Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Indicator > Adenosine 5'-O-(3-thiotriphosphate)

Adenosine 5'-O-(3-thiotriphosphate)

Adenosine 5'-O-(3-thiotriphosphate): A synthetic analogue of adenosine triphosphate (ATP) where the oxygen atom in the terminal phosphate group is replaced by a sulfur atom.
This modification makes the compound more resistant to hydrolysis by ATPases, allowing it to act as a stable ATP mimetic.
Adenosine 5'-O-(3-thiotriphosphate) is widely utilized in biochemical and cell biology reserach to study the role of ATP-dependent processes, such as protein phosphorylation, enzyme activation, and signal transduction.
Its ability to be incorporated into cellular systems while resisting degradation makes it a valuable tool for investigting the dynamisc of ATP-mediated regulation.

Most cited protocols related to «Adenosine 5'-O-(3-thiotriphosphate)»

1
Structural Characterization of Hsp90 N-Terminal Domain
The NH2-terminal domain of human Hsp90 (residues 9–236) was expressed and purified as described (Stebbins et al., 1997 (link)). Crystals were grown in the presence of 10 mM adenosine-5′-O-(3-thiotriphosphate) (ATPγS) and 0.2 M magnesium chloride, from a buffer of 0.1 M Tris-HCl, pH 8.5, and 30% PEG4000. Data collection, structure determination, and refinement followed the procedures described for the analysis of the same domain with bound geldanamycin (Stebbins et al., 1997 (link)).
Obermann W.M., Sondermann H., Russo A.A., Pavletich N.P, & Hartl F.U. (1998). In Vivo Function of Hsp90 Is Dependent on ATP Binding and ATP Hydrolysis. The Journal of Cell Biology, 143(4), 901-910.
Publication 1998
adenosine 5'-O-(3-thiotriphosphate) geldanamycin Homo sapiens HSP90 Heat-Shock Proteins Magnesium Chloride Tromethamine
2
Investigating Cellular Signaling Pathways
Anti-cPLA2, anti-PKCα, anti-PKCι, anti-PKCμ, anti-STAT3, anti-Jak2, anti-β-actin, and anti-p47phox antibodies were from Santa Cruz (Santa Cruz, CA). Anti-COX-2 antibody was from BD Transduction Laboratories (San Diego, CA). Adenosine 5′-O-(3-thiotriphosphate) (ATPγS), Gö6983, Gö6976, GF109203X, Ro318220, Rottlerin, PPADS, suramin, AG490, CBE, and arachidonic acid were from Biomol (Plymouth Meeting, PA). All other chemicals and enzymes were obtained from Sigma (St. Louis, MO). Edaravone (MCI-186) was from Tocris Bioscience (Ellisville, MO). CellROX™ Deep Red Reagent and CM-H2DCFDA were from Invitrogen (Carlsbad, CA).
Cheng S.E., Lee I.T., Lin C.C., Wu W.L., Hsiao L.D, & Yang C.M. (2013). ATP Mediates NADPH Oxidase/ROS Generation and COX-2/PGE2 Expression in A549 Cells: Role of P2 Receptor-Dependent STAT3 Activation. PLoS ONE, 8(1), e54125.
Publication 2013
2',7'-dichlorodihydrofluorescein diacetate Actins adenosine 5'-O-(3-thiotriphosphate) AG-490 Anti-Antibodies Antibodies, Anti-Idiotypic Arachidonic Acid Edaravone Enzymes GF 109203X Gö6983 Janus Kinase 2 MCI 186 NCF1 protein, human PRKCA protein, human PTGS2 protein, human pyridoxal phosphate-6-azophenyl-2',4'-disulfonic acid rottlerin STAT3 Protein Suramin
3
Synthesis of m6A-containing RNAs
To synthesize RNAs containing a single m6A or A nucleotide, or 10 m6A or 10 A nucleotides, we performed in vitro transcription using reactions that contained either m6A triphosphate or adenosine triphosphate. This approach ensures that all adenosines are either in the m6A or A form. In vitro transcription was performed using AmpliScribe T7 High Yield Transcription kit (AS3107, Lucigen) according to the manufacturer’s instruction. The template encodes an RNA containing a single adenosine (indicated in bold): (GGTCTCGGTCTTGGTCTCTGGTCTTTGGACTTGGTCTTGGTCTTCGGTCTCGGTCTTTGGTCT) or 10 adenosines in the canonical GGACU consensus motif for m6A: (GGACTCGGACTTGGACTCTGGACTTTGGACTTGGACTTGGACTTCGGACTCGGACTTTGGACT). The m6A versions of the RNA were synthesized by replacing adenosine 5’ triphosphate in the reaction by N6-methyadenosine 5’ triphosphate (TriLink). The reaction was terminated by addition of DNAse I and incubation for 15 min at 37°C. RNA was purified using an Oligo Clean and Concentrator column (D4061, Zymo Research). RNA concentration was determined using a NanoDrop spectrophotometer and verified by TBE-urea denaturing gel electrophoresis. Nucleic acid staining was performed with SYBR Gold (S11494). DNA matrix was obtained by hybridizing DNA oligonucleotides containing a T7 promoter and the target sequence.
