Protocol full text hidden due to copyright restrictions
Open the protocol to access the free full text link
>
Chemicals & Drugs
>
Biomedical or Dental Material
>
Suspensions
Suspensions
Suspensions are heterogeneous mixtures where solid particles are dispersed throughout a liquid medium.
They are widely used in various fields, including pharmaceuticals, cosmetics, and materials science.
Suspensions offer unique properties such as improved stability, controlled release, and enhanced bioavailability.
Researchers can optimize suspension research protocols using AI-driven platforms like PubCompare.ai, which help locate the best protocols from literature, pre-prints, and patents.
By utilizing AI-driven comparisons, researchers can enhance the reproducibility and accuracy of their suspension studies, streamlining the research process.
PubCompare.ai is a powerful tool that can assist researchers in navigating the complexities of suspension research and driving advancements in this important field.
They are widely used in various fields, including pharmaceuticals, cosmetics, and materials science.
Suspensions offer unique properties such as improved stability, controlled release, and enhanced bioavailability.
Researchers can optimize suspension research protocols using AI-driven platforms like PubCompare.ai, which help locate the best protocols from literature, pre-prints, and patents.
By utilizing AI-driven comparisons, researchers can enhance the reproducibility and accuracy of their suspension studies, streamlining the research process.
PubCompare.ai is a powerful tool that can assist researchers in navigating the complexities of suspension research and driving advancements in this important field.
Most cited protocols related to «Suspensions»
Adjustment Disorders
Buffers
Cell-Derived Microparticles
Cells
Crossbreeding
DNA, Complementary
DNA Chips
exodeoxyribonuclease I
Hypersensitivity
Kinetics
Microchip Analytical Devices
Oligonucleotide Primers
RNA-Directed DNA Polymerase
All methods and relevant materials are discussed in detail in SI Appendix, SI Methods . The single cell analysis pipeline consisted of the following steps. Brain tissue was dissociated and single cell suspensions were loaded on a medium-sized C1 Single-Cell Auto Prep Array for mRNA Seq available (Fluidigm). cDNA was converted into sequencing libraries using a Nextera XT DNA Sample Preparation Kit (Illumina). Raw sequencing reads were aligned using STAR and per gene counts were calculated using HTSEQ. Gene counts were further analyzed using R. Patients were consented for the acquisition of specimens through a process approved by the Stanford Hospital Institutional Review Board.
Brain
Cells
DNA, Complementary
Ethics Committees, Research
Genes
Patients
RNA, Messenger
Single-Cell Analysis
Tissues
Protocol full text hidden due to copyright restrictions
Open the protocol to access the free full text link
Antibiotics
Asepsis
Bacteria
Ciprofloxacin
Complex Extracts
Normal Saline
Nutrients
resazurin
Sterility, Reproductive
Strains
Sulfoxide, Dimethyl
Technique, Dilution
2-Mercaptoethanol
Antibiotics
Cells
Chickens
Clone Cells
Cloning Vectors
Edetic Acid
Electrophoresis
Electroporation
Embryonic Stem Cells
Feeder Cell Layers
Feeder Cells
Fetal Bovine Serum
Fibroblasts
Gelatins
Geneticin
Genome
Glucose
Glutamine
Hyperostosis, Diffuse Idiopathic Skeletal
LIF protein, human
Mus
Neomycin
Nitrogen
Oil, Mineral
PRSS2 protein, human
Puromycin
Serum
Sterility, Reproductive
Strains
Sulfoxide, Dimethyl
Technique, Dilution
Tissues
Trypsin
Antibodies
Antigens
Cells
Cytokine
Flow Cytometry
Germ Cells
Monoclonal Antibodies
neutravidin
paraform
Phagocytes
secretion
Technique, Dilution
THP-1 Cells
Tissues
Most recents protocols related to «Suspensions»
Example 161
To a solution of 2-(piperazin-1-yl)ethanol (0.73 g, 5.6 mmol, 1 eq.) in DMF (10 mL) was added K2CO3 (1.56 g, 11.3 mmol, 2 eq.) followed by 1,2,4-trifluoro-5-nitrobenzene (1 g, 5.6 mmol, 1 eq.) and the mixture was stirred at 0° C. for 1 hour. The mixture was poured into ice-water (100 mL), extracted by EA (3×40 mL), and the organic layers were combined, washed with brine (150 mL), concentrated and purified via column chromatography (10-95% CH3CN—H2O) to afford 2-(4-(2,5-difluoro-4-nitrophenyl)piperazin-1-yl)ethanol (0.65 g, 41%) as a yellow solid.
To a solution of 2-(4-(2,5-difluoro-4-nitrophenyl)piperazin-1-yl)ethanol (0.65 g, 2.3 mmol) in MeOH (50 mL) was added Pd/C (100 mg) and the resulting mixture was stirred at r.t. overnight. The Pd/C was removed by filtration and the filtrate was concentrated to afford 2-(4-(4-amino-2,5-difluorophenyl)piperazin-1-yl)ethanol (0.58 g, 99%).
