Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Chemical Viewed Structurally > Borates

Borates

Borates are a class of chemical compounds containing the borate ion (BO3^3- or BO4^5-).
These substances play a crucial role in various industrial and agricultural applications, such as glass manufacturing, fire retardants, and fertilizers.
Borates exhibit a diverse range of physical and chemical properties, including low toxicity, thermal stability, and the ability to enhance the mechanical and chemical properties of materials.
Researchers studying borates can leverage AI-driven platforms like PubCompare.ai to optimize their research process, easily find relevant protocols from literature, preprints, and patents, and identify the best products and protocols through innovative AI comparisons.
This enhances reproducibility and accuracy in borates research.
Discover the power of PubCompare.ai's tools to elevate your borates studies.

Most cited protocols related to «Borates»

1
Immunohistochemical Staining of Tumor Tissue
Standard IHC protocol was followed to stain the tumor tissue samples using the mouse monoclonal antibody against hNIS (human Sodium Iodide Symporter) (Abcam, ab17795), ER (Estrogen Receptor) (Abcam, ab16660, ab288). Briefly, 5 µm sized paraffin embedded tissue sections were de-paraffinized with xylene and endogenous peroxidase activity was quenched with 3% H2O2 in methanol for 30 minutes in the dark. Tissue sections were dehydrated through graded alcohols and subjected to antigen retrieval using 10mM sodium citrate. Sections were washed with TBST (Tris Borate Saline Tween-20) and then blocked with 5% BSA (Bovine Serum Albumin) for one hour. Slides were incubated with the respective mouse monoclonal primary antibody diluted with TBS. Slides were then washed for 5 minutes in TBST and incubated for 1 hour with the respective HRP (Horse Raddish Peroxidase) conjugated anti-mouse secondary antibody diluted with TBS in a ratio of 1∶200. After washing, slides were incubated with DAB (3,3′-diaminobenzidine tetrahydrochloride) (Sigma) and immediately washed under tap water after color development. Slides were then counter stained with hematoxylin. Slides were mounted with DPX (dibutyl phthalate xylene) and were then observed under a light microscope (Carl Zeiss).
Varghese F., Bukhari A.B., Malhotra R, & De A. (2014). IHC Profiler: An Open Source Plugin for the Quantitative Evaluation and Automated Scoring of Immunohistochemistry Images of Human Tissue Samples. PLoS ONE, 9(5), e96801.
Full text: Click here
Publication 2014
Antibodies, Anti-Idiotypic Antigens Borates Equus caballus estrogen receptor alpha, human Ethanol Homo sapiens Light Microscopy Methanol Monoclonal Antibodies Mus Neoplasms Paraffin Peroxidase Peroxide, Hydrogen Phthalate, Dibutyl Saline Solution Serum Albumin, Bovine SLC5A5 protein, human Sodium Citrate Stains Tissues Tromethamine Tween 20 Xylene
2
Structural Homogeneity Analysis of RNA Molecules
In order to check for structure homogeneity of the RNA molecules, all labeled transcripts were analyzed on 5–10% polyacrylamide gels (400/300/0.8 mm, acrylamide/bisakrylamide–29/1) in non-denaturing conditions. The electrophoresis was conducted at a constant power of 10 or 20 W for 4–6 h in 0.5 × TB buffer (45 mM Tris–borate) at 20°C (identical to the temperature of chemical and enzymatic structure probing reactions). Prior to gel electrophoresis, the 32P-labeled transcripts were subjected to a denaturation/renaturation procedure in a solution containing 10 mM Tris–HCl (pH 7.2), 40 mM NaCl and 10 mM MgCl2, by heating the sample at 90°C for 1 min. and slowly cooling it to 20°C (∼1°C/min), and mixed with an equal volume of 7% sucrose with dyes. Electrophoresis performed in the presence of 1–10 mM Mg2+ and constant buffer circulation did not reveal any significant differences in the formation of stable conformers. The specific conditions for the temperature and pH dependence experiments are described in the legend to the Supplementary Figure 2.