For fluorescent RNA in vitro transcription, BODIPY FL-Guanosine 5’-O-(3-Thiotriphosphate) fluorescent GTPs (G22183, Invitrogen) were added to the reaction in a 1:10 molar ratio with GTPs. The thiotriphosphate linkage prohibits the fluorescent nucleotides from being internally incorporated, and only allows incorporation at the +1 position of in vitro transcripts (the initial ‘G’ after the T7 promoter sequence). Incorporation of the fluorescent GTP into transcripts was verified by TBE-urea denaturing gel electrophoresis and fluorophore excitation by exposure to 488 nm light. RNA concentrations were determined using a NanoDrop spectrophotometer and verified by SYBR Gold staining.
Ries R.J., Zaccara S., Klein P., Olarerin-George A., Namkoong S., Pickering B.F., Patil D.P., Kwak H., Lee J.H, & Jaffrey S.R. (2019). m6A enhances the phase separation potential of mRNA. Nature, 571(7765), 424-428.
Publication 2019
Adenosine Adenosine Triphosphate BODIPY Deoxyribonuclease I Electrophoresis Exhaling Gold Guanosine 5'-O-(3-Thiotriphosphate) Light Molar Nucleic Acids Nucleotides Oligonucleotides S 11494 Transcription, Genetic triphosphate Urea
4
Phosphorylation and Binding Assay of Mt-MviN ICD
Assays were performed with [γ-32P]ATP as described (47 (link)). The Mt-MviN ICD was phosphorylated for binding and structural studies for 24 to 48 hours at 4°C with the ICD at 0.1 to 1 mg/ml in tris buffer (pH 7.0), 1 mM ATP, 1 mM MnCl2, 0.1 mM EDTA, and protease inhibitors AEBSF, leupeptin, and E64. PknB KD was added at 1:10 to 1:20 kinase-substrate ratio. The kinase was removed with a 1-ml HisTrap column (GE Healthcare), and the ATP and MnCl2 were removed by dialysis. Phosphorylation was confirmed with Pro-Q Diamond stain (Molecular Probes) and by altered SDS–polyacrylamide gel electrophoresis (SDS-PAGE) migration for constructs <30 kD.
Purified PknB or the Mt-MviN ICD at 0, 0.1, 0.5, 1, 2, 5, or 10 μM in 60 mM Mops, 0.1 mM EDTA, 1 mM MgCl2, 1 mM MnCl2, and 4% glycerol was mixed with 25 nM BODIPY–ATP-γ-S [adenosine 5′-O-(3-thiotriphosphate)] analog. The fluorescence polarization was measured using an excitation energy of 485 nm and a 535-nm emission filter with a Victor 3V 1420 multilabel counter (PerkinElmer).
Gee C.L., Papavinasasundaram K.G., Blair S.R., Baer C.E., Falick A.M., King D.S., Griffin J.E., Venghatakrishnan H., Zukauskas A., Wei J.R., Dhiman R.K., Crick D.C., Rubin E.J., Sassetti C.M, & Alber T. (2012). A Phosphorylated Pseudokinase Complex Controls Cell Wall Synthesis in Mycobacteria. Science signaling, 5(208), ra7.
Publication 2012
4-(2-aminoethyl)benzenesulfonylfluoride adenosine 5'-O-(3-thiotriphosphate) Biological Assay BODIPY Dialysis Diamond Edetic Acid Fluorescence Polarization Glycerin leupeptin Magnesium Chloride manganese chloride Molecular Probes morpholinopropane sulfonic acid Phosphorylation Phosphotransferases Pro-Q aerosol foam Protease Inhibitors SDS-PAGE Stains Tromethamine
5
ATP Binding Assay for NLR Proteins
In this assay, purified NLR protein mixtures of proteins containing NLR proteins are incubated with a radiolabeled, non-hydrolyzable analog of ATP, [35S]-ATPγS. After the binding reaction is complete, the protein bound nucleotide is isolated from the free nucleotide by filtering the solution through a protein-binding nitrocellulose filter. The filter-associated label is then detected using liquid scintillation counting. Variations of this assay can be performed to assess the relative nucleotide binding stoichiometry of different proteins (or preparations of proteins), the relative preference of a particular NLR protein for a nucleotide base by including titrations of competitor nucleotides, or relative rates of association or dissociation of an NLR protein from ATPγS (seeFigure 2). Additionally, the optimal buffer pH, NaCl concentration, and Mg2+ ion concentration may vary from protein to protein. We recommend optimizing these when exploring ATPγS-binding activity of uncharacterized NLR proteins. The description of the assay that follows reflects the first of these assays, a comparison of relative nucleotide binding by different NLR containing protein preparations. The assay is carried out at a single concentration of ATPγS for a fixed time of binding (a time that has previously been demonstrated achieves maximum binding for NLRP3). In the described assay, we compare the ATPγS binding of NLRP3 at 4 stages of protein preparation (Figure 1 and 3).

