520), pEF_Flag-HA-SBP-CT2-SMG-9 (175–520), pcDNA5/NTAP(CBP-SBP)-SMG-9 (2–520) (for Figure 5C), pSR_Strep-HA-SMG-9 full (2–520), pSR-V5-SMG-9 full (2–520), pSR_V5-NT-SMG-9 (2–181) and pSR-V5-CT-SMG-9 (182–520) were constructed by cloning each cDNA fragment by standard methods. siLentGene-puro-siSMG-9UTR (siRNA sequence targeted to the 3′-UTR of the SMG-9 mRNA: GGAGAGGAATGTCATGCAC) was constructed by method described in manual.
A 293T cells were transfected using HEKfectin (Biorad), and lysed with a loose-fit Potter–Elvehjem homogenizer in T-buffer [20 mM HEPES–NaOH at pH 7.5, 50 mM NaCl, 0.05% Tween-20, 2.5 mM MgCl₂, 0.5 mM DTT, protease inhibitor cocktail (Roche), phosphatase inhibitor cocktail (Roche) and 100 μg/ml RNaseA (Qiagen)]. The soluble fractions were pre-cleared with sepharose 4B (Sigma) and then incubated with streptavidin–sepharose (GE Biotech) for 2 h at 4°C with gentle rotation. Pre-cleared lysates were incubated with streptavidin–sepharose or anti-V5 antibodies for 2 h or 1 h at 4°C with gentle rotation. For antibodies, subsequently, the soluble fractions were incubated with 30 μl of protein G sepharose (GE Biotech) for an additional 1 h at 4°C with gentle rotation. After washing with RNase(−) T-lysis buffer, the affinity-purified protein complexes were eluted by incubation at 4°C for 30 min with RNase(−) lysis buffer containing 2 mM biotin (Sigma) or SDS sample buffer, respectively. All proteins in western blot experiments were detected with an ECL western blot detection kit (GE Biotech) or Lumi-Light (Roche). All experiments were performed two to three times, and typical results are shown.

Fernández I.S., Yamashita A., Arias-Palomo E., Bamba Y., Bartolomé R.A., Canales M.A., Teixidó J., Ohno S, & Llorca O. (2010). Characterization of SMG-9, an essential component of the nonsense-mediated mRNA decay SMG1C complex. Nucleic Acids Research, 39(1), 347-358.

Publication 2010

anti-H-2 antibodies Antibodies Biotin Buffers DNA, Complementary G-substrate HEK293 Cells HEPES Magnesium Chloride Phosphoric Monoester Hydrolases Protease Inhibitors Proteins Ribonucleases RNA, Messenger RNA, Small Interfering Sepharose Sepharose 4B Sodium Chloride streptavidin-agarose Streptococcal Infections TNFSF14 protein, human Tween 20 Western Blotting

Most recents protocols related to «Sepharose 4B»

Purification of GST-tagged Rigor Protein

For in vitro assays, GST-tagged rigor was purified from Escherichia coli BL21 cells. Briefly, after transformation, bacteria were cultured until OD600 ≈ 0.7 at 37°C. Cultures were cooled, after which protein expression was induced with 0.15 mM IPTG at 18°C overnight. Cells were then pelleted by centrifugation at 4,500 × g, snap-frozen in liquid nitrogen, and stored at −80°C until use. Cells were rapidly thawed at 37°C before being resuspended in chilled lysis buffer (1 × PBS supplemented with 0.1% [vol/vol] Tween 20, 250 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 0.5 mM ATP, and 1 × EDTA-free cOmplete protease inhibitor; pH 7.4). Bacteria were lysed by sonication (five rounds of 30 s), supplemented with 2 mg/ml lysozyme, and then incubated on ice for 45 min. The lysate was clarified by centrifuging at 27,000 × g for 30 min and filtered through a 0.22-mm pore size filter before being incubated with equilibrated Glutathione Sepharose 4B resin for 2 h. Beads were then pelleted and resuspended in five column volumes (CV) wash buffer (1 × PBS supplemented with 0.1% [vol/vol] Tween 20, 250 mM NaCl, 5 mM MgCl₂, 1 mM DTT, and 0.5 mM ATP; pH 7.4) and transferred to a BioRad column. Once settled, the resin was washed three times with 10 CV wash buffer and once with 10 CV cleavage buffer (50 mM Tris-HCl supplemented with 0.1% [vol/vol] Tween 20, 100 mM NaCl, 5 mM MgCl₂, 1 mM EDTA, 1 mM DTT, and 0.5 mM ATP; pH 8.0). Then, 80 units of PreScission Protease in three CV cleavage buffer were added and the column was sealed and incubated overnight with rotation for removal of the GST tag. The following morning, once the resin was settled, the eluent was collected, concentrated by spinning through a 3,000 kD MWCO filter, supplemented with 0.5 mM ATP, 1 mM DTT, and 10% [wt/vol] sucrose, aliquoted, flash-frozen in liquid nitrogen, and stored at −80°C. Concentration was determined with a BSA standard gel. All steps from lysis onwards were performed at 4°C.