To a suspension of 2-(4-(4-amino-2,5-difluorophenyl)piperazin-1-yl)ethanol (270 mg, 0.88 mmol, 1 eq.) and N-(3-(2-chloroquinazolin-8-yl)phenyl)acrylamide (225 mg, 0.88 mmol, 1 eq.) in n-BuOH (10 mL) was added TFA (0.5 mL, 4.4 mmol, 5 eq.) and the resulting mixture was stirred at 90° C. overnight. The mixture was concentrated, diluted with DCM (20 mL), washed with Na2CO3 solution (20 mL), dried, concentrated and purified via column chromatography (DCM/MeOH=10/1) to afford N-(3-(2-((2,5-difluoro-4-(4-(2-hydroxyethyl)piperazin-1-yl)phenyl)amino)quinazolin-8-yl)phenyl)acrylamide (120 mg, 26%) as yellow solid. LRMS (M+H+) m/z calculated 531.2, found 531.2. 1H NMR (DMSO-d6, 400 MHz) δ 10.18 (s, 1H), 9.37 (s, 1H), 9.17 (s, 1H), 7.97-7.94 (m, 3H), 7.83-7.74 (m, 2H), 7.50-7.39 (m, 3H), 6.90-6.85 (m, 1H), 6.48-6.41 (m, 1H), 6.23 (dd, 1H), 5.73 (dd, 1H), 4.42 (t, 1H), 3.55-3.50 (m, 2H), 2.94-2.91 (m, 4H), 2.55-2.54 (m, 4H), 2.44 (t, 2H).
Full text: Click here
1H NMR
Acrylamide
brine
Chromatography
Ethanol
Filtration
Ice
Nitrobenzenes
Piperazine
potassium carbonate
Sulfoxide, Dimethyl
Example 4
Composition H was manufactured according to the following procedure:
- a) Specified amount of purified water was taken in a suitable container and specified quantity of docusate sodium was added and stirred continuously to obtain a solution.
- b) Sodium lauryl sulphate was added to the step (a) solution and stirred continuously to obtain a solution.
- c) Hydroxypropyl methyl cellulose was added to the step (b) solution and stirred continuously to obtain a solution.
- d) Mifepristone was added to the step (c) solution and stirred for 5 minutes to obtain Mifepristone dispersion.
- e) Mifepristone dispersion was homogenized using IKA's Ultra TURRAX® homogenizer at 1000 RPM for 15 minutes.
- f) The above homogenized mifepristone slurry was nano-sized in ball-mill chamber to obtain nano-suspension containing desired particle size of mifepristone. The particle size distribution was measured by using Mastersizer 3000 particle analyser.
- g) Specified quantities of the silicified microcrystalline cellulose and sodium starch glycolate were dispensed in a bowl and warmed to reach 28° C. to 30° C. temperature.
- h) The nano-sized mifepristone suspension according to step (f) was sprayed onto the warmed intra-granular material according to step (g). The sprayed granules were dried at a temperature of 50° C. to 65° C. and sieved through 30 number mesh sieve.
- i) Specified quantities of milled granules of step (h), sodium starch glycolate, microcrystalline cellulose, colloidal silicon dioxide and magnesium stearate were blended and compressed using tablet compression machine. The tablets according to step (i) were coated with suitable coating materials.
Full text: Click here
Cytoplasmic Granules
Docusate Sodium
Hypromellose
magnesium stearate
microcrystalline cellulose
Mifepristone
Pharmaceutical Preparations
Silicon
Silicon Dioxide
sodium starch glycolate
Sulfate, Sodium Dodecyl
Example 1
a. Materials and Methods
i. Vector Construction
1. Virus-Like Particle
As most broadly neutralizing HPV antibodies are derived from the highly conserved N-terminal region of L2, amino acids 14-122 of HPV16 L2 were used to create HBc VLPs. L2 with flanking linker regions was inserted into the tip of the a-helical spike of an HBc gene copy which was fused to another copy of HBc lacking the L2 insert. This arrangement allows the formation of HBc dimers that contain only a single copy of L2, increasing VLP stability (Peyret et al. 2015). This heterodimer is referred to as HBche-L2. A dicot plant-optimized HPV16 L2 coding sequence was designed based upon the sequence of GenBank Accession No. CAC51368.1 and synthesized in vitro using synthetic oligonucleotides by the method described (Stemmer et al., 1995). The plant-optimized L2 nucleotide sequence encoding residues 1-473 is posted at GenBank Accession No. KC330735. PCR end-tailoring was used to insert Xbal and SpeI sites flanking the L2 aa 14-122 using primers L2-14-Xba-F (SEQ ID NO. 1: CGTCTAGAGTCCGCAACCCAACTTTACAAG) and L2-122-Spe-R (SEQ ID NO. 2: G GGACTAGTTGGGGCACCAGCATC). The SpeI site was fused to a sequence encoding a 6His tag, and the resulting fusion was cloned into a geminiviral replicon vector (Diamos, 2016) to produce pBYe3R2K2Mc-L2(14-122)6H.