Determine the number of filters required for the assay (see note 6):

3 for counting total CPM in the binding reactions. +

3 for determining nonspecific filter binding (no protein control) +

3 × # of samples or time points to be tested

Soak MF membrane filters in Wash Buffer, ~200 mL buffer in 9” × 9” pyrex pan. To wet membrane evenly, place filters in pan and rock or shake slowly for at least 30 min at room temperature (see note 7).

While membranes are soaking, set up binding reactions:

Thaw and prepare 1 μL diluted [35S]-ATPγS for each filtered reaction. Dilute [35S]-ATPγS 1:16 in 2x ATP binding buffer. Use 1 μL of the diluted isotope in each 100 μL binding reaction, yielding a final concentration of 5 nM [35S]-ATPγS in the reaction mix.

Turn on water bath and set temperature to 30 °C.

Prepare 2x reaction mix (2x ATP binding buffer with [35S]-ATPγS). Place 49 μL 2x binding buffer × (# of prepared filters) in 15 mL conical screw cap tube (for a low number of binding reactions a 1.5 mL microfuge tube can be substituted) and add 1 μL × (# of prepared filters) diluted [35S]-ATPγS (see note 8).

Label three 1.5 mL microfuge tubes for each sample to be tested and three additional tubes for a no protein control.

Add 50 μL of 2x binding buffer with [35S]-ATPγS to each reaction tube.

Dilute protein samples being tested for assay. We typically use ~100 ng purified NLR protein for each binding reaction. We dilute purified protein preparations to 2 ng/μL in NLR Protein Storage Buffer (see note 6).

