Nucleic Acid Probes

In situ hybridization was performed using specific probes to circHIPK3 sequence. PCR fragments with T7 promoter were amplified with specific primers for the back-splice region of circHIPK3. Primers are listed in Supplementary Table 3. Digoxin or Biotin-labelled RNA probes were transcribed from PCR fragments using the DIG or Biotin RNA labelling mix and T7 RNA polymerase (Roche) according to the manufacturers' instructions. HeLa cells were grown to the exponential phase and were 80–95% confluent at the time of fixation. After pre-hybridization (1 × PBS/0.5% Triton X-100), cells were hybridized in hybridization buffer (40% formamide, 10% Dextran sulfate, 1 × Denhardt's solution, 4 × SSC, 10 mM DDT, 1 mg ml⁻¹ yeast transfer RNA, 1 mg ml⁻¹ sheared salmon sperm DNA) with DIG-labelled probes specific to circHIPK3 at 60 °C overnight. Signals were detected using tyramide-conjugated Alexa 488 fluorochrome TSA kit (Life Technologies). The double FISH assay was performed in HeLa cells after co-transfection with circHIPK3 and miR-124 expressing vectors. Biotin-labelled probes specific to circHIPK3 and Dig-labelled locked nucleic acid miR-124 probes (Exiqon, Vedbaek, Denmark) were used in the hybridization. The signals of biotin-labelled probes were detected using Cy5-Streptavidin (Life Technologies). The signals of Dig-labelled locked nucleic acid miR-124 probes were detected using tyramide-conjugated Alexa 488 fluorochrome TSA kit. Nuclei were counterstained with 4,6-diamidino-2-phenylindole. The images were acquired on a Leica SP5 confocal microscope (Leica Micosystems, Mannheim, Germany).

The Custom LNA™ LncRNA ISH Detection Probes & Kits (QIAGEN, German) was used with a double digoxin-labeled nucleic acid strand probe (human lncRNA DLX6-AS1: 5DigN/TTGCCTGTTCCATATCAATT/3DigN; mouse lncRNA Dlx6-os1: 5DigN/TGTTAAGTGAGACAGGCATTCA/3Dig_N), according to the manufacturer’s instructions.

The analyte siRNA-01, the antisense strand of siRNA-01 (AS1, a 21-mer oligonucleotide), the analogue internal standard (IS) ASO-002, and 3′ n-1 truncated metabolite of AS1 were proprietary compounds obtained from Biogen (Cambridge, MA, USA) and its collaborator (see Table 5 for the basic compound information). The biotinylated DNA capture probe (5′-BiotinTEG-DNA, full sequence reverse-complementary to AS1) was synthesized by Integrated DNA Technologies (Coralville, IA, USA). The biotinylated peptide nucleic acid (PNA) capture probe (5′-Biotin-OO-PNA-KK, 19-mer reverse-complementary to AS1) was synthesized by PNA Bio (Newbury Park, CA, USA).
Acetonitrile (ACN), methanol (MeOH), N,N-dimethylcyclohexylamine (DMCHA), 1,1,1,3,3,3-hexafluoro-2-methyl-2-propanol (HFMIP), ethylenediaminetetraacetic acid (EDTA), 10 N sodium hydroxide (NaOH), tris(Hydroxymethyl)aminomethane (Tris), Tween 20, sodium chloride (NaCl), and DL-dithiothreitol (DTT) were obtained from MilliporeSigma (Burlington, MA, USA). Clarity OTX Lysis-Loading Buffer v 2.0 was purchased from Phenomenex (Torrance, CA, USA). Proteinase K, Dynabeads MyOne Streptavidin C1, and Blocker BSA in TBS (10×) Concentrate (100 mg/mL) were obtained from Thermo Fisher Scientific (Waltham, MA, USA). NONIDET P40 (NP-40) was purchased from Accurate Chemical & Scientific (Carle Place, NY, USA). LoBind Eppendorf 1 mL round bottom 96-well plates were obtained from Eppendorf (Enfield, CT, USA). Control rat plasma (K₂EDTA), monkey plasma (K₂EDTA), monkey CSF, and monkey tissues (liver, brain, kidney, heart, spleen, colon, lung, and spinal cord) were purchased from BioIVT (Westbury, NY, USA). Artificial CSF (aCSF) was purchased from Tocris Bioscience (Toronto, ON, Canada).
A Shimadzu Nexera X2 UHPLC system (Shimadzu, Columbia, MD, USA) equipped with three LC-30AD pumps was used for the LC separation. A Sciex TripleQuad 6500+ mass spectrometer (Sciex, Framingham, MA, USA) with Analyst software v 1.6.3 was used for the mass spectrometric detection. A KingFisher Flex Purification System (ThermoFisher Scientific, Waltham, MA, USA) was used for the hybridization sample preparation.