The HBche heterodimer VLP system was adapted from Peyret et al (2015). Using the plant optimized HBc gene (Huang et al., 2009), inventors constructed a DNA sequence encoding a dimer comprising HBc aa 1-149, a linker (G2S)5G (SEQ ID NO. 39), HBc aa 1-77, a linker GT(G4S)2 (SEQ ID NO. 40), HPV-16 L2 aa 14-122, a linker (GGS)2GSSGGSGG (SEQ ID NO. 41), and HBc aa 78-176. The dimer sequence was generated using multiple PCR steps including overlap extensions and insertion of BamHI and SpeI restriction sites flanking the L2 aa 14-122, using primers L2-14-Bam-F (SEQ ID NO. 3: CAGGATCCGCAACC CAACTTTACAAGAC) and L2-122-Spe-R (SEQ ID NO. 2). The HBche-L2 coding sequence was inserted into a geminiviral replicon binary vector pBYR2eK2M (
2. Recombinant Immune Complex
The recombinant immune complex (RIC) vector was adapted from Kim et al., (2015). The HPV-16 L2 (aa 14-122) segment was inserted into the BamHI and SpeI sites of the gene encoding humanized mAb 6D8 heavy chain, resulting in 6D8 epitope-tagged L2. The heavy chain fusion was inserted into an expression cassette linked to a 6D8 kappa chain expression cassette, all inserted into a geminiviral replicon binary vector (
ii. Agroinfiltration of Nicotiana benthamiana Leaves
Binary vectors were separately introduced into Agrobacterium tumefaciens EHA105 by electroporation. The resulting strains were verified by restriction digestion or PCR, grown overnight at 30° C., and used to infiltrate leaves of 5- to 6-week-old N. benthamiana maintained at 23-25° C. Briefly, the bacteria were pelleted by centrifugation for 5 minutes at 5,000 g and then resuspended in infiltration buffer (10 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.5 and 10 mM MgSO4) to OD600=0.2, unless otherwise described. The resulting bacterial suspensions were injected by using a syringe without needle into leaves through a small puncture (Huang et al. 2004). Plant tissue was harvested after 5 DPI, or as stated for each experiment. Leaves producing GFP were photographed under UV illumination generated by a B-100AP lamp (UVP, Upland, CA).
iii. Protein Extraction
Total protein extract was obtained by homogenizing agroinfiltrated leaf samples with 1:5 (w:v) ice cold extraction buffer (25 mM sodium phosphate, pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 10 mg/mL sodium ascorbate, 0.3 mg/mL PMSF) using a Bullet Blender machine (Next Advance, Averill Park, NY) following the manufacturer's instruction. To enhance solubility, homogenized tissue was rotated at room temperature or 4° C. for 30 minutes. The crude plant extract was clarified by centrifugation at 13,000 g for 10 minutes at 4° C. Necrotic leaf tissue has reduced water weight, which can lead to inaccurate measurements based on leaf mass. Therefore, extracts were normalized based on total protein content by Bradford protein assay kit (Bio-Rad) with bovine serum albumin as standard.
iv. SDS-PAGE and Western Blot
Clarified plant protein extract was mixed with sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.02% bromophenol blue) and separated on 4-15% polyacrylamide gels (Bio-Rad). For reducing conditions, 0.5M DTT was added, and the samples were boiled for 10 minutes prior to loading. Polyacrylamide gels were either transferred to a PVDF membrane or stained with Coomassie stain (Bio-Rad) following the manufacturer's instructions. For L2 detection, the protein transferred membranes were blocked with 5% dry milk in PBST (PBS with 0.05% tween-20) overnight at 4° C. and probed with polyclonal rabbit anti-L2 diluted 1:5000 in 1% PBSTM, followed by goat anti-rabbit horseradish peroxidase conjugate (Sigma). Bound antibody was detected with ECL reagent (Amersham).
v. Immunization of Mice and Sample Collection
All animals were handled in accordance to the Animal Welfare Act and Arizona State University IACUC. Female BALB/C mice, 6-8 weeks old, were immunized subcutaneously with purified plant-expressed L2 (14-122), HBche-L2 VLP, L2 RIC, or PBS mixed 1:1 with Imject® Alum (Thermo Scientific, Rockford, IL). In all treatment groups, the total weight of antigen was set to deliver an equivalent 5 μg of L2. Doses were given on days 0, 21, and 42. Serum collection was done as described (Santi et al. 2008) by submandibular bleed on days 0, 21, 42, and 63.
vi. Antibody Measurements
Mouse antibody titers were measured by ELISA. Bacterially-expressed L2 (amino acids 11-128) was bound to 96-well high-binding polystyrene plates (Corning), and the plates were blocked with 5% nonfat dry milk in PBST. After washing the wells with PBST (PBS with 0.05% Tween 20), the diluted mouse sera were added and incubated. Mouse antibodies were detected by incubation with polyclonal goat anti-mouse IgG-horseradish peroxidase conjugate (Sigma). The plate was developed with TMB substrate (Pierce) and the absorbance was read at 450 nm. Endpoint titers were taken as the reciprocal of the lowest dilution which produced an OD450 reading twice the background. IgG1 and IgG2a antibodies were measured with goat-anti mouse IgG1 or IgG2a horseradish peroxidase conjugate.
