> Chemicals & Drugs > Indicator > SYBR Green II

SYTO 9 →

SYBR Green II

SYBR Green II is a fluorescent dye used in molecular biology and biochemistry for the detection and quantification of double-stranded DNA.
It binds to the minor groove of DNA, emitting a green fluorescent signal upon excitation.
SYBR Green II is widely employed in techniques like real-time PCR, DNA melting curve analysis, and DNA gel electrophoresis, offering a sensitive and inexpansive method for nucleic acid quantification.
Researchers can leverage the PubCompare.ai platform to optimize their SYBR Green II protocols, access the most effective procedures from literature, preprints, and patents, and utilize AI-powered comparisons to enhance reproducibility and accuracy in their experiments.
This technology-driven approach can help take SYBR Green II-based research to new heights.

Most cited protocols related to «SYBR Green II»

Validation of Bacterial Primer Specificity

Cited 20 times

All primer sets were tested for sensitivity, optimal annealing temperature and primer efficiency as previously described [18] (link), [19] (link). Briefly, high quality gDNA was was extracted using the GeneJET Genomic DNA Purification Kit (Fermentas Inc, Glen Burnie, MD, USA) with an additional bead-beating step to maximize lysis. DNA was quantified using both a Nanodrop 2000 (Nanodrop, Wilmington, DE, USA) and Qubit 2.0 Fluorometer (Life technologies, Grand Island, NY, USA).
Genome copies of DNA were calculated using the following formula:
Size of genome (in bp) × 650 Daltons/bp = molecular weight of Genome in g/mol.
# copies of genome in 1 ng of DNA = (1×10⁻⁹ g ÷ Mw of genome)×6.02×10²³ molecules/mole (Avogadro’s number).
To get 10⁸ copies in 2 µl = (10⁸ ÷ # copies of genome in 1 ng)/2.
Serial dilutions of DNA from 10⁸ to 10² copies were prepared and tested in duplicate with each primer set to calculate primer efficiency and sensitivity.
Primers were tested using two different instruments, the Roche Light Cycler 480 II (LC 480 II) with SYBR Green I Master Mix (Roche Applied Sciences, Indianapolis, IN), and the BioRad CFX96 with SsoAdvanced SYBR Green supermix (Bio-Rad Laboratories, Hercules, CA). Each primer was tested for specificity by two methods. First, the primers were tested against genomic DNA extracted from a panel of American Type Culture Collection strains (ATCC, Manassas, VA, USA) and clinical isolates representing fifty different bacterial species, including closely related members from the same genus (Table S5). Secondly, primers were tested against 200 clinical isolates of each species, identified to the species level using three automated identification systems; the Vitek 2 (bioMerieux, Durham, NC), the BD Pheonix (Diagnostics Systems, Sparks, MD), and the Microscan Walkway (Siemens Healthcare Diagnostics Inc, Deerfield, IL), selected from a large repository of isolates (>10,000 strains) collected between 2002 to 2012 from 23 different facilities in the United States of America, Europe, Asia and the Middle East. Pulsed-field gel electrophoresis (PFGE) indicated that the selected clinical isolates represented a variety of different pulse-types (unpublished results).

Clifford R.J., Milillo M., Prestwood J., Quintero R., Zurawski D.V., Kwak Y.I., Waterman P.E., Lesho E.P, & Mc Gann P. (2012). Detection of Bacterial 16S rRNA and Identification of Four Clinically Important Bacteria by Real-Time PCR. PLoS ONE, 7(11), e48558.

Full text: Click here

Publication 2012

Bacteria Diagnosis Electrophoresis, Gel, Pulsed-Field Genome Hypersensitivity Light Moles Oligonucleotide Primers Pulse Rate Strains SYBR Green I SYBR Green II Technique, Dilution