At timed intervals add 50 μL protein solution (or Protein Storage Buffer) into the appropriate reaction tube, vortex and place reaction in a 30°C water bath. Start all reactions for one sample type in 40 second intervals then wait 2 min and initiate the next reaction. Allow the binding reaction to proceed 60 minutes. See Table 1 for starting and completion time example for assay run to generate Figure 3. (see Notes 9 & 10)

Approximately 5 min before the end of the hour, turn on the vacuum for the filtration system and close the individual valves for each filter holder spot and prepare to process the reactions:

Lay three wet filter membranes on filter support grids of the vacuum manifold and place manifold chimneys in place over the filters (see Note 11)

Add 4 mL ice-cold 1x ATP binding buffer to filter each holder (see Note 12).

Add 100 μL (all) of the reaction mixture to the buffer in a filter holder and open the filter valve to begin the filtration of that sample.

Repeat the transfer of reaction mixtures to filter holders for all three reactions of a single sample at 20 s intervals.

Wash 3x by immediately adding 8 mL wash buffer to each holder after all buffer passes through the membrane using the Varipet Syringe Dispenser (for a total of 8 mL × 3) (see Note 13).

Turn off vacuum and remove filter membranes from the filtration system to a 20 cm × 20 cm sheet of aluminum foil.

Repeat steps 11–16 of section 3.1, for each reaction sample.

To determine the total cpm placed in each reaction and the specific activity (cpm/pmol) of the labeled [35S]-ATPγS, run a set of three filters through steps 11–16 skipping the addition of reaction (step 13).

Dry membranes thoroughly using a heat lamp (see Note 14).

For the 3 filters prepared in step 18, pipette 2.5 μL of label containing 2x binding buffer (remaining from step 5) onto each filter and allow filters to completely dry. (The cpm detected on these filters represents 1/20 the total placed in the reaction.)

Put the filters into 5 mL scintillation vials and add 5 mL scintillation liquid.

Count using a liquid scintillation counter using a program suitable for 35S detection.

Mo J, & Duncan J.A. (2013). Assessing ATP binding and hydrolysis by NLR proteins. Methods in molecular biology (Clifton, N.J.), 1040, 153-168.
Publication 2013

Most recents protocols related to «Adenosine 5'-O-(3-thiotriphosphate)»