vii. Electron Microscopy
Purified samples of HBche or HBche-L2 were initially incubated on 75/300 mesh grids coated with formvar. Following incubation, samples were briefly washed twice with deionized water then negatively stained with 2% aqueous uranyl acetate. Transmission electron microscopy was performed with a Phillips CM-12 microscope, and images were acquired with a Gatan model 791 CCD camera.
viii. Statistical Analysis
The significance of vaccine treatments and virus neutralization was measured by non-parametric Mann-Whitney test using GraphPad prism software. Two stars (**) indicates p values <0.05. Three stars (***) indicates p values <0.001.
b. Design and Expression of HBc VLPs and RIC Displaying HPV16 L2
BeYDV plant expression vectors (
To express L2-containing MC, amino acids 14-122 of HPV16 L2 were fused with linker to the C-terminus of the 6D8 antibody heavy chain and tagged with the 6D8 epitope (Kim et al. 2015). A BeYDV vector (
After rigorous genetic optimization, the N. benthamiana system is capable of producing very high levels of recombinant protein, up to 30-50% of the total soluble plant protein, in 4-5 days (Diamos et al. 2016). Using this system, we produced and purified milligram quantities of fully assembled and potently immunogenic HBc VLPs displaying HPV L2 through a simple one-step purification process (
c. Purification and Characterization of HBche-L2 and L2 RIC
To assess the assembly of HBc-L2 VLP, clarified plant extracts containing either HBche-L2 or HBche were analyzed by sucrose gradient sedimentation. HBche-L2 sedimented largely with HBche, which is known to form VLP, though a small increase in density was observed with HBche-L2, perhaps due to the incorporation of L2 into the virus particle (
L2 RIC was purified from plant tissue by protein G affinity chromatography. By SDS-PAGE, an appropriately sized band was visible >150 kDa that was highly pure (
d. Mouse Immunization with HBche-L2 and L2 RIC
Groups of Balb/c mice (n=8) were immunized, using alum as adjuvant, with three doses each of 5 μg L2 delivered as either L2 alone, HBche-L2 VLP, L2 RIC, or a combination of half VLP and half RIC. VLP and RIC, alone or combined, greatly enhanced antibody titers compared to L2 alone by more than an order of magnitude at all time points tested (
In vitro neutralization of HPV16 pseudovirions showed that the VLP and RIC groups greatly enhanced neutralization compared to L2 alone (
In this study, by displaying amino acids 11-128 on the surface of plant-produced HBc VLPs, L2 antibody titers as high as those seen with L1 vaccines were generated (
Mice immunized with L2 alone had highly variable antibody titers, with titers spanning two orders of magnitude. By contrast, the VLP and VLP/RIC groups had much more homogenous antibody responses, with no animals below an endpoint titer of 1:1,000,000 (
Fc gamma receptors are present on immune cells and strongly impact antibody effector functions such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity (Jefferis 2009). In mice, these interactions are controlled in part by IgG subtypes. IgG1 is associated with a Th2 response and has limited effector functions. By contrast, IgG2a is associated with a Th1 response and more strongly binds complement components (Neuberger and Raj ewsky 1981) and Fc receptors (Radaev 2002), enhancing effector functions and opsonophagocytosis by macrophages (Takai et al. 1994). Immunization with L2 alone was found to produce low levels of IgG2a, however immunization with RIC and VLP produced significant increases in IgG2a titers. VLP-containing groups in particular showed a 3-fold increase in the ratio of IgG2a to IgG1 antibodies (
The glycosylation state of the Fc receptor also plays an important role in antibody function. Advances in glycoengineering have led to the development of transgenic plants with silenced fucosyl- and xylosyl-transferase genes capable of producing recombinant proteins with authentic human N-glycosylation (Strasser et al. 2008). Antibodies produced in this manner have more homogenous glycoforms, resulting in improved interaction with Fc gamma and complement receptors compared to the otherwise identical antibodies produced in mammalian cell culture systems (Zeitlin et al. 2011; Hiatt et al. 2014; Strasser et al. 2014; Marusic et al. 2017). As the known mechanisms by which RIC vaccines increase immunogenicity of an antigen depend in part on Fc and complement receptor binding, HPV L2 RIC were produced in transgenic plants with silenced fucosyl- and xylosyl-transferase. Consistent with these data, we found that L2 RIC strongly enhanced the immunogenicity of L2 (
e. Neutralization of HPV Pseudovirions
Neutralization of papilloma pseudoviruses (HPV 16, 18, and 58) with sera from mice immunized IP with HBc-L2 VLP and L2(11-128) showed neutralization of HPV 16 at titers of 400-1600 and 200-800, respectively (Table 1). More mice IP-immunized with HBc-L2 VLP had antisera that cross-neutralized HPV 18 and HPV 58 pseudoviruses, compared with mice immunized with L2(11-128). Anti-HBc-L2 VLP sera neutralized HPV 18 at titers of 400 and HPV 58 at titers ranging from 400-800 (Table 1), while anti-L2(11-128) sera neutralized HPV 18 at a titer of 200 and HPV 58 at a titer of 400 (Table 1). None of the sera from intranasal-immunized mice demonstrated neutralizing activity, consistent with lower anti-L2 titers for intranasal than for intraperitoneal immunized mice.