Two different electrophoretic migration standards were used: ds69 and ds107. The ds69 represents dsRNA molecule, 69 bp long, obtained by hybridization of two complementary RNA oligomers: 5′ GGG(CUG)21CCC and 5′ GGG(CAG)21 CCC. The second marker, ds107, was obtained by annealing of the fx4 transcript with its complementary molecule containing 23 CCG repeats.
A number of transcripts analyzed in this study migrated on the native gels as two distinct conformers. In all cases, the contribution of the less prevalent conformer was too high to be neglected in the structure studies. Two assays were used to obtain conformer-specific structural data. First, the preparative amount of intact conformers was separated on a native 8% polyacrylamide gel, exposed to the X ray film and then separately excised and eluted from the gel with 20 mM Tris–HCl, pH 7.2. The conformer-specific structure probing was performed without the initial denaturation/renaturation step as described below. Alternatively, structure probing reactions were performed on the mixture of coexisting stable conformers and partially nicked RNA molecules that were resolved on native polyacrylamide gels. Nicked transcripts (due to the nuclease or lead ion hydrolysis), which migrate on native gels at the same rate as intact conformers, were eluted from the gel (with 0.3 M potassium acetate, pH 5.1, 1 mM EDTA and 0.1% SDS), precipitated and analyzed on denaturing polyacrylamide gels. Although, both methods led to identical results, the first, more straightforward approach was used more frequently. In order to rule out the possibility of sequence heterogeneity between the stable coexisting conformers, RNA sequencing analysis of each conformer was conducted using RNA Sequencing Kit (Pharmacia Biotech Inc.) according to the manufacturer's recommendations.
Napierala M., Michalowski D., de Mezer M, & Krzyzosiak W.J. (2005). Facile FMR1 mRNA structure regulation by interruptions in CGG repeats. Nucleic Acids Research, 33(2), 451-463.
Publication 2005
Acrylamide Biological Assay Borates Buffers Complementary RNA Crossbreeding Dyes Edetic Acid Electrophoresis Enzymes Genetic Heterogeneity Hydrolysis Magnesium Chloride Molecular Structure polyacrylamide gels Potassium Acetate RNA, Double-Stranded Sequence Analysis Sodium Chloride Sucrose Tromethamine X-Ray Film
3
RNA Sequencing Library Preparation
Sequencing libraries were prepared as outlined in Fig. 1 with a modified version of the protocol used for ribosome profiling32 (link). Specifically, DMS treated mRNA samples were denatured for 2 min at 95°C and fragmented at 95°C for 2 min in 1X RNA fragmentation buffer (Zn2+ based, Ambion). The reaction was stopped by adding 1/10 volume of 10X Stop solution (Ambion) and quickly placed on ice. The fragmented RNA was run on a 10% TBU (Tris Borate Urea) gel for 60 min. Fragments of 60–80 nucleotides in size were visualized by blue light (Invitrogen) and excised. Gel extraction was performed by crushing the purified gel piece and incubating in 300 µl DEPC treated water at 70°C for 10 min with vigorous shaking. The RNA was then precipitated by adding 33 µl NaOAc, 2 µl GlycoBlue (Invitrogen), and 900 µl 100% EtOH, incubating on dry ice for 20 min and spinning for 30 min at 4°C. The samples were then re-suspended in 7 µl 1X PNK buffer (NEB) and the 3’phospates left after random fragmentation were resolved by adding 2 µl T4 PNK (NEB), 1 µl of Superase Inhibitor (Ambion) and incubating at 37°C for 1h. The samples were then directly ligated to 1 µg of microRNA cloning linker-1, /5rApp/CTGTAGGCACCATCAAT/3ddC/ (IDT DNA) by adding 2µl T4 RNA ligase2, truncated K227Q (NEB), 1 µl 0.1M DTT, 6 µl 50%PEG, 1 µl 10X ligase2 buffer, and incubating at room temperature for 1.5 hr. Ligated products were run on a 10% TBU gel for 40 min, visualized by blue light, and separated from unligated excess linker-1 by gel extraction as described above. Reverse transcription (RT) was performed in 20 µl volume at 52°C using SuperscriptIII (Invitrogen), and truncated RT products of 25–50 nucleotides (above the size of the RT primer) were extracted by gel purification. The samples were then circularized using circ ligase (Epicenter), and Illumina sequencing adapters were introduced by 8–10 cycles of PCR.