Jansen K.I., Iwanski M.K., Burute M, & Kapitein L.C. (2023). A live-cell marker to visualize the dynamics of stable microtubules throughout the cell cycle. The Journal of Cell Biology, 222(5), e202106105.

Publication 2023

Bacteria Biological Assay Buffers Cells Centrifugation Cytokinesis Edetic Acid Endopeptidases Escherichia coli Freezing Glutathione Isopropyl Thiogalactoside Magnesium Chloride Muramidase Muscle Rigidity Nitrogen Protease Inhibitors Proteins Resins, Plant Sepharose 4B Sodium Chloride Strains Sucrose Tromethamine Tween 20

Affinity Purification and Mass Spectrometry of Protein Complexes

(AU)₈-boxB and (AU)₈mut-boxB RNAs were generated using a T3 MEGAscript in vitro transcription kit (Thermo Fisher Scientific, AM1338) according to the manufacturer’s recommendations. The template plasmids were linearized with HindIII. RNA was purified using Agencourt RNAClean XP beads (Beckman Coulter, A63987).
GRNA chromatography was performed as described previously^{87 (link)} with the following modifications. First, 30 µg ml⁻¹ of GST-lambda N fusion peptide was immobilized on 20 µl of a 50% slurry of Glutathione Sepharose 4B (Amersham, 17075601) in binding buffer (BB: 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 0.05% NP-40 and 0.4 mM) by incubating on an orbital rocker for 30 minutes at room temperature. Beads were washed twice in 1 ml of BB and incubated with 25 pmol of RNA ((AU)8-boxB and (AU)8mut-boxB) in 200 µl of BB for 1 hour at 4 °C. The beads were washed twice with 1 ml of BB and incubated with 3 mg of protein lysate prepared from P0 mouse brain (lysis buffer: BB with 0.5% NP-40) for 2 hours at 4 °C. The beads were washed three times with 1 ml of BB, and bound proteins were eluted with 0.15 µg of RNAse A in 60 µl of BB without NP-40 for 30 minutes at 30 °C on an orbital shaker. Eluates were supplemented with 70 µl of 2.5 M NaOAC pH 5.0, 1 µl of GlycoBlue (Ambion) and absolute EtOH up to 2 ml and incubated at 4 °C overnight. Proteins were recovered by centrifugation at 18,000g and 4 °C for 30 minutes. Total protein lysates from neurites and soma of PCNs were prepared as previously described^{24 (link)}. Eluates and total lysates were subjected to in-solution digest using trypsin, and desalted peptides were subjected to liquid chromatography–tandem mass spectrometry (LC–MS/MS) using a Q Exactive HF-X mass spectrometer coupled to an Easy nLC 1200 system (Thermo Fisher Scientific). MS data were processed with Max Quant software (1.6.3.4) with peptide FDR cutoff at 1%. The resulting text files were filtered to exclude reverse database hits, potential contaminants and proteins identified only by site. For eluate samples, label-free quantification (LFQ) intensity values were filtered for ‘minimum value of 3’ in at least one group. Missing values were imputed with random noise simulating the detection limit of the mass spectrometer. Differential proteins were defined using two-sample Studentʼs t-test and FDR-based significance cutoff. The DEP R package (version 1.6.1)^{90 (link)} was used to analyze iBAQ protein intensity values from total proteome data. Only proteins detected in at least half (three out of six) of samples and not marked as potential contaminant or reverse sequence were retained for analysis. Missing values were imputed using the ‘MinProb’ algorithm (random draws from a Gaussian distribution) with standard settings, and values from each compartment were then normalized to the median GAPDH intensity. Enrichment between compartments was calculated using a generalized linear model (limma), and P values were FDR-corrected with the Benjamini–Hochberg method.