Quantitative RT-PCR for Gene Expression Analysis

Cited 16 times

An aliquot of 0.5 μg total RNA was treated with 1 unit DNAse (Fermentas, St. Leon-Rot, Germany) 30 min at 37°C. Reverse transcription of RNA (0.5 μg) was performed with oligo (dT)12–18 primer and 200 units of SUPERSCRIPT II (Invitrogen, Karlsruhe, Germany) and 24 units of Ribo LockTM RNAse inhibitor (Fermentas) for 1 h at 42°C. The cDNA was used for PCR analysis. All cDNA probes were analyzed for: ACTA1, (NM_001100), amplicon length 85 bp; MYOG, (NM_002479), amplicon length 113 bp; MYH3, (NM_002470), amplicon length 84 bp and the RG: ACTB (NM_001101), amplicon length 104 bp; B2M, (NM_004048), amplicon length 98 bp; GAPDH, (NM_002046), amplicon length 119 bp; cyclophilin A/PPIA, (NM_203430), amplicon length 121 bp; RPLPO, (NM_001002), amplicon length 170 bp; TBP, (NM_003194), amplicon length 132 bp. The QuantiTect/PrimerAssays were purchased from QIAGEN GmbH (Hilden, Germany). cDNAs were amplified with Brilliant^®II SYBR^®Green QRT-PCR Master Mix (Stratagene-Agilent Technologies, Waldbronn, Germany). The thermal profile consisted of 1 cycle at 50°C for 2 minutes followed by 1 cycle at 95°C (2 min), 45 cycles at 95°C (15 sec), 60°C (1 min). Amplification was performed using the Mx3005P™ QPCR System (Stratagene). For relative quantification, a standard curve was generated in every individual run. Shortly, total RNA was pooled from muscle biopsies of healthy human volunteers, reverse transcription was performed and a serial dilution of the cDNA was used to perform the calibration curve. The data were analyzed using the relative standard curve method. For each unknown sample, the relative amount is calculated using linear regression analysis from their respective standard curves. Data were analyzed using the Mx3005P analysis software (Stratagene-Agilent Technologies, Waldbronn, Germany). The efficiencies of all GOI and RG were calculated in every individual run (Table 1).

Stern-Straeter J., Bonaterra G.A., Hörmann K., Kinscherf R, & Goessler U.R. (2009). Identification of valid reference genes during the differentiation of human myoblasts. BMC Molecular Biology, 10, 66.

Full text: Click here

Publication 2009

Biopsy Cyclophilin A Deoxyribonuclease I DNA, Complementary Endoribonucleases GAPDH protein, human Healthy Volunteers Homo sapiens Muscle Tissue Oligonucleotide Primers Oligonucleotides Reverse Transcription SYBR Green II Technique, Dilution

One-Pot RNA Nanoring Assembly

Cited 6 times

RNA nanorings were assembled in one pot from various sets of RNA units at concentrations specified in the text. Typically, RNA unit transcripts were heated to 95°C for two minutes, snap cooled to 4°C on ice, and assembled at 30°C by addition of MgOAc₂ buffer to a final concentration (89 mM tris-borate (pH 8.3), 2 mM Mg(OAc)₂, 50 mM KCl, and 50 mM NaCl) and incubation for 30 minutes at 30°C. Native PAGE and TGGE experiments were performed as described 13 (link), 16 (link), 17 . Typically, assembly experiments reported were analyzed at 12°C on 7% (29:1) native polyacrylamide gels in presence of 89 mM Tris-borate, pH 8.3, 2 mM Mg(OAc)₂. A Typhoon phosphoimager was used to visualize ³²P labeled or SYBR® Green II stained RNA. For TGGE analysis, a linear temperature gradient applied perpendicular to the electric field was used. Total monomer RNA concentration was 200 nM for all assembly systems. The fluctuation of the temperature gradient during migration was generally less than 1 to 2°C.

Grabow W.W., Zakrevsky P., Afonin K.A., Chworos A., Shapiro B.A, & Jaeger L. (2011). Self-assembling RNA nanorings based on RNAI/II inverse kissing complexes. Nano letters, 11(2), 878-887.

Publication 2011

Borates Buffers Electricity Native Polyacrylamide Gel Electrophoresis polyacrylamide gels Sodium Chloride SYBR Green II Tromethamine Typhoons