Rouskin S., Zubradt M., Washietl S., Kellis M, & Weissman J.S. (2013). Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo. Nature, 505(7485), 701-705.
Publication 2013
Borates Buffers Dry Ice Ethanol Ligase Light MicroRNAs Nucleotides Oligonucleotide Primers Reverse Transcription Ribosomes RNA, Messenger Tromethamine Urea
4
Tyramide Signal Amplification in Planarians
Tyramide conjugates were synthesized as described [49 (link)] from N-hydroxy-succinimidyl-esters of 5/6-carboxyfluorescein (Pierce), 5-(and-6)-carboxytetramethylrhodamine (Molecular Probes), DyLight 633 (Pierce), and 6-(2,4-dinitrophenyl) amino hexanoic acid (Molecular probes). Tyramide signal amplification was performed by incubating planarians for 10 min in fluorophore-conjugated tyramide diluted 1:250–1:500 in 100 mM borate buffer pH 8.5, 2 M NaCl, 0.003% H2O2, and 20 μg/ml 4-iodophenylboronic acid. For double FISH experiments, residual peroxidase activity was quenched by incubating for 45 minutes in 100 mM glycine pH 2.0 or in PBSTx containing either 2% H2O2, 4% formaldehyde, or 100 mM sodium azide.
King R.S, & Newmark P.A. (2013). In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea. BMC Developmental Biology, 13, 8.
Full text: Click here
Publication 2013
Acids Amino Acids Borates Buffers carboxyfluorescein Esters Fishes Formaldehyde Glycine Molecular Probes Peroxidase Peroxide, Hydrogen Planarians Sodium Azide Sodium Chloride
5
Characterization of NIR Fluorophores
Commercially available NIR fluorophores included IRDye™ 800-CW (CW800; Li-Cor, Lincoln, NE), IRDye™ 800-RS (RS800; Li-Cor), and indocyanine green (ICG; Akorn, Decatur, IL). When only an NHS ester was available, the corresponding carboxylic acid (CA) was formed by incubation at high concentration in 50 mM borate buffer, pH 9.0 for 3 h followed by dilution into the desired buffer. All optical measurements were performed at 37°C in phosphate-buffered saline (PBS), pH 7.4 or 100% fetal bovine serum (FBS) buffered with 50 mM HEPES, pH 7.4. For fluorescence quantum yield (Φ) measurements, ICG in dimethyl sulfoxide (Φ = 13%) was used as a calibration standard under conditions of matched absorbance at 770 nm.[14 (link)-19 (link)] For in vitro optical property measurements, online fiberoptic HR2000 absorbance (200-1100 nm) and USB2000FL fluorescence (350-1000 nm) spectrometers (Ocean Optics, Dunedin, FL) were used. NIR excitation was provided by a 770 nm NIR laser diode light source (Electro Optical Components, Santa Rosa, CA) set to 8 mW and coupled through a 300-μm core diameter, NA 0.22 fiber (Fiberguide Industries, Stirling, NJ). In silico calculations of the partition coefficient (logD) and surface molecular charge and hydrophobicity were calculated using MarvinSketch 5.2.1 (ChemAxon, Budapest, Hungary).
Choi H.S., Nasr K., Alyabyev S., Feith D., Lee J.H., Kim S.H., Ashitate Y., Hyun H., Patonay G., Strekowski L., Henary M, & Frangioni J.V. (2011). Synthesis and In Vivo Fate of Zwitterionic Near-Infrared Fluorophores. Angewandte Chemie (International ed. in English), 50(28), 6258-6263.
Publication 2011
Borates Carboxylic Acids Esters Eye Fetal Bovine Serum Fibrosis Fluorescence HEPES Indocyanine Green IRDye800 Lasers, Semiconductor Phosphates Rosa Saline Solution Sulfoxide, Dimethyl Technique, Dilution Vision