Mendonsa S., von Kügelgen N., Dantsuji S., Ron M., Breimann L., Baranovskii A., Lödige I., Kirchner M., Fischer M., Zerna N., Bujanic L., Mertins P., Ulitsky I, & Chekulaeva M. (2023). Massively parallel identification of mRNA localization elements in primary cortical neurons. Nature Neuroscience, 26(3), 394-405.

Publication 2023

Brain Buffers Carisoprodol Centrifugation Chromatography Ethanol GAPDH protein, human Glutathione Glycerin Liquid Chromatography Mus Neurites Nonidet P-40 Peptides Plasmids Proteins Proteome Ribonucleases Sepharose 4B Sodium Chloride Student Tandem Mass Spectrometry Transcription, Genetic Tromethamine Trypsin

Recombinant GST and His-tagged Protein Purification

GST, GST-PRMT5, GST-PRMT5 truncated recombinant proteins were expressed in Escherichia coli BL21-DE3 by induction with 1 mM IPTG (Amersco, SF, USA). GST-tagged proteins were purified using Glutathione Sepharose 4B beads (GE Healthcare). G3BP2-His and G3BP2-His truncated proteins were purified with Ni-NTA agarose beads (Qiagen). Different purified GST- and His-tagged recombinant proteins were incubated with pull-down buffer (50 mM Tris-Cl, pH 8.0, 200 mM NaCl, 10 mM MgCl₂, 1% NP-40, 1 mM EDTA,1 mM DTT) for 2 h at 4 °C before immunoblotting assay.

Wang N., Li T., Liu W., Lin J., Zhang K., Li Z., Huang Y., Shi Y., Xu M, & Liu X. (2023). USP7- and PRMT5-dependent G3BP2 stabilization drives de novo lipogenesis and tumorigenesis of HNSC. Cell Death & Disease, 14(3), 182.

Publication 2023

Buffers Edetic Acid Escherichia coli Glutathione Immunoblotting Isopropyl Thiogalactoside Lanugo Magnesium Chloride Nonidet P-40 Proteins Recombinant Proteins Sepharose Sepharose 4B Sodium Chloride Tromethamine

Recombinant Expression and Purification of GbpA

The UniProt ID for GbpA from A. veronii strain HM21 is: A0A7Z3TUS8 and the UniProt ID for GbpA from V. cholerae strain ATCC 39315 is: Q9KLD5. To generate a plasmid for the expression of unmodified A. veronii GbpA, PCR product of the gbpA ORF inclusive of the stop codon was generated by using the primers CBPf (gcatcatatggcagcaaaaatccatc)/CBPr1 (gcatctcgagtcacttcagctcaatccaggctt). The PCR product was cloned into the NdeI and XhoI sites of plasmid pET21b (Novagen). To generate a plasmid for the expression of a cleavable GST tagged GbpA, PCR product of the gbpA ORF lacking the secretion signal and inclusive of the stop codon were generated by using the primers GSTCBPf (gcatgaattccacggctacatcagccagccc)/GSTCBPr (gcatctcgagtcatcacttcagctcaatccagg) and cloned into the EcoR1 and Xho1 sites of pGEX6p1. The plasmids were then transformed into E. coli BL21 (DE3) RIL-CodonPlus cells (Stratagene).
Protein purification was achieved using a glutathione Sepharose 4B column (GE Healthcare) following the recommended protocol. Glutathione S-transferase (GST) cleavage was achieved after elution of GbpA from the column by adding 1 unit of PreScission protease enzyme and incubation overnight at 4°C per the instructions of the manufacturer (GE Healthcare).

Banse A.V., VanBeuge S., Smith T.J., Logan S.L, & Guillemin K. (2023). Secreted Aeromonas GlcNAc binding protein GbpA stimulates epithelial cell proliferation in the zebrafish intestine. Gut Microbes, 15(1), 2183686.