Quantifying MBNL-1 Protein Binding Affinity

Cited 5 times

Recombinant MBNL-1 protein which is fused to a 25 amino acid sequence encoding the LacZα peptide was expressed and purified as previously described.(31 (link)) The MBNL-1 displacements assays were completed using a modified procedure based on reference 22 (link). The average amount of RNA immobilized in the well was determined using SYBR Green II (Invitrogen) and known concentrations of RNA. On average, when 2.5 pmoles of RNA were delivered to a well, 0.5 pmoles were immobilized. Please see the Supporting Information for detailed procedures for the MBNL-1 displacement assays and the determination of the number of moles of RNA immobilized.
The resulting data were then fit to a four parameter logistic curve to determine the IC₅₀’s when the percentage of MBNL-1 bound ranged from 0–100% using the following equation:

y = D + \frac{A - D}{1 + {(\frac{x}{I C_{50}})}^{Hill slope}}

where y is the percentage of MBNL-1 bound, x is the concentration of ligand, D is the minimum response plateau, and A is the maximum response plateau. A and D are typically 0% and 100%, respectively. Each IC₅₀ was the average of at least two measurements, and the error is the standard deviation in those measurements. The values for the multivalent effects were computed using the two equations below:

Normalized I C_{50} (N I C_{50}) = I C_{50} \times Number o f Displayed Modules

Multivalent Effect = \frac{I C_{50} FITC - 1}{N I C_{50}}

Lee M.M., Pushechnikov A, & Disney M.D. (2009). Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2. ACS chemical biology, 4(5), 345-355.

Publication 2009

Amino Acid Sequence Biological Assay Ligands Moles Peptides Recombinant Proteins SYBR Green II

Real-time ZIKV RdRp RNA Synthesis Assay

Cited 4 times

For the detection of RNA synthesis by ZIKV RdRp, we established a real-time assay based on the fluorescent dye SYTO 9, which binds dsRNA but not ssRNA template molecules. The fluorescence emitted was recorded in real-time using a Fluostar Optima fluorimeter (BMG Labtech) using excitation and emission filters at 485 and 520 nm, respectively. The assay records the synthesis of dsRNA in a reaction using a poly-U molecule as a template and ATP as the nucleotide substrate. This technique has been adapted from methods previously documented for the detection of DNA synthesis^{38 (link)}.
Reactions were performed in individual wells of black 96-well flat-bottom plates. The standard reaction contained 50 mM Tris-HCl, pH 7.5, 2.5 mM MnCl₂, 500 μM ATP, 20 μg/mL poly-U, 0.1 mg/mL BSA and 0.25 μM SYTO 9 (50 μM stock solution in TE buffer pH 7.5). The assay was initiated by the addition of 250 nM ZIKV RdRp and the fluorescence was recorded over 30 min at 30 °C.
Variations on this assay, for example, different concentrations of reagents and/or the presence of additional compounds, are specifically indicated in each corresponding section. For graphical representation, background fluorescence obtained at time point 0 was subtracted from each value.
To determine K_m and V_max constants for ZIKV RdRp binding to poly-U ssRNA, standard reactions were carried out in increasing concentrations of the template (0.5–50 μg/mL) in the presence of ATP at 500 μM. The kinetic parameters for ATP were obtained from assays in the presence of increasing concentrations of this nucleotide (200–2250 μM) and using 3 μg/mL of poly-U.
IC₅₀ values were obtained from standard reactions carried out in the presence of 3 μg/mL poly-U and 1500 μM ATP, and increasing concentrations of each inhibitor.
End-point fluorometric reactions were performed in black 96-well black-flat bottom plates at 30 °C in the presence of the same reagents as described above, but in the absence of dye. The reactions were quenched at 60 min by adding in 25 mM EDTA to the samples. Either SYTO9 or SYBR Green II dye was then added to the sample (0.25 μM or 1x, respectively) and the mix reaction was incubated at room temperature for 5 min to allow the stabilization of RNA-dye complexes and fluorescence emission. To determine background fluorescence levels, a negative control was assayed in parallel, where the reaction was quenched before adding ZIKV RdRp. The quenched control reaction was incubated for 1 h at 30 °C, and then 0.25 μM SYTO9 or 1 × SYBR Green II, respectively, was added to the sample and fluorescence recorded as described above.

Sáez-Álvarez Y., Arias A., del Águila C, & Agudo R. (2019). Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs. Scientific Reports, 9, 5397.