Most recents protocols related to «Borates»

1
Targeted siRNA Delivery for Muscle Atrophy
Not available on PMC !

Example 24

For groups 1-12, see study design in FIG. 32, the 21mer Atrogin-1 guide strand was designed. The sequence (5′ to 3′) of the guide/antisense strand was UCGUAGUUAAAUCUUCUGGUU (SEQ ID NO: 14237). The guide and fully complementary RNA passenger strands were assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity. Purified single strands were duplexed to get the double stranded siRNA described in figure A. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linkers. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

For groups 13-18 see study design in FIG. 32, a 21mer negative control siRNA sequence (scramble) (published by Burke et al. (2014) Pharm. Res., 31(12):3445-60) with 19 bases of complementarity and 3′ dinucleotide overhangs was used. The sequence (5′ to 3′) of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 14228). The same base, sugar and phosphate modifications that were used for the active MSTN siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

Antibody siRNA Conjugate Synthesis Using Bis-Maleimide (BisMal) Linker

Step 1: Antibody Reduction with TCEP

Antibody was buffer exchanged with 25 mM borate buffer (pH 8) with 1 mM DTPA and made up to 10 mg/ml concentration. To this solution, 4 equivalents of TCEP in the same borate buffer were added and incubated for 2 hours at 37° C. The resultant reaction mixture was combined with a solution of BisMal-siRNA (1.25 equivalents) in pH 6.0 10 mM acetate buffer at RT and kept at 4° C. overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA. The reaction mixture was treated with 10 EQ of N-ethylmaleimide (in DMSO at 10 mg/mL) to cap any remaining free cysteine residues.

Step 2: Purification

The crude reaction mixture was purified by AKTA Pure FPLC using anion exchange chromatography (SAX) method-1. Fractions containing DAR1 and DAR2 antibody-siRNA conjugates were isolated, concentrated and buffer exchanged with pH 7.4 PBS.

Anion Exchange Chromatography Method (SAX)-1.

Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID×15 cm, 13 um

Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow Rate: 6.0 ml/min

Gradient:

a.% A% BColumn Volume
b.10001
c.81190.5
d.505013
e .40600.5
f.01000.5
g.10002

Anion Exchange Chromatography (SAX) Method-2

Column: Thermo Scientific, ProPac™ SAX-10, Bio LC™, 4×250 mm

Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow Rate: 0.75 ml/min

Gradient:

a.Time% A% B
b.0.09010
c.3.009010
d.11.004060
e.14.004060
f.15.002080
g.16.009010
h.20.009010

Step-3: Analysis of the Purified Conjugate

The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2 (Table 22).

TABLE 22
SAX retention% purity
Conjugatetime (min)(by peak area)
TfR1-Atrogin-1 DAR19.299
TfR1-Scramble DAR18.993

In Vivo Study Design

The conjugates were assessed for their ability to mediate mRNA downregulation of Atrogin-1 in muscle (gastroc) in the presence and absence of muscle atrophy, in an in vivo experiment (C57BL6 mice). Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs and doses, see FIG. 32. Seven days post conjugate delivery, for groups 3, 6, 9, 12, and 15, muscle atrophy was induced by the daily administration via intraperitoneal injection (10 mg/kg) of dexamethasone for 3 days. For the control groups 2, 5, 8, 11, and 14 (no induction of muscle atrophy) PBS was administered by the daily intraperitoneal injection. Groups 1, 4, 7, 10, and 13 were harvested at day 7 to establish the baseline measurements of mRNA expression and muscle weighted, prior to induction of muscle atrophy. At three days post-atrophy induction (or 10 days post conjugate delivery), gastrocnemius (gastroc) muscle tissues were harvested, weighed and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) is calculated and then further normalized relative to the PBS control group by taking a second difference (ΔΔCt).

Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Results

The data are summarized in FIG. 33-FIG. 35. The Atrogin-1 siRNA guide strands were able to mediate downregulation of the target gene in gastroc muscle when conjugated to an anti-TfR mAb targeting the transferrin receptor, see FIG. 33. Increasing the dose from 3 to 9 mg/kg reduced atrophy-induced Atrogin-1 mRNA levels 2-3 fold. The maximal KD achievable with this siRNA was 80% and a tissue concentration of 40 nM was needed to achieve maximal KD in atrophic muscles. This highlights the conjugate delivery approach is able to change disease induce mRNA expression levels of Atrogin-1 (see FIG. 34), by increasing the increasing the dose. FIG. 35 highlights that mRNA down regulation is mediated by RISC loading of the Atrogin-1 guide strands and is concentration dependent.

Conclusions

In this example, it was demonstrated that a TfR1-Atrogin-1 conjugates, after in vivo delivery, mediated specific down regulation of the target gene in gastroc muscle in a dose dependent manner. After induction of atrophy the conjugate was able to mediate disease induce mRNA expression levels of Atrogin-1 at the higher doses. Higher RISC loading of the Atrogin-1 guide strand correlated with increased mRNA downregulation.