Full text: Click here
3' Untranslated Regions
5' Untranslated Regions
AA 149
Agrobacterium tumefaciens
aluminum potassium sulfate
aluminum sulfate
Amino Acids
Animals
Animals, Transgenic
Antibodies
Antibody Formation
Antigen-Presenting Cells
Antigens
B-Lymphocytes
Bacteria
Bromphenol Blue
Buffers
Cell Culture Techniques
Cells
Centrifugation
Chromatography, Affinity
Cloning Vectors
Cold Temperature
Combined Modality Therapy
complement 1q receptor
Complement Receptor
Complex, Immune
Complex Extracts
Cytotoxicities, Antibody-Dependent Cell
Cytotoxin
Digestion
DNA, A-Form
DNA Sequence
Edetic Acid
Electron Microscopy
Electroporation
Enzyme-Linked Immunosorbent Assay
Epitopes
ethane sulfonate
Fc Receptor
Females
Formvar
Fucosyltransferase
G-substrate
Gamma Rays
Genes
Genes, vif
Glycerin
Goat
Helix (Snails)
Helper-Inducer T-Lymphocyte
Homo sapiens
Homozygote
Horseradish Peroxidase
Human papillomavirus 16
Human papillomavirus 18
Human Papilloma Virus Vaccine
IGG-horseradish peroxidase
IgG1
IgG2A
Immune Sera
Immunoglobulin Heavy Chains
Immunoglobulins
Immunologic Factors
Institutional Animal Care and Use Committees
Introns
Inventors
L2 protein, Human papillomavirus type 16
Light
Macrophage
Mammals
Matrix Attachment Regions
Mice, Inbred BALB C
Microscopy
Milk, Cow's
Morpholinos
Mus
Necrosis
Needles
Nicotiana
Oligonucleotide Primers
Oligonucleotides
Open Reading Frames
Opsonophagocytosis
Papilloma
Pathogenicity
Plant Development
Plant Extracts
Plant Leaves
Plant Proteins
Plants
Plants, Transgenic
polyacrylamide gels
Polystyrenes
polyvinylidene fluoride
prisma
Protein Glycosylation
Proteins
Punctures
Rabbits
Receptors, IgG
Recombinant Proteins
Replicon
Reproduction
Response, Immune
Ribulose-Bisphosphate Carboxylase Large Subunit
Satellite Viruses
SDS-PAGE
Serum
Serum Albumin, Bovine
Sodium Ascorbate
Sodium Chloride
sodium phosphate
Specimen Collection
Stars, Celestial
Strains
Sucrose
Sulfate, Magnesium
Syringes
System, Immune
Technique, Dilution
Tissue, Membrane
Tissues
Transferase
Transmission Electron Microscopy
Triton X-100
Tromethamine
Tween 20
Ultraviolet Rays
uranyl acetate
Vaccination
Vaccines
Vaccines, Recombinant
Virion
Viroids
Virus
Vision
Western Blotting
xylosyltransferase
Example 11
Step a: To a stirred suspension of 2,4-dichloro-6-methyl-3-nitropyridine (2.5 g, 12 mmol) in 24 mL of THE was added a solution of 7N NH3 in MeOH (14 mL, 98 mmol). After stirring for 3 h, the volatiles were removed in vacuo. The crude residue was purified by silica gel column chromatography to give 2-chloro-6-methyl-3-nitropyridin-4-amine. C6H7CN3O2 [M+H]+ 188.0, found 188.0.
Step b: To a stirred mixture of 2-chloro-6-methyl-3-nitropyridin-4-amine (760 mg, 4.1 mmol) and Fe (1.1 g, 20 mmol) in a 5:1 solution of EtOH/H2O (24 mL) was added 4.4 mL of conc. HCl. The contents were refluxed for 30 min, then cooled to room temperature and quenched with 100 mL of sat. NaHCO3 (aq). The mixture was extracted with EtOAc and the combined organic layers were dried over MgSO4, filtered, and concentrated in vacuo to yield 2-chloro-6-methylpyridine-3,4-diamine. MS: (ES) m/z calculated for C6H9ClN3 [M+H]+ 158.0, found 158.0.
Step c: To a stirred solution of 2-chloro-6-methylpyridine-3,4-diamine (0.49 g, 3.1 mmol) in 3 mL of EtOH was added a 40% w/w aqueous solution of glyoxal (2.0 mL, 12 mmol). After refluxing for 16 h, the mixture was diluted with H2O and extracted with EtOAc. The organic layers were combined, dried over MgSO4, filtered and concentrated in vacuo. The crude residue was purified by silica gel column chromatography to give 5-chloro-7-methylpyrido[3,4-b]pyrazine. MS: (ES) m/z calculated for C8H7ClN3 [M+H]+ 180.0, found 180.1.