Full text: Click here

Publication 2019

Anabolism Buffers Edetic Acid Fluorescence Fluorescent Dyes Fluorometry Kinetics manganese chloride Nucleotides Poly A-U Poly U RNA, Double-Stranded SYBR Green II SYTO 9 Tromethamine Zika Virus

Most recents protocols related to «SYBR Green II»

GAS6-AS1 Expression Quantification

Complementary DNA was generated using 1 μg of extracted RNA and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). The PCR analysis was conducted with the SYBR Green II mix (Applied Biosystem, Foster City, USA) and the ABI 7500Fast real-time PCR. The primer sequences were: GAS6-AS1, forward 5′-ATGCAAGGACGGAACCACACCT-3′, reverse 5′-GCAGAGGTTTCTGTCTCCATCG-3′; GAPDH forward 5'- TGAAGGTCGGAGTCAACGGATTTGGT-3', reverse 5'-CATGTGGGCCATGAGGTCCACCAC-3'. The expression level was calculated with the 2^−ΔΔCt method normalized to GAPDH.

Wang Z., Zhang M, & Fu Y. (2023). Downregulated Circulating Long Non-coding RNA GAS6-AS1 Screens and Predicts Acute Myocardial Infarction. Anatolian Journal of Cardiology, 27(3), 167-172.

Publication 2023

Anabolism DNA, Complementary GAPDH protein, human Oligonucleotide Primers Real-Time Polymerase Chain Reaction SYBR Green II

RNA Resistance Assay with RNase R

2.5 μg of in vitro-transcribed RNAs (Circular EGFP ΔpAΔIRES) were incubated at 37°C with 10 U of RNase R (Cosmo Bio) in a 10 μl mixture. After a 45 min incubation, the mixture was subjected to 4 and 8% denaturing PAGE (8.3 M urea), and then stained by SYBR Green II Nucleic Acid Gel Stain (TaKaRa). Stained RNA was detected by Typhoon FLA-7000 (GE Healthcare).

Kameda S., Ohno H, & Saito H. (2023). Synthetic circular RNA switches and circuits that control protein expression in mammalian cells. Nucleic Acids Research, 51(4), e24.

Full text: Click here

Publication 2023

Nucleic Acids ribonuclease U SYBR Green II Typhoons Urea

Thermostability of 146S Virus Capsids

The thermostability of 146S in solution and encapsulated in ZIF-8 was measured by differential scanning fluorescence (DSF) analysis according to our published method.^{41 (link)} Briefly, 18 μL solution containing 146S was mixed with 2 μL 1 : 100-fold diluted SYBR Green II (Solarbio, China). The experiments were performed using a real-time PCR instrument (Applied Biosystem, USA) at a scan rate of 1 °C min⁻¹ from 25 °C to 95 °C. The T_m value corresponding to the dissociation of 146S to 12S was calculated according to the maximum of the first derivative [d(RFU)/dT] plot of the fluorescence curve.

Wang L., Lin X., Sheng Y., Zhu H., Li Z., Su Z., Yu R, & Zhang S. (2023). Synthesis of a crystalline zeolitic imidazole framework-8 nano-coating on single environment-sensitive viral particles for enhanced immune responses. Nanoscale Advances, 5(5), 1433-1449.

Publication 2023

Fluorescence Radionuclide Imaging Real-Time Polymerase Chain Reaction SYBR Green II

Synthesis and Characterization of Zinc-based Nanoparticles

2-methylimidazole (98%) was purchased from Energy Chemical Co., Ltd (Shanghai, China). ZnCl₂ was purchased from Macklin Biochemical Co., Ltd (Shanghai, China). Cetyltrimethylammonium bromide (CTAB) was purchased from Aladdin Biochemical Technology Co., Ltd (Shanghai, China). Sodium ethylene diamine tetraacetic acid (EDTA-Na₂) was purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). Nucleic acid dye SYBR GREEN II, 4% tissue fix solution, and DAPI dye were purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). The Formvar support film was purchased from Zhongjingkeyi Film Technology Co., Ltd. (Beijing, China). The cell Counting Kit-8 (CCK-8) kit was purchased from LABLEAD. Inc (Beijing, China). 3′,6′-Dihydroxy-5-isothiocyanato-3H-spiro[isobenzofuran-1,9′-xanthen]-3-one (FITC), PRIM-1640, 0.25% trypsin–EDTA (1×), PBS (1×), penicillin–streptomycin solution and LysoTracker™ Red DND-99 lysosomal probe were purchased from Thermo Fisher Scientific (Massachusetts, USA). Dendritic cells 2.4 were saved by our laboratory. All other reagents were all analytical grade and used without further treatment. Unless otherwise specified, deionized water for injection was used for solution preparation.