US11872287B2. Compositions and methods of treating muscle atrophy and myotonic dystrophy (2024-01-16). Avidity Biosciences, Inc. [US]. Inventors: Andrew John Geall [US], Venkata Doppalapudi [US], David Sai-Ho Chu [US], Michael Caramian Cochran [US], Michael Hood [US], Beatrice Diana Darimont [US], Rob Burke [US], Yunyu Shi [US], Gulin Erdogan Marelius [US], Barbora Malecova [US].
Full text: Click here
Patent 2024
Acetate Anions Antibody Formation Antigens Atrophy Biological Assay Borates Buffers Carbohydrates Chromatography Complementary RNA Complement System Proteins Cysteine Dexamethasone Dinucleoside Phosphates DNA, Complementary Down-Regulation Ethanol Ethylmaleimide Freezing Genes Genes, Housekeeping High-Performance Liquid Chromatographies Immunoglobulins Injections, Intraperitoneal maleimide MicroRNAs Mus Muscle, Gastrocnemius Muscle Tissue Muscular Atrophy Nitrogen Obstetric Delivery Oligonucleotide Primers Pentetic Acid Phosphates Plasma PPIB protein, human Prospective Payment Assessment Commission Real-Time Polymerase Chain Reaction Retention (Psychology) Reverse Transcription RNA, Messenger RNA, Small Interfering RNA-Induced Silencing Complex RNA Interference Sodium Chloride Solvents Stem, Plant STS protein, human Sulfhydryl Compounds Sulfoxide, Dimethyl TFRC protein, human Tissues Transferrin tris(2-carboxyethyl)phosphine Tromethamine
2
Ala-M1-5 kDa PEG 3 Release Assay
Not available on PMC !

Example 8

250 μL of 5 were pH shifted to pH 9.0 by dilution with 205 μL 50 mM borate pH 10.0. The sample was incubated at 37° C. in an incubator for 24 hours. After incubation the percentage of released Ala-M1-5 kDa PEG 3 was determined by RP-HPLC using a Acquity UPLC Peptide BEH C18 column (Waters, 300 Å, 2.1×50 mm, 1.7 μm) on a 1260 Infinity II system (Agilent Technologies). The column temperature was maintained at 30° C. and the flow was set to 0.25 mL/min. UV detection was performed at 215 nm. The content of released 3 was determined against a calibration curve of purified 3 in five different injection volumes in the range of 0.25-2 μg IL2 on column using the same RP-HPLC conditions. IL-2 mutein Ala-M1 polymer prodrug release mixture 7 was used without purification and therefore mainly contains Ala-M1-5 kDa PEG 3 and cleaved 40 kDa mPEG-linker as well as minor amounts of residual 5.

