The Rac activity assay is based on the Rap1 activity assay described by Franke et al. (1997) (link). We used a glutathione-S-transferase (GST)–PAK-CD (PAK-CRIB domain) fusion protein, containing the Rac- and Cdc42-binding region from human PAK1B (GenBank/EMBL/DDBJ accession number AF071884 ). A fragment encoding amino acids 56–272 of PAK1B was generated by standard PCR using the oligos AGCTGGATCCATTTTACCTGGAGAT and AGCTGAATTCATTTCTGGCTGTTGGATGTC, and then digested with BamHI/EcoRI and inserted between the BamH1 and EcoRI sites of pGEX2TK (Pharmacia Biotech , Piscataway, NJ) to yield GST–PAK-CD.
Escherichia coli BL21 cells transformed with the GST–PAK-CD construct were grown at 37°C to an absorbance of 0.3. Expression of recombinant protein was induced by addition of 0.1 mM isopropylthiogalactoside for 2 h. Cells were harvested, resuspended in lysis buffer (50 mM Tris-HCl, pH 8, 2 mM MgCl2, 0.2 mM Na2S2O, 10% glycerol, 20% sucrose, 2 mM dithiothreitol, 1 μg/ml leupeptin, 1 μg/ml pepstatin, and 1 μg/ml aprotinin), and then sonicated. Cell lysates were centrifuged at 4°C for 20 min at 45,000 g and the supernatant was incubated with glutathione-coupled Sepharose 4B beads (Pharmacia Biotech ) for 30 min at 4°C. Protein bound to the beads was washed three times in lysis buffer and the amount of bound fusion protein was estimated using Coomassie-stained SDS gels.
Escherichia coli BL21 cells transformed with the GST–PAK-CD construct were grown at 37°C to an absorbance of 0.3. Expression of recombinant protein was induced by addition of 0.1 mM isopropylthiogalactoside for 2 h. Cells were harvested, resuspended in lysis buffer (50 mM Tris-HCl, pH 8, 2 mM MgCl2, 0.2 mM Na2S2O, 10% glycerol, 20% sucrose, 2 mM dithiothreitol, 1 μg/ml leupeptin, 1 μg/ml pepstatin, and 1 μg/ml aprotinin), and then sonicated. Cell lysates were centrifuged at 4°C for 20 min at 45,000 g and the supernatant was incubated with glutathione-coupled Sepharose 4B beads (