Publication 2023

2-methylimidazole Cetrimonium Bromide DAPI Dendritic Cells Edetic Acid Fluorescein-5-isothiocyanate Formvar Lysosomes LysoTracker Nucleic Acids Penicillins Red DND-99 Sodium Streptomycin SYBR Green II Tissues Trypsin

Evaluating SsMRT4 Expression in Mycelia

To evaluate the SsMRT4 expression levels during mycelia development, wild-type strains were cultured on cellophane over PDA, and hyphae were harvested at 1 and 2 days post inoculation (dpi) (hyphae), 3 and 4 dpi (initial sclerotia), 5~7 dpi (developing sclerotia), and 15 dpi (mature sclerotia). Primers of SsMRT4 and β-tub-ulin used for qPCR were: SsMRT4qF (CCTCCATCATCACCTACTTCC)/SsMRT4 qR: (GGTTCCAAACTAT GTGCCATT) and SsTubqF (ACCTCCATCCAAGAACTC)/SsTubqR (GAACTCCAT CTCGTCCAT). β-tubulin was used as an internal reference. The program setting included holding stage (95 °C, 2 min), cycling stage (95 °C, 20 s; 55 °C, 20 s; 72 °C, 20 s; 40 cycles), and melt curve stage (95 °C, 15 s; 60 °C, 1 min). Quantitative expression assays were performed using SYBR^® Green Premix Pro Taq HS qPCR Kit II (Accurate Biology) with StepOneTM Real-time PCR Instrument Thermal Cycling Block. The transcript level of the gene of interest was calculated from the threshold cycle using the 2^-ΔΔCT method [37 (link)] with three replicates, and data were analyzed using SPSS Statistics v.24.0.

Yang C., Tang L., Qin L., Zhong W., Tang X., Gong X., Xie W., Li Y, & Xia S. (2023). mRNA Turnover Protein 4 Is Vital for Fungal Pathogenicity and Response to Oxidative Stress in Sclerotinia sclerotiorum. Pathogens, 12(2), 281.

Full text: Click here

Publication 2023

Biological Assay Cardiac Arrest Cellophane Genes Hyphae Mycelium Oligonucleotide Primers Real-Time Polymerase Chain Reaction Strains SYBR Green II Tubulin Vaccination

Top products related to «SYBR Green II»

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Sybr green premix ex taq 2 by Takara Bio

Sourced in China, Japan, United States

SYBR Green Premix Ex Taq II is a ready-to-use solution for real-time PCR. It contains SYBR Green I dye, Taq DNA polymerase, dNTPs, and buffer components.

Sybr green 2 by Thermo Fisher Scientific

Sourced in United States

SYBR Green II is a fluorescent dye used in molecular biology applications. It binds to double-stranded DNA and emits a fluorescent signal upon binding, allowing for the detection and quantification of DNA. SYBR Green II is commonly used in real-time PCR and other DNA-based assays.

Primescript rt reagent kit by Takara Bio

Sourced in Japan, China, United States, France, Germany, Switzerland, Canada, Sweden, Puerto Rico, Singapore

The PrimeScript RT reagent kit is a reverse transcription kit designed for the synthesis of first-strand cDNA from RNA templates. The kit includes RNase-free reagents and enzymes necessary for the reverse transcription process.

Sybr green 2 by Takara Bio

Sourced in Japan, China, United States

SYBR Green II is a fluorescent dye that binds to double-stranded DNA. It can be used for nucleic acid quantification and detection in various molecular biology applications, including real-time PCR and DNA gel electrophoresis.

Trizol by Thermo Fisher Scientific

Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Spain, Australia, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines

TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

Brilliant 2 sybr green qpcr master mix by Agilent Technologies

Sourced in United States, Germany, Canada

Brilliant II SYBR Green QPCR Master Mix is a ready-to-use solution for quantitative PCR (qPCR) analysis. It contains SYBR Green I dye, enabling real-time detection of DNA amplification.

Primescript rt reagent kit with gdna eraser by Takara Bio

Sourced in Japan, China, United States, Germany, France, Switzerland, Puerto Rico

The PrimeScript™ RT reagent Kit with gDNA Eraser is a reverse transcription kit. It includes a gDNA Eraser component to remove genomic DNA from RNA samples prior to reverse transcription.