US11879001B2. Conjugate comprising an IL-2 moiety (2024-01-23). ASCENDIS PHARMA ONCOLOGY DIVISION A/S [DK]. Inventors: Nina Gunnarsson [DK], Matiss Maleckis [DK], David B. Rosen [US].
Full text: Click here
Patent 2024
Borates High-Performance Liquid Chromatographies monomethoxypolyethylene glycol mutein 2 mutein 5 Peptides Polymers Prodrugs Technique, Dilution
3
Potentiometric Ion Sensor Fabrication
The following chemicals were obtained from Sigma‒Aldrich (USA): Na+-selective grade ionic carrier X, Na+ tetra [3,5-bis(trifluoromethyl)phenyl]borate (Na–TFPB), valinomycin (ionic carrier K+), Na+ tetraphenylborate (NaTPB), ETH 129 (Ca2+ carrier), 1-nitro-2-(n-octyloxy)benzene (NPOE), bis(2-ethylhexyl)sebacate (DOS), 3,4-ethylenedioxythiophene (EDOT), poly(4-styrenesulfonate) (NaPSS), HCl, H2SO4, urease (≥2 units/mg solid, from Candida spp.), bovine serum albumin (BSA), glutaraldehyde solution (20–25%), polyvinyl butyral resin BUTVAR B-98 (PVB), sodium chloride (NaCl), potassium chloride (KCl), calcium chloride (CaCl2), magnesium chloride (MgCl2), PBS (pH = 7.2), and methanol.
Au sulfite solution and Ag/AgCl ink were obtained from Yuncaitaotao Company. All the chemicals were used as received. All solutions were prepared using deionized water produced by Millipore Water Purification Systems, unless otherwise noted.
Huang X., Zheng S., Liang B., He M., Wu F., Yang J., Chen H.J, & Xie X. (2023). 3D-assembled microneedle ion sensor-based wearable system for the transdermal monitoring of physiological ion fluctuations. Microsystems & Nanoengineering, 9, 25.
Full text: Click here
Publication 2023
Benzene Borates butvar B-98 Calcium chloride Candida ETH 129 Glutaral Ions Magnesium Chloride Methanol Poly A polyvinyl butyral resin Serum Albumin, Bovine Sodium Chloride Sulfites Tetragonopterus Tetraphenylborate Urease Valinomycin
4
Cytotoxicity and Hemolytic Assays of Salmonella Protease
The in vitro cytotoxicity assay of the purified protease of S. typhimurium against HT29 human adenocarcinoma cell line (Merck, Darmstadt, Germany) was performed on a 96-well plate by incubation for 24 h. Per 1 × 105 HT29 cells per milliliter, fifteen micrograms of the enzyme were used. By the end of incubation, the percent of cell death of HT29 was assessed by the standard MTT assay16 (link). For negative blanks, physiological saline was used instead of the active protease preparations, while for blanks, a medium without cells was used. The idea of this assay is that the remaining surviving cells can convert the yellow tetrazolium MTT reagent into the purple formazan complex with a characteristic absorption at A540 nm, therefore indicating HT29 viability. The intensity of the purple color is in direct relation to the number of surviving cells after exposure to the UcB5.
Furthermore, an assay of cell-damaging activity against RBCs (hemolytic activity) due to the purified enzyme was done. This was achieved by vortexing identical volume sizes of 15 µg protease/mL and 4% (v/v) washed human RBCs suspended in 0.1 M borate buffer, pH 7.5. Incubation was done at 37 °C for 90 min, thereafter, the quantity of released hemoglobin was measured colorimetrically. For comparison, a complete hemolysis treatment was done by mixing RBCs suspension with 1% (v/v) triton X-100 solution.
Also, an in vivo screening of cell-damaging activity was done and the LD50 value was calculated. For this, BALB/c mice weighing 22–25 g were acclimatized to the laboratory conditions for one week and retained at relatively fixed nutritional and physical conditions. They were then divided into six groups of six per cage. The first group was represented as the universal blank group. Mice in this group were intraperitoneally inoculated with an equal volume of a heat-denatured enzyme preparation at a concentration of 60 µg/body weight. While the other five groups were intraperitoneally injected with the active protease preparation at various concentrations (60, 30, 15, 8, and 4 µg protease/body weight) in a total volume of 1 ml solution. Animals were then observed at time intervals throughout 48 h for the LD50 calculation according to the method of Karber. Livers of affected and blank mice were removed instantly after death and fixed in 5% (v/v) glutaraldehyde then 1% (w/v) OsO4 solution. Before dissection of a blank mouse, it was anaesthsized by the inhalant gas sevoflurane. Ultrathin sections of 70 nm were sliced by RMC ultramicrotome and loaded on standard-grade TEM support grids made-up of copper for examination under JEOL 1010 TEM.