Publication 2023

Cells Codon, Terminator Cytokinesis Escherichia coli Glutathione Glutathione S-Transferase Inclusion Bodies Oligonucleotide Primers Peptide Hydrolases Plasmids Proteins secretion Sepharose 4B Strains Vibrio cholerae

Bacterial Expression and In Vitro Interaction

GST fusion proteins were expressed in BL21 (Vazyme) Escherichia coli, followed by ultrasonic disruption and purification using glutathione Sepharose 4B beads (GE). In vitro transcription and translation experiments were performed using rabbit reticulocyte lysate (TNT systems, Promega) according to the manufacturer’s recommendation. The beads were co-incubated with the in vitro translated proteins and then washed with binding buffer. The eluates were then analyzed using SDS-PAGE.

Zhang D.G., Yu W.Q., Liu J.H., Kong L.G., Zhang N., Song Y.D., Li X.F., Fan Z.M., Lyu Y.F., Li N, & Wang H.B. (2023). Serum/glucocorticoid-inducible kinase 1 deficiency induces NLRP3 inflammasome activation and autoinflammation of macrophages in a murine endolymphatic hydrops model. Nature Communications, 14, 1249.

Publication 2023

Buffers Escherichia coli Glutathione Promega Proteins Rabbits Reticulocytes SDS-PAGE Sepharose 4B Transcription, Genetic Ultrasonics

Top products related to «Sepharose 4B»

Glutathione sepharose 4b by GE Healthcare

Sourced in United States, United Kingdom, Sweden, Germany, Japan, Australia, China

Glutathione Sepharose 4B is a chromatography resin used for the purification of proteins tagged with glutathione S-transferase (GST). It consists of the glutathione ligand covalently coupled to Sepharose 4B beads. The resin can be used to efficiently capture and purify GST-tagged proteins from complex samples.

Glutathione sepharose 4b beads by GE Healthcare

Sourced in United States, United Kingdom, Sweden, China, Germany

Glutathione Sepharose 4B beads are a chromatography resin used for the purification of glutathione S-transferase (GST)-tagged recombinant proteins. The beads consist of cross-linked agarose matrix covalently coupled with reduced glutathione, which serves as a ligand for the affinity-based capture of GST-fusion proteins.

Glutathione sepharose 4b resin by GE Healthcare

Sourced in United States, Sweden, United Kingdom, Japan

Glutathione Sepharose 4B resin is a chromatography medium designed for the affinity purification of glutathione S-transferase (GST) fusion proteins. It consists of glutathione, a tripeptide, covalently attached to Sepharose 4B, a cross-linked agarose bead matrix.

Glutathione sepharose 4b bead by Cytiva

Sourced in United States, Sweden, United Kingdom

Glutathione-Sepharose 4B beads are a chromatography resin designed for the purification of glutathione-binding proteins. The beads consist of cross-linked agarose matrix with covalently coupled glutathione, a tripeptide that can selectively bind to proteins containing a glutathione-S-transferase (GST) tag. The beads can be used in batch or column chromatography for the capture and purification of GST-tagged recombinant proteins from various sample sources.

Prescission protease by GE Healthcare

Sourced in United States, Sweden, Germany, United Kingdom, Japan, Italy

PreScission protease is a recombinant enzyme derived from human rhinovirus 3C protease. It is used for the specific cleavage of fusion proteins to remove affinity tags or other protein domains. The enzyme recognizes and cleaves the sequence Leu-Glu-Val-Leu-Phe-Gln-Gly-Pro, allowing for precise and efficient tag removal from recombinant proteins.

Sepharose 4b by GE Healthcare

Sourced in United States, Sweden, United Kingdom, Germany

Sepharose 4B is a cross-linked agarose-based gel matrix used as a chromatography medium for the purification and separation of biomolecules. It provides a high degree of chemical and physical stability, as well as a porous structure that facilitates efficient adsorption and elution of target molecules.

Glutathione sepharose 4b by Cytiva

Sourced in United States, United Kingdom, Japan

Glutathione Sepharose 4B is a chromatographic media for the purification of proteins containing a glutathione S-transferase (GST) tag. It consists of cross-linked agarose beads to which the glutathione ligand is covalently coupled. This media can be used to capture and purify GST-tagged proteins from complex mixtures.

Protease inhibitor cocktail by Roche

Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel

Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.

Ni nta agarose by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, China, Switzerland, Italy, Canada, Spain, India

Ni-NTA agarose is a solid-phase affinity chromatography resin designed for the purification of recombinant proteins containing a histidine-tag. It consists of nickel-nitrilotriacetic acid (Ni-NTA) coupled to agarose beads, which selectively bind to the histidine-tagged proteins.