1
Sheathless Capillary Electrophoresis Chemicals
Deionized water, methanol (99.9%), MgCl2, and beryllium sulfate (99.99%) were obtained from Fisher Scientific (Ward Hill, MA). 1 n NaOH, 1 n HCl, ultrahigh purity ammonium acetate (99.999%), Tris‐HCl, KCl, GuHCl, DTT, adenosine 5′‐O‐(3‐thiotriphosphate) tetralithium salt, and aluminum fluoride (99.8%) were purchased from Sigma–Aldrich (St. Louis, MO). All sheathless bare fused silica (BFS) OptiMS CESI capillaries (91 cm × 30 µm i.d. × 150 µm o.d.) were from SCIEX (Brea, CA).
Marie A., Georgescauld F., Johnson K.R., Ray S., Engen J.R, & Ivanov A.R. (2024). Native Capillary Electrophoresis–Mass Spectrometry of Near 1 MDa Non‐Covalent GroEL/GroES/Substrate Protein Complexes. Advanced Science, 11(11), 2306824.
Publication 2024
2
Synthesis of Adenosine Triphosphate Analogues
The adenosine
5′-O-(1-thiotriphosphate) analogues, presented
in this paper, were synthesized via the oxathiaphospholane method45 (link),46 (link) according to the procedure described previously.1 (link) The protected adenosine 5′-O-(2-thio-1,3,2-oxathiaphospholane)
in the presence of DBU as a base catalyst was reacted with pyrophosphate
or hypophosphate for compounds 2 and 4,
respectively. The ring-opening reaction followed by the spontaneous
elimination of ethylene sulfide led to the desired analogues. The
reactions were performed at room temperature with the exclusion of
moisture. After the deprotection step, with 25% aqueous ammonia, the
compounds were purified by ion-exchange chromatography (DEAE-Sephadex)
using triethylammonium bicarbonate (TEAB) as an eluent. The β,γ-hypo-ATP
(3) was obtained from the starting α-thio-β,γ-hypo-ATP
(4) (as a diastereomeric mixture) using iodoxybenzene
according to a previously published protocol.1 (link) The obtained compounds were additionally purified and separated
into the individual P-diastereoisomers using high-performance liquid
chromatography (RP-HPLC) with linear gradient 0–30% MeCN supplemented
with 0.1 mol/L triethylammonium acetate buffer (TEAAc) (pH 7.5). The
final quality of the compounds was achieved by analytical RP-HPLC
analysis.
Pawlowska R., Graczyk A., Radzikowska-Cieciura E., Wielgus E., Madaj R, & Chworos A. (2024). Substrate Specificity of T7 RNA Polymerase toward Hypophosphoric Analogues of ATP. ACS Omega, 9(8), 9348-9356.
Publication 2024
3
Synthesis of Adenosine 5'-O-(1-Thiotriphosphate) Analogues
Not available on PMC !
Adenosine was purchased from Pharma Waldhof (Germany). The acetic anhydride,1,4-diazabicyclo [5.4.0]undec-7-ene (DBU), phosphorus trichloride, as well as 1,2-ethanediol and tris(tetrabutylammonium) hydrogen pyrophosphate and methylenediphosphonic acid were purchased from Sigma-Aldrich/Merck (USA). Chloroform, triethylamine and methanol were provided by POCH (Poland). Elemental sulphur was dried under high vacuum for 12 h. Acetonitrile (HPLC grade, JT Baker), which was used as a solvent for ring opening reaction, was stored over 3 Å molecular sieves until the residual moisture content dropped below 10 ppm (by Karl-Fischer coulometry). The obtained adenosine 5′-O-(1-thiotriphosphate) analogues were separated into P-epimers using a binary Varian HPLC system, consisting of two PrepStar 218 pumps and a ProStar 325 UV/VIS detector set at 260 nm. A reverse phase HPLC column (PRP-1, C18, 7 mm, 3057 mm, Hamilton, Reno, NV) was eluted with a gradient of CH 3 CN (1% min -1 ) in 0.1 mol/L TEAB (pH 7.3) at a 2.5 mL min -1 flow rate.