Step d: To a stirred solution of 5-chloro-7-methylpyrido[3,4-b]pyrazine (200 mg, 1.0 mmol) and 2′-chloro-2-methyl-3′-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-[1,1′-biphenyl]-3-amine (350 mg, 1.0 mmol) in 2 mL of MeCN was added AcOH (0.18 mL, 3.1 mmol). After 30 min, the volatiles were concentrated in vacuo. The crude residue was purified by silica gel column chromatography to give N-(2′-chloro-2-methyl-3′-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-[1,1′-biphenyl]-3-yl)-7-methylpyrido[3,4-b]pyrazin-5-amine. MS: (ES) m/z calculated for C27H29BClN4O2 [M+H]+ 487.2, found 487.2.
Step e: To a stirred solution of N-(2′-chloro-2-methyl-3′-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-[1,1′-biphenyl]-3-yl)-7-methylpyrido[3,4-b]pyrazin-5-amine (390 mg, 0.66 mmol), 6-chloro-2-methoxynicotinaldehyde (240 mg, 1.4 mmol), and K3PO4 (490 mg, 2.3 mmol) in a 1:1 solution of 1,4-dioxane/H2O (3.3 mL) under N2 (g) was added Pd(PPh3)4 (76 mg, 0.066 mmol). The mixture was stirred under N2 (g) at 90° C. for 3 h. The mixture was diluted with H2O and then extracted with EtOAc. The combined organic layers were dried over MgSO4, filtered, and concentrated. The crude residue was purified by silica gel column chromatography to give 6-(2-chloro-2′-methyl-3′-((7-methylpyrido[3,4-b]pyrazin-5-yl)amino)-[1,1′-biphenyl]-3-yl)-2-methoxynicotinaldehyde. MS: (ES) m/z calculated for C28H23ClN5O2 [M+H]+ 496.2, found 496.2.
Step f: To a stirred mixture of 6-(2-chloro-2′-methyl-3′-((7-methylpyrido[3,4-b]pyrazin-5-yl)amino)-[1,1′-biphenyl]-3-yl)-2-methoxynicotinaldehyde (120 mg, 0.25 mmol), (S)-5-(aminomethyl)pyrrolidin-2-one hydrochloride (150 mg, 0.99 mmol), and trimethylamine (0.14 mL, 0.99 mmol) in a 4:1 solution of DCM/MeOH (5 mL) was added NaBH(OAc)3 (530 mg, 2.5 mmol). After stirring for 30 min, the mixture was filtered through Celite, and the filtrate was concentrated in vacuo. The product was purified by preparative HPLC to give the product (S)-5-((((6-(2-chloro-2′-methyl-3′-((7-methylpyrido[3,4-b]pyrazin-5-yl)amino)-[1,1′-biphenyl]-3-yl)-2-hydroxypyridin-3-yl)methyl)amino)methyl)pyrrolidin-2-one. 1H NMR (400 MHz, DMSO-d6) δ 12.59 (s, 1H), 9.32 (s, 1H), 9.07 (d, J=2.0 Hz, 1H), 8.86 (d, J=2.0 Hz, 1H), 8.23 (d, J=8.7 Hz, 1H), 7.76 (d, J=7.0 Hz, 1H), 7.62 (s, 1H), 7.55 (d, J=7.5 Hz, 1H), 7.50-7.43 (m, 1H), 7.35 (dd, J=7.9, 7.9 Hz, 1H), 7.12 (s, 1H), 6.96 (d, J=7.5 Hz, 1H), 6.55 (s, 2H), 6.43 (d, J=7.1 Hz, 1H), 4.07 (s, 3H), 3.95-3.84 (m, 1H), 2.48 (s, 4H), 2.26-2.15 (m, 3H), 2.11 (s, 3H), 1.86-1.70 (m, 1H). MS: (ES) m/z calculated for C32H31ClN7O2 [M+H]+ 580.2, found 580.1.
Full text: Click here
1H NMR
2-picoline
4-nitropyridine
Amines
Bicarbonate, Sodium
Celite
Chromatography
Diamines
Dioxanes
diphenyl
Ethanol
Gel Chromatography
Glyoxal
High-Performance Liquid Chromatographies
Pyrazines
Silica Gel
Silicon Dioxide
Sulfate, Magnesium
Sulfoxide, Dimethyl
trimethylamine
Example 2
A. Seed Treatment with Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiably higher biomass than the control corn plants.
The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.
The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.
In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.
B. Seed Treatment with Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiably higher biomass than the control corn plants.
The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.
The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.
In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.
C. Treatment with Agricultural Composition Comprising Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiably higher biomass than the control corn plants.
The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.
The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.
In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.
D. Treatment with Agricultural Composition Comprising Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiably higher biomass than the control corn plants.
The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.
The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.
In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.
A. Seed Treatment with Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.
The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.
B. Seed Treatment with Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.
The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.
C. Treatment with Agricultural Composition Comprising Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the with the agricultural composition will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.
The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.
D. Treatment with Agricultural Composition Comprising Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the with the agricultural composition will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.
The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.
A. Seed Treatment with Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.
The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.
B. Seed Treatment with Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.
The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.
C. Treatment with Agricultural Composition Comprising Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.
The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.
D. Treatment with Agricultural Composition Comprising Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.
The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.