Lightcycler 480 2 by Roche

Sourced in Switzerland, Germany, United States, China, Japan, United Kingdom, France, Czechia, Canada, Sweden, Belgium, Poland, Portugal, Spain, Netherlands, Denmark

The LightCycler 480 II is a real-time PCR instrument designed for high-throughput nucleic acid quantification and analysis. It features a 96-well format and supports a wide range of applications, including gene expression analysis, genotyping, and DNA methylation studies.

Rneasy mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway

The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

What are some common applications of SYBR Green II?

SYBR Green II is a versatile fluorescent dye used in a variety of molecular biology and biochemistry techniques. It is widely employed in real-time PCR for the detection and quantification of double-stranded DNA, DNA melting curve analysis to study DNA structure and stability, and DNA gel electrophoresis for visualizing and quantifying nucleic acids. SYBR Green II offers a sensitive and cost-effective method for nucleic acid analysis compared to other fluorescent dyes.

How can SYBR Green II-based experiments be optimized?

Optimizing SYBR Green II-based experiments can be challenging, as factors like dye concentration, reaction conditions, and sample preparation can impact the accuracy and reproducibility of your results. This is where PubCompare.ai can be incredibly helpful. The platform allows you to efficiently screen protocol literature, leveraging AI to pinpoint critical insights that can help you identify the most effective SYBR Green II protocols for your specific research goals. The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option to enhance reproducibility and accuracy in your experiments.

Are there different variations or types of SYBR Green II dye?

Yes, there are several variations and types of SYBR Green II dye available. While the core dye structure remains the same, manufacturers may offer different formulations or versions optimized for specific applications. For example, some SYBR Green II variants may have improved sensitivity, stability, or compatibility with certain instrumentation or workflows. Researchers should carefully evaluate the specific characteristics of each SYBR Green II product to ensure it aligns with the requirements of their experiments and provides the best possible performance.

How can PubCompare.ai help researchers working with SYBR Green II?

PubCompare.ai is an invaluable tool for researchers using SYBR Green II in their experiments. The platform allows you to efficiently screen protocol literature and leverage AI to pinpoint critical insights that can help you identify the most effective SYBR Green II protocols. By utilizing the platform's AI-driven analysis, you can compare the effectiveness of different SYBR Green II protocols and choose the best option to enhance the reproducibility and accuracy of your research. This technology-driven approach can help take your SYBR Green II-based experiments to new heights of success.

What are some common challenges in using SYBR Green II?

One of the main challenges in using SYBR Green II is ensuring optimal performance and reproducibility. The dye concentration, reaction conditions, and sample preparation can all impact the accuracy of your results. Additionally, SYBR Green II is a non-specific dye that binds to any double-stranded DNA, which can lead to the detection of non-target sequences or background signals. Researchers must carefully optimize their SYBR Green II protocols to minimize these issues and ensure reliable, high-quality data. Fortunatley, the PubCompare.ai platform can assist in this process by helping you identify the most effective SYBR Green II protocols from the literature, preprints, and patents.

More about "SYBR Green II"

SYBR Green II is a popular fluorescent dye used extensively in molecular biology and biochemistry for the detection and quantification of double-stranded DNA.
This versatile dye binds to the minor groove of DNA, emitting a bright green fluorescent signal upon excitation.
SYBR Green II is widely employed in a variety of techniques, including real-time PCR, DNA melting curve analysis, and DNA gel electrophoresis, offering a sensitive and cost-effective method for nucleic acid quantification.
Researchers can leverage the PubCompare.ai platform to optimize their SYBR Green II protocols, accessing the most effective procedures from published literature, preprints, and patents.
By utilizing AI-powered comparisons, scientists can enhance the reproducibility and accuracy of their SYBR Green II-based experiments, taking their research to new heights.
In addition to SYBR Green II, researchers may also find the TRIzol reagent, SYBR Green Premix Ex Taq II, PrimeScript RT reagent kit, Brilliant II SYBR Green QPCR Master Mix, and PrimeScript™ RT reagent Kit with gDNA Eraser to be useful tools in their molecular biology workflows.
The LightCycler 480 II and RNeasy Mini Kit are also valuable resources for quantitative PCR and RNA extraction, respectively.
By incorporating these related techniques and products, researchers can optimize their SYBR Green II protocols, improve experimental outcomes, and drive their research forward with greater efficiency and precision.