Kotb E., El-Nogoumy B.A., Alqahtani H.A., Ahmed A.A., Al-shwyeh H.A., Algarudi S.M, & Almahasheer H. (2023). A putative cytotoxic serine protease from Salmonella typhimurium UcB5 recovered from undercooked burger. Scientific Reports, 13, 3926.
Full text: Click here
Publication 2023
Adenocarcinoma Animals Biological Assay Body Weight Borates Buffers Cell Death Cell Lines Cells Copper Cytotoxin Dissection Enzymes Erythrocytes Formazans Glutaral Hemoglobin Hemolysis Homo sapiens HT29 Cells Inhalation Drug Administration Liver Mice, Inbred BALB C MTT formazan MTT tetrazolium Mus Peptide Hydrolases PER1 protein, human Physical Examination physiology protease S Saline Solution Sevoflurane Tetrazolium Salts Triton X-100 Ultramicrotomy
5
Immunofluorescence Analysis of BrdU-Labeled Cells
Two types of immunofluorescence detections were performed on the BrdU-treated lizards. For those in the first group, with survival times of 1.5 h or 3 days (n = 3 each), a triple immunofluorescence detection for GFAP/DCX/BrdU was performed. For those in the second group, with a survival time of 7 days from the first injection and 3 days from the last injection (n = 3), a double immunofluorescence for BrdU/PCNA was performed.
In both cases the protocol for fluorescence immunohistochemistry was similar, except for the antibodies used. First, the slides were deparaffinized and hydrated. Then, they were treated with HCl 2N for 10 min at 37°C for DNA denaturation, rinsed in 0.1 M borate buffer and washed in phosphate buffered saline containing 0.1% Triton X-100 and BSA 0.1% (PTA). Subsequently, the sections were incubated in a blocking solution containing 10% casein (Vector) or 5% normal goat serum (NGS) (Sigma, San Luis, MO, USA) in PTA for 1 h, for triple or double immunoassay, respectively. After rinsing in PTA, the sections were incubated in blocking solution with the corresponding primary antibodies overnight at 4°C. The primary antibodies used for the first group were: mouse anti-BrdU (1:150, Dako), rabbit anti-GFAP (1:500, Dako), and goat anti-DCX (1:200, Sta. Cruz Biotechnologies); and for the second group: mouse anti-PCNA (1:500, Sigma, San Luis, MO, USA), and rat anti-BrdU (1:200, Abcam, Cambridge, UK). Sections were then washed with PTA and incubated with fluorescent secondary antibodies at 1:500 in blocking solution for 1 h at room temperature in the dark. The secondary antibodies used for the first group were: donkey anti-mouse Alexa 647 (1:500, Invitrogen, Walthan, MA, USA), donkey anti-rabbit Alexa 488 (1:500, Invitrogen, Walthan, MA, USA), and donkey anti-goat Alexa 555 (1:500, Invitrogen, Walthan, MA, USA); and for the second group: goat anti-mouse Alexa 555 (1:500, Invitrogen, Walthan, MA, USA), and goat anti-rat Alexa 488 (1:500, Invitrogen, Walthan, MA, USA). The sections were then washed in 0.1 M PB and incubated for 10 min with DAPI 1:1000 in H2O (Sigma, San Luis, MO, USA) at room temperature in the dark. Finally, the slides were washed with 0.1 M PB and mounted with Fluorsave (Calbiochem). The sections were analyzed with a Leica (Wetzlar, Germany) SP2 TCS AOBS inverted confocal microscope.
González-Granero S., Font E., Desfilis E., Herranz-Pérez V, & García-Verdugo J.M. (2023). Adult neurogenesis in the telencephalon of the lizard Podarcis liolepis. Frontiers in Neuroscience, 17, 1125999.
Full text: Click here
Publication 2023
Antibodies Borates Bromodeoxyuridine Caseins Cloning Vectors DAPI DNA Denaturation Equus asinus Fluorescence Fluorescent Antibody Technique Glial Fibrillary Acidic Protein Goat Immunoassay Immunohistochemistry Lizards Mice, House Microscopy, Confocal Phosphates Proliferating Cell Nuclear Antigen Rabbits Saline Solution Serum Triton X-100