Sepharose 4b by Merck Group

Sourced in United States, United Kingdom, Poland

Sepharose 4B is a cross-linked agarose-based chromatography medium used for the separation and purification of biomolecules. It offers a highly porous structure, providing a large surface area for adsorption and separation processes. Sepharose 4B can be used in a variety of chromatographic techniques, including size exclusion, ion exchange, and affinity chromatography.

What are the key benefits of using Sepharose 4B in my research?

Sepharose 4B is a versatile agarose-based resin that offers several key benefits for biomolecule separations and purification. It provides excellent chemical and physical stability, allowing it to be used in a wide range of applications and experimental conditions. The cross-linked structure of Sepharose 4B also makes it resistant to compression, ensuring reliable performance even under high flow rates or pressures. Additionally, the hydrophilic nature of the matrix helps minimize non-specific binding, improving the purity and recovery of target molecules.

Are there different types or variations of Sepharose 4B available?

Yes, there are several variations of Sepharose 4B with different functionalities and applications. Some common types include: - Sepharose 4B: The original, unmodified agarose resin - Sepharose 4B-COOH: Carboxyl-functionalized version for immobilizing amine-containing ligands - Sepharose 4B-NH2: Amine-functionalized version for immobilizing ligands with carboxyl groups - Sepharose 4B-Cl: Chloromethyl-activated version for covalent coupling of ligands These specialized Sepharose 4B resins allow researchers to tailor the matrix to their specific purification needs and target biomolecules.

What are some common applications of Sepharose 4B in life science research?

Sepharose 4B is widely used in a variety of life science applications, including: - Protein purification: Exploiting affinity interactions (e.g. Protein A/G, GST, His-tag) or ion exchange properties - Enzyme purification: Separating enzymes from complex mixtures based on their specific binding characteristics - Antibody purification: Capturing and purifying antibodies using Protein A or Protein G affinity - DNA/RNA purification: Isolating nucleic acids using ion exchange or affinity chromatography - Cell separation: Separating cells or cellular components based on surface markers or other properties The versatility of Sepharose 4B makes it a valuable tool for researchers across many fields, from biochemistry and molecular biology to immunology and cell biology.

How can PubCompare.ai help me optimize my Sepharose 4B protocols?

PubCompare.ai is an AI-driven platform that can help researchers like you streamline their Sepharose 4B experimentation and achieve more reliable results. The tool allows you to: 1. Screen protocol literature more efficiently: PubCompare.ai's powerful search and analysis capabilities help you quickly identify the most relevant Sepharose 4B protocols from published literature, preprints, and patents. 2. Leverage AI to pinpoint critical insights: The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for your specific research goals and maximize reproducibility. By using PubCompare.ai, you can save time, enhance the accuracy of your Sepharose 4B experiments, and confidently select the most appropriate protocols for your research needs.

More about "Sepharose 4B"

Sepharose 4B is a versatile cross-linked agarose resin commonly used in chromatography and affinity purification applications.
This robust matrix offers excellent chemical and physical stability, making it well-suited for a variety of biomolecule separations, including those involving proteins, enzymes, and antibodies.
One popular application of Sepharose 4B is in the purification of glutathione-S-transferase (GST) fusion proteins using Glutathione Sepharose 4B beads or resin.
The high affinity of glutathione for GST allows for efficient capture and separation of the target protein.
PreScission protease can then be used to cleave the GST tag from the purified protein.
Sepharose 4B can also be utilized in the purification of histidine-tagged proteins using Ni-NTA agarose, a nickel-charged resin that binds to the polyhistidine tag.
Additionally, Sepharose 4B can be employed in the separation and purification of a wide range of biomolecules, such as nucleic acids, polysaccharides, and lipids, by tailoring the ligand or functional group attached to the matrix.
To optimize your Sepharose 4B protocols and achieve reliable, reproducible results, researchers can leverage the power of PubCompare.ai, an AI-driven platform that helps locate the best procedures from literature, preprints, and patents.
This tool enables accurate comparisons, allowing scientists to streamline their Sepharose 4B experimentation and enhance reproducibility in life science research.
Whether you're working with Glutathione Sepharose 4B, Ni-NTA agarose, or other Sepharose 4B-based applications, PubCompare.ai can be a valuable resource to help you identify and implement the most effective protocols, ultimately saving time and improving the quality of your research outcomes.