The inoculants were prepared from isolates grown as spread plates on R2A incubated at 25° C. for 48 to 72 hours. Colonies were harvested by blending with sterile distilled water (SDW) which was then transferred into sterile containers. Serial dilutions of the harvested cells were plated and incubated at 25° C. for 24 hours to estimate the number of colony forming units (CFU) in each suspension. Dilutions were prepared using individual isolates or blends of isolates (consortia) to deliver 1×105 cfu/microbe/seed and seeds inoculated by either imbibition in the liquid suspension or by overtreatment with 5% vegetable gum and oil.
Seeds corresponding to the plants of table 15 were planted within 24 to 48 hours of treatment in agricultural soil, potting media or inert growing media. Plants were grown in small pots (28 mL to 200 mL) in either a controlled environment or in a greenhouse. Chamber photoperiod was set to 16 hours for all experiments on all species. Air temperature was typically maintained between 22-24° C.
Unless otherwise stated, all plants were watered with tap water 2 to 3 times weekly. Growth conditions were varied according to the trait of interest and included manipulation of applied fertilizer, watering regime and salt stress as follows:
-
- Low N—seeds planted in soil potting media or inert growing media with no applied N fertilizer
- Moderate N—seeds planted in soil or growing media supplemented with commercial N fertilizer to equivalent of 135 kg/ha applied N
- Insol P—seeds planted in potting media or inert growth substrate and watered with quarter strength Pikovskaya's liquid medium containing tri-calcium phosphate as the only form phosphate fertilizer.
- Cold Stress—seeds planted in soil, potting media or inert growing media and incubated at 10° C. for one week before being transferred to the plant growth room.
- Salt stress—seeds planted in soil, potting media or inert growing media and watered with a solution containing between 100 to 200 mg/L NaCl.
Untreated (no applied microbe) controls were prepared for each experiment. Plants were randomized on trays throughout the growth environment. Between 10 and 30 replicate plants were prepared for each treatment in each experiment. Phenotypes were measured during early vegetative growth, typically before the V3 developmental stage and between 3 and 6 weeks after sowing. Foliage was cut and weighed. Roots were washed, blotted dry and weighed. Results indicate performance of treatments against the untreated control.
The data presented in table 15 describes the efficacy with which a microbial species or strain can change a phenotype of interest relative to a control run in the same experiment. Phenotypes measured were shoot fresh weight and root fresh weight for plants growing either in the absence of presence of a stress (assay). For each microbe species, an overall efficacy score indicates the percentage of times a strain of that species increased a both shoot and root fresh weight in independent evaluations. For each species, the specifics of each independent assay is given, providing a strain ID (strain) and the crop species the assay was performed on (crop). For each independent assay the percentage increase in shoot and root fresh weight over the controls is given.
Full text: Click here
Ammonia
Asparagine
Aspartic Acid
Biological Assay
Bosea thiooxidans
Calcium Phosphates
Capsicum
Cells
Chlorophyll
Cold Shock Stress
Cold Temperature
Crop, Avian
Dietary Fiber
DNA Replication
Droughts
Drought Tolerance
Embryophyta
Environment, Controlled
Farmers
Fertilization
Glutamic Acid
Glutamine
Glycine
Growth Disorders
Herbaspirillum
Herbaspirillum huttiense
Leucine
Lolium
Lycopersicon esculentum
Lysine
Maize
Massilia niastensis
Methionine
Microbial Consortia
Nitrates
Nitrites
Nitrogen
Novosphingobium rosa
Paenibacillus
Paenibacillus amylolyticus
Pantoea agglomerans
Pantoea vagans
Phenotype
Phosphates
Photosynthesis
Plant Development
Plant Embryos
Plant Leaves
Plant Proteins
Plant Roots
Plants
Polaromonas ginsengisoli
Pseudoduganella violaceinigra
Pseudomonas
Pseudomonas fluorescens
Rahnella
Rahnella aquatilis
Retention (Psychology)
Rhodococcus erythropolis
Rosa
Salt Stress
Sodium Chloride
Sodium Chloride, Dietary
Stenotrophomonas chelatiphaga
Stenotrophomonas maltophilia
Stenotrophomonas rhizophila
Stenotrophomonas terrae
Sterility, Reproductive
Strains
Technique, Dilution
Threonine
Triticum aestivum
Tryptophan
Tyrosine
Vegetables
Zea mays
Top products related to «Suspensions»
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Belgium, Switzerland, Singapore, Uruguay, Australia, Spain, Poland, India, Austria, Denmark, Netherlands, Jersey, Finland, Sweden
The FACSCalibur is a flow cytometry system designed for multi-parameter analysis of cells and other particles. It features a blue (488 nm) and a red (635 nm) laser for excitation of fluorescent dyes. The instrument is capable of detecting forward scatter, side scatter, and up to four fluorescent parameters simultaneously.
Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Italy, France, Belgium, Australia, Uruguay, Switzerland, Israel, India, Spain, Denmark, Morocco, Austria, Brazil, Ireland, Netherlands, Montenegro, Poland
Matrigel is a solubilized basement membrane preparation extracted from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma, a tumor rich in extracellular matrix proteins. It is widely used as a substrate for the in vitro cultivation of cells, particularly those that require a more physiologically relevant microenvironment for growth and differentiation.