Top products related to «Borates»

1
Sybr gold by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Japan, China, Canada, Spain
SYBR Gold is a nucleic acid stain used for the detection and quantification of DNA and RNA in gel electrophoresis and other applications. It is a sensitive, fluorescent dye that binds to nucleic acids, allowing the visualization and analysis of DNA and RNA samples.
2
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
3
Bromodeoxyuridine (brdu) by Merck Group
Sourced in United States, Germany, United Kingdom, France, Spain, China, Sao Tome and Principe, Switzerland, Macao, Australia, Canada, Belgium, Japan, Israel, Poland
BrdU is a synthetic nucleoside that is an analog of the DNA base thymidine. It can be incorporated into the newly synthesized DNA of replicating cells, substituting for thymidine during the DNA synthesis phase of the cell cycle.
4
Gelred by Biotium
Sourced in United States, United Kingdom, Germany, Canada, Belgium, Switzerland, France, Italy, Australia, China, Spain
GelRed is a nucleic acid stain used for detecting DNA and RNA in agarose gels. It is a sensitive and stable dye that binds to nucleic acids and emits fluorescence when exposed to UV or blue light.
5
γ 32p atp by PerkinElmer
Sourced in United States, United Kingdom, Japan, China, France, Australia, Germany, Italy, Sweden, Canada
[γ-32P]ATP is a radiolabeled compound containing the radioactive isotope phosphorus-32 (32P) attached to the gamma phosphate group of adenosine triphosphate (ATP). This product is commonly used as a tracer in various biochemical and molecular biology applications, such as nucleic acid labeling and analysis.
6
Tetrahydrofuran by Merck Group
Sourced in United States, Germany, United Kingdom, Spain, Italy, France, China, Belgium, Switzerland, Australia, Sao Tome and Principe, India, Greece
Tetrahydrofuran is a colorless, volatile, and flammable organic compound. It is commonly used as a polar aprotic solvent in various industrial and laboratory applications. Tetrahydrofuran's core function is to serve as a versatile solvent for a wide range of organic compounds, including polymers, resins, and other materials.
7
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
8
Lightshift chemiluminescent emsa kit by Thermo Fisher Scientific
Sourced in United States, China, Germany
The LightShift Chemiluminescent EMSA Kit is a laboratory tool designed to detect and analyze protein-DNA interactions. It uses chemiluminescent detection to visualize and quantify the binding of proteins to specific DNA sequences.
9
Methanol by Merck Group
Sourced in Germany, United States, Italy, India, United Kingdom, China, France, Poland, Spain, Switzerland, Australia, Canada, Sao Tome and Principe, Brazil, Ireland, Japan, Belgium, Portugal, Singapore, Macao, Malaysia, Czechia, Mexico, Indonesia, Chile, Denmark, Sweden, Bulgaria, Netherlands, Finland, Hungary, Austria, Israel, Norway, Egypt, Argentina, Greece, Kenya, Thailand, Pakistan
Methanol is a clear, colorless, and flammable liquid that is widely used in various industrial and laboratory applications. It serves as a solvent, fuel, and chemical intermediate. Methanol has a simple chemical formula of CH3OH and a boiling point of 64.7°C. It is a versatile compound that is widely used in the production of other chemicals, as well as in the fuel industry.
10
Quantity one software by Bio-Rad
Sourced in United States, China, Germany, Italy, United Kingdom, Spain, Japan, France, Canada, Sweden, Israel, Australia
Quantity One software is a powerful and versatile tool for analyzing and quantifying data from gel electrophoresis and imaging experiments. It provides a suite of analytical tools for researchers to accurately measure and compare the size, intensity, and other properties of bands or spots in their samples.

More about "Borates"

Borates are a diverse class of chemical compounds that contain the borate ion (BO3^3- or BO4^5-).
These substances play a crucial role in a wide range of industrial and agricultural applications, such as glass manufacturing, fire retardants, and fertilizers.
Borates exhibit a range of desirable properties, including low toxicity, thermal stability, and the ability to enhance the mechanical and chemical properties of materials.
Researchers studying borates can leverage powerful AI-driven platforms like PubCompare.ai to optimize their research process.
These tools enable scientists to easily find relevant protocols from literature, preprints, and patents, and to identify the best products and protocols through innovative AI comparisons.
This enhances the reproducibility and accuracy of borates research, which is essential for advancing our understanding of these important compounds.
The diverse applications of borates include their use in SYBR Gold, a fluorescent dye used for nucleic acid staining, and TRIzol reagent, a solution used for RNA extraction.
Borates are also found in BrdU, a synthetic nucleoside analogue used to detect proliferating cells, and GelRed, a nucleic acid gel stain.
Additionally, borates play a role in the [γ-32P]ATP, a radioactively labeled nucleotide used in various molecular biology techniques.
Borates can also be found in Tetrahydrofuran, a widely used organic solvent, and Bovine serum albumin, a common protein used in biological assays.
The LightShift Chemiluminescent EMSA Kit, which is used to detect protein-DNA interactions, may also contain borates.
Methanol, a common organic solvent, can be used in conjuction with borates in various applications.
Researchers can use the Quantity One software to analyze and quantify data related to borates and their applications.
By leveraging the power of PubCompare.ai and exploring the diverse applications of borates, scientists can enhance the reproducibility, accuracy, and efficiency of their borates research, leading to new discoveries and advancements in this important field of study.