Analytical RP-HPLC were performed using Kinetex ® 5 mm column 100 A (4.6 250 mm, Phenomenex) at 1 mL min -1 flow rate; buffer A, 0.05 mol/L triethylammonium bicarbonate (TEAB) buffer pH 7.3; buffer B, 40% CH 3 CN in 0.05 mol/L TEAB; a gradient 0 to 40% B over 30 min. The open column chromatographic purification was performed using Silica gel 60, 200-300 mesh. TLC silica gel 60 plates with a UV F254 indicator, were used for routine analyses 39 (link) . Silica gel chromatography media were purchased from Merck.
Pawlowska R., Radzikowska-Cieciura E., Jafari S., Fastyn J., Korkus E., Gendaszewska-Darmach E., Zhao G., Snaar-Jagalska E, & Chworos A. (2024). Double-modified, thio and methylene ATP analogue facilitates wound healing in vitro and in vivo. Scientific reports, 14(1).
Publication 2024
4
Enzymatic Assays for ATP Analogs
All the reagents used in this study were of a reagent grade. The reagents are ATP disodium (Cytiva, USA), Adenosine 5′-O-(3-Thiotriphosphate), Tetralithium Salt (ATPγS) (Millipore Sigma, USA), ATP, [γ-32P] 6000 Ci/mmol 10 mCi/ml EasyTide, 250 μCi (PerkinElmer, USA), Phosphoenol-pyruvate, Proteinase K (Roche, USA), Ni-NTA Magnetic Agarose Beads (QIAGEN, USA), and Bio-Spin® Columns, Bio-Gel® P-30 (BIO-RAD). The ampicillin sodium salt, chloramphenicol, streptomycin dihydrochloride pentahydrate, kanamycin sulfate, l-lactic dehydrogenase and pyruvate kinase were purchased from the Sigma-Aldrich company. The USB® Shrimp alkaline phosphatase was purchased from Affymetrix. Enzymes such as T4 Polynucleotide Kinase (T4 PNK), Klenow Fragment (3′ – 5′, exo−), EcoRI-HF, NcoI, NdeI, SexAI and XbaI were purchased from New England Biolabs (NEB, Ipswich, MA). Buffers were made from reagent grade chemicals with Milli-Q water. ATP (Cytiva, USA) and ATPγS (Millipore Sigma, USA) stocks were adjusted to pH 7.5, and concentration was determined spectrophotometrically using ϵ260 = 1.54 × 104 M−1 cm−1.
The plasmids pBR322, pBR322-3F3H (21 (link)), pPB520 (22 (link)), pMS421(23 (link)), pPB800 (22 (link)), pET15b-30 (24 (link)) and pGL10 (25 (link)) were isolated and purified using the QIAprep miniprep kit (Qiagen, USA). The pKD46 and pKD3 plasmids were obtained from the E. coli genetic stock center of Yale and Addgene respectively. The pPB800-TAAs and pGBnuc vectors were constructed as described below.
Pavankumar T.L., Wong C.J., Wong Y.K., Spies M, & Kowalczykowski S.C. (2024). Trans-complementation by the RecB nuclease domain of RecBCD enzyme reveals new insight into RecA loading upon χ recognition. Nucleic Acids Research, 52(5), 2578-2589.
Publication 2024
5
RIPK1 Kinase Assay Protocol
For RIPK1 in vitro kinase assays, purified EEF1AKMT3WT or EEF1AKMT3S26A were subjected to kinase reaction and alkylation system (51 (link), 52 (link)): 1 mM adenosine 5′-O-(3-thiotriphosphate) (ATP-γ-S) and recombinant activated RIPK1 were added into the reaction. The mixtures were incubated for 30 min at 30°C and then supplemented with 2.5 mM p-Nitrobenzyl mesylate (PNBM) [5% dimethyl sulfoxide (DMSO)], briefly vortexed, and alkylated for 1 hour at room temperature. The reactions were then stopped with SDS sample buffer and resolved by SDS-PAGE. Phosphorylation by RIPK1 was detected by anti–thiophosphate ester antibody (Abcam, ab92570).
Lu Y., Leng Y., Li Y., Wang J., Wang W., Wang R., Liu Y., Tan Q., Yang W., Jiang Y., Cai J., Yuan H., Weng L, & Xu Q. (2023). Endothelial RIPK1 protects artery bypass graft against arteriosclerosis by regulating SMC growth. Science Advances, 9(35), eadh8939.
Publication 2023
adenosine 5'-O-(3-thiotriphosphate) Alkylation Antibodies, Anti-Idiotypic Biological Assay Buffers Esters Mesylates Phosphorylation Phosphotransferases RIPK1 protein, human SDS-PAGE Sulfoxide, Dimethyl thiophosphate