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
Sourced in United States, Germany, Switzerland, United Kingdom, Italy, Japan, Macao, Canada, Sao Tome and Principe, China, France, Australia, Spain, Belgium, Netherlands, Israel, Sweden, India
DNase I is a laboratory enzyme that functions to degrade DNA molecules. It catalyzes the hydrolytic cleavage of phosphodiester linkages in the DNA backbone, effectively breaking down DNA strands.
Sourced in United States, Germany, United Kingdom, Belgium, China, Australia, France, Japan, Italy, Spain, Switzerland, Canada, Uruguay, Netherlands, Czechia, Jersey, Brazil, Denmark, Singapore, Austria, India, Panama
The FACSCanto II is a flow cytometer instrument designed for multi-parameter analysis of single cells. It features a solid-state diode laser and up to four fluorescence detectors for simultaneous measurement of multiple cellular parameters.
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Belgium, France, Spain, Italy, Australia, Finland, Poland, Switzerland, Cameroon, Uruguay, Denmark, Jersey, Moldova, Republic of, Singapore, India, Brazil
The FACSCalibur flow cytometer is a compact and versatile instrument designed for multiparameter analysis of cells and particles. It employs laser-based technology to rapidly measure and analyze the physical and fluorescent characteristics of cells or other particles as they flow in a fluid stream. The FACSCalibur can detect and quantify a wide range of cellular properties, making it a valuable tool for various applications in biology, immunology, and clinical research.
Sourced in United States, Switzerland, Germany, Japan, United Kingdom, France, Canada, Italy, Macao, China, Australia, Belgium, Israel, Sweden, Spain, Austria
DNase I is a lab equipment product that serves as an enzyme used for cleaving DNA molecules. It functions by catalyzing the hydrolytic cleavage of phosphodiester bonds in the DNA backbone, effectively breaking down DNA strands.
Sourced in United States, United Kingdom, Germany, France, Canada, Australia, Belgium, China, Uruguay, Japan, Sweden, Switzerland, Cameroon
The LSRFortessa is a flow cytometer designed for multiparameter analysis of cells and other particles. It features a compact design and offers a range of configurations to meet various research needs. The LSRFortessa provides high-resolution data acquisition and analysis capabilities.
More about "Suspensions"
Suspensions are heterogeneous mixtures where solid particles are dispersed throughout a liquid medium.
These colloidal dispersions are widely used in various fields, including pharmaceuticals, cosmetics, and materials science.
Suspensions offer unique properties such as improved stability, controlled release, and enhanced bioavailability.
Researchers can optimize suspension research protocols using AI-driven platforms like PubCompare.ai, which help locate the best protocols from literature, pre-prints, and patents.
By utilizing AI-driven comparisons, researchers can enhance the reproducibility and accuracy of their suspension studies, streamlining the research process.
PubCompare.ai is a powerful tool that can assist researchers in navigating the complexities of suspension research and driving advancements in this important field.
The platform can help researchers find the most relevant protocols, compare them side-by-side, and identify the best approach for their specific needs.
This can be particularly useful when working with related techniques and technologies, such as flow cytometry (using instruments like the FACSCalibur and FACSCanto II), cell culture (incorporating Matrigel and Penicillin/streptomycin), and molecular biology (utilizing DNase I).
By leveraging the insights and capabilities of PubCompare.ai, researchers can optimize their suspension studies, improve the quality and reliability of their data, and accelerate the pace of innovation in fields like pharmaceuticals, cosmetics, and materials science.
Whether you're working with cell suspensions, nanoparticle suspensions, or any other type of colloidal dispersion, PubCompare.ai can be a valuable tool in your research toolkit.
These colloidal dispersions are widely used in various fields, including pharmaceuticals, cosmetics, and materials science.
Suspensions offer unique properties such as improved stability, controlled release, and enhanced bioavailability.
Researchers can optimize suspension research protocols using AI-driven platforms like PubCompare.ai, which help locate the best protocols from literature, pre-prints, and patents.
By utilizing AI-driven comparisons, researchers can enhance the reproducibility and accuracy of their suspension studies, streamlining the research process.
PubCompare.ai is a powerful tool that can assist researchers in navigating the complexities of suspension research and driving advancements in this important field.
The platform can help researchers find the most relevant protocols, compare them side-by-side, and identify the best approach for their specific needs.
This can be particularly useful when working with related techniques and technologies, such as flow cytometry (using instruments like the FACSCalibur and FACSCanto II), cell culture (incorporating Matrigel and Penicillin/streptomycin), and molecular biology (utilizing DNase I).
By leveraging the insights and capabilities of PubCompare.ai, researchers can optimize their suspension studies, improve the quality and reliability of their data, and accelerate the pace of innovation in fields like pharmaceuticals, cosmetics, and materials science.
Whether you're working with cell suspensions, nanoparticle suspensions, or any other type of colloidal dispersion, PubCompare.ai can be a valuable tool in your research toolkit.