Top products related to «Adenosine 5'-O-(3-thiotriphosphate)»

1
Adenosine triphosphate (atp) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Sao Tome and Principe, Italy, Japan, Macao, Spain, Canada, France, Switzerland, Ireland, Sweden, Australia
ATP is a laboratory instrument used to measure the presence and concentration of adenosine triphosphate (ATP) in various samples. ATP is a key molecule involved in energy transfer within living cells. The ATP product provides a reliable and accurate method for quantifying ATP levels, which is useful in applications such as microbial detection, cell viability assessment, and ATP-based assays.
2
Adenosine deaminase by Merck Group
Sourced in United States, Canada
Adenosine deaminase is an enzyme that catalyzes the deamination of adenosine to inosine. It is involved in the purine nucleoside metabolism pathway. The enzyme plays a crucial role in regulating the levels of adenosine, which is an important signaling molecule in the body.
3
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
4
3 deoxyguanosine 5 triphosphate by TriLink
3'-Deoxyguanosine-5'-Triphosphate is a nucleoside triphosphate analogue used in biochemical and molecular biology applications. It serves as a substrate for DNA polymerase enzymes.
5
Set of 4 on targetplus pde12 sirna lq 017946 01 0002 by Horizon Discovery
The Set of 4: ON-TARGETplus PDE12 siRNA (LQ-017946-01-0002) is a collection of small interfering RNA (siRNA) molecules designed to target the PDE12 gene. The core function of this product is to facilitate the knockdown of PDE12 expression in cells, which can be used for research purposes.
6
Set of 4 on targetplus enpp1 sirna lq 003809 by Horizon Discovery
The ON-TARGETplus ENPP1 siRNA (LQ-003809) is a set of four small interfering RNA (siRNA) designed to specifically target the ENPP1 gene. The core function of this product is to facilitate the knockdown of ENPP1 expression in cell-based studies.
7
Anti pde12 antibody ab87738 by Abcam
The Anti-PDE12 antibody (ab87738) is a protein detection reagent that can be used to identify the presence and abundance of the PDE12 enzyme in biological samples. PDE12 is an enzyme involved in the regulation of cellular processes. This antibody can be used in various immunoassay techniques to study PDE12 expression and distribution.
8
Hsv 60 lyovec by InvivoGen
HSV-60/LyoVec™ is a transfection reagent formulation. It is designed for the efficient delivery of nucleic acids, such as plasmids or oligonucleotides, into mammalian cells.
9
Recombinant enpp1 by R&D Systems
Recombinant ENPP1 is a laboratory product produced by R&D Systems. It is a recombinant form of the human ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) protein. ENPP1 is an enzyme involved in the hydrolysis of nucleotide phosphates.
10
Trpsin by Merck Group
Trypsin is a serine protease enzyme that is commonly used in cell biology and biochemistry laboratories. Its primary function is to cleave peptide bonds in proteins, which is essential for various applications such as cell dissociation, protein purification, and cell culture maintenance.

More about "Adenosine 5'-O-(3-thiotriphosphate)"

Adenosine 5'-O-(3-thiotriphosphate), also known as ATPγS, is a synthetic analogue of adenosine triphosphate (ATP) where the oxygen atom in the terminal phosphate group is replaced by a sulfur atom.
This modification makes the compound more resistant to hydrolysis by ATPases, allowing it to act as a stable ATP mimetic.
ATPγS is widely utilized in biochemical and cell biology research to study the role of ATP-dependent processes, such as protein phosphorylation, enzyme activation, and signal transduction.
Its ability to be incorporated into cellular systems while resisting degradation makes it a valuable tool for investigating the dynamics of ATP-mediated regulation.
ATPγS shares similarities with other nucleotide triphosphates like 3'-Deoxyguanosine-5'-Triphosphate (3'dGTP), which is also used in research to study nucleotide-dependent processes.
Adenosine deaminase, an enzyme that catalyzes the deamination of adenosine, is another related compound that is often studied alongside ATPγS.
Bovine serum albumin (BSA) is a common reagent used in experiments involving ATPγS to stabilize proteins and prevent non-specific interactions.
The use of ATPγS can be further optimized by leveraging the power of AI-driven comparisons, as provided by platforms like PubCompare.ai.
These tools can help researchers locate the best protocols from literature, preprints, and patents, ultimately improving the reproducibility and accuracy of their experiments.
By incorporating data-driven decision-making, researchers can experience the benefits of ATPγS research while enhancing the overall quality and efficiency of their work.
In addition to its use in biochemical and cell biology research, ATPγS has also been explored in the development of antiviral agents, such as the HSV-60/LyoVec™ compound, which contains ATPγS and is used to stimulate innate immune responses.
The recombinant enzyme ENPP1, which hydrolyzes ATPγS, has also been studied in the context of various diseases and signaling pathways.
Overall, Adenosine 5'-O-(3-thiotriphosphate) is a versatile and important tool in modern biological research, with a wide range of applications and a growing body of supporting evidence.
By leveraging the insights provided by AI-powered platforms, researchers can optimize their ATPγS-based experiments and advance their understanding of ATP-mediated processes in a more efficient and effective manner.