Ammonium Hydroxide

From blood and skin biopsies from the Connecticut site, DNA was extracted using the Qiagen DNeasy Tissue Kit (Qiagen, Valencia, CA) as described. 27 (link) For ticks collected at the Connecticut site, DNA was extracted from individual nymphal I. scapularis following Beati and Keirans for the 2002 collection. 28 (link) For ticks collected at several locations in 2004–2007 collections, total DNA was extracted using ammonium hydroxide (NH₄OH). For this procedure, ticks were incubated for 2 h in 5 μL of 1.4 mol/L NH₄OH at 22°C and crushed with a plastic pipette tip. To this was added 95 μL distilled H₂O before a second incubation at 95°C for 30 minutes. Material was centrifuged to separate tick debris from DNA solution, and the supernatant was transferred to clean vials containing 1 μL of 100 mmol/L EDTA and stored at −20°C.
In addition to the DNA extracts from blood, tissue, and ticks described above, two other sets of DNA samples, which were extracted from ticks by the method of Beati and Keirans, 28 (link) were available for examination: (1) flat nymphs that were derived from engorged larvae removed from captured mammals at the Connecticut field site, as described by Hanincova and others, 29 (link) and (2) flat larvae and nymphs of laboratory-reared P. leucopus, which were infected with B. miyamotoi, as described. 12 (link)
DNA extracts were subjected to quantitative multiplex real-time PCR (qPCR), as described, 15 (link),16 (link),30 (link) with two probes hybridizing to a region of the 16S rDNA that differed between B. burgdorferi and B. miyamotoi. Results were expressed as the number of spirochete cells per tick or volume of blood or tissue. Forward and reverse primers were, respectively, 5′GCTGTAAACGATGCACACTTGGT and 5′GGCGGCACACTTAACACGTTAG. The corresponding dye-labeled probes were 6FAM-TTCGGTACTA ACTTTTAGTTAA and VIC-CGGTACTAACCTTTCGAT TA with 3′ ends modified with a minor groove binding protein (Applied Biosystems, Foster City, CA). The reaction was performed in 25-μL volume in single tubes or wells at a final concentration of 900 nmol/L for each primer and 200 nmol/L for each probe. 15 (link) The final concentration of EDTA was < 0.1 mmol/L. The PCR conditions were 50°C for 2 minutes and 95°C for 10 minutes, followed by 45 cycles of 95°C for 15 seconds and 63°C for 60 seconds on an Applied Biosystems 7300 Real-Time PCR apparatus for the 2002 and 2004 samples and a Rotor-Gene RG-3000 apparatus (Corbett Research, San Francisco, CA) for the 2005–2007 samples. The DNA extractions, PCR reaction preparations, and analysis of the products were carried out in three separated laboratory rooms. To monitor for contamination, negative controls were included with all DNA extraction and PCR procedures.
DNA standards were the same for each experiment: strain B31 (ATCC 35210) for B. burgdorferi and strain HS1 (ATCC 35209) of B. hermsii for the uncultivable B. miyamotoi.15 (link) B. hermsii and B. miyamotoi have identical sequences for the regions of the primers and probe. Borrelia species cells were grown in BSK II medium at 34°C and harvested as described. 31 (link) With DNA standards, the qPCR assays with each probe set was linear with a R² ≥ 0.99 over a range of 1–10⁶ spirochetes per reaction. The linear regression coefficients (95% confidence intervals [CIs]) for C_t values on log-transformed cell counts were −3.31 (−3.40 to −3.28) for B. burgdorferi and −3.40 (−3.52 to −3.28) for the B. hermsii surrogate (P > 0.05). Samples with estimated spirochete counts of less than one per tick or biopsy specimen were considered negative.
The identities of the Borrelia species in 100 random samples scored by qPCR as B. burgdorferi were confirmed by PCR of the 16S–23S intergenic spacer region (IGR) with species-specific primers. 8 (link),15 (link),32 (link) Random samples scored as B. miyamotoi or B. burgdorferi by qPCR were confirmed by direct sequencing of the IGR on a CEQ 8000 capillary sequencer (Beckman Coulter, Fullerton, CA).

Metabolites were extracted from serum samples (thawed on ice) by adding 65 μl 80:20 methanol:water solution at −80 °C to 5 μl of serum sample, followed by vortexing for 10 s, incubation at 4 °C for 10 min, and centrifugation at 4 °C and 16,000g· for 10 min. To extract metabolites from tissue samples, frozen tissue samples were first weighed (~20 mg each sample) and ground using a Cryomill (Retsch). The resulting powder was then mixed with −20 °C 40:40:20 methanol:acetonitrile:water solution, followed by vortexing for 10 s, incubation at 4 °C for 10 min, and centrifugation at 4 °C and 16,000g for 10 min. The volume of the extraction solution (in μl) was 40 × the weight of tissue (in mg). The supernatant was transferred to LC–MS autosampler vials for analysis.
Serum and tissue extracts were analysed using LC–MS. In brief, a quadrupoleorbitrap mass spectrometer (Q Exactive Plus, Thermo Fisher Scientific) operating in negative ion mode was coupled to hydrophilic interaction chromatography via electrospray ionization and used to scan from m/z 73 to 1,000 at 1 Hz and 140,000 resolution. LC separation was achieved on a XBridge BEH Amide column (2.1 mm × 150 mm, 2.5 μm particle size, 130 Å pore size; Waters) using a gradient of solvent A (20 mM ammonium acetate + 20mM ammonium hydroxide in 95:5 water:acetonitrile, pH 9.45) and solvent B (acetonitrile). Flow rate was 150 μl min⁻¹. The gradient was: 0 min, 85% B; 2 min, 85% B; 3 min, 80% B; 5 min, 80% B; 6 min, 75% B; 7 min, 75% B; 8 min, 70% B; 9 min, 70% B; 10 min, 50% B; 12 min, 50% B; 13 min, 25% B; 16 min, 25% B; 18 min, 0% B; 23 min, 0% B; 24 min, 85% B; 30 min, 85% B. Data were analysed using the MAVEN software^{35 (link)}. Isotope labelling was corrected for natural abundances of ¹³C, ²H, and ¹⁵N. Circulating glycerol labelling was determined by first converting serum glycerol to glycerol-3-phosphate using glycerol kinase and then measuring the labelling of glycerol-3-phosphate with LC–MS.
For acetate, circulating metabolite labelling was determined by GC–MS using a 7890A GC system coupled to a 5975 MSD mass spectrometer (Agilent) after derivatization with 2,3,4,5,6-pentafluorobenzyl bromide as described^{36 (link)}. GC separation was achieved using an Agilent J&W 122-7033 column (30 m × 0.25 mm × 0.5 μm). The GC temperature program was: 0 min, 35 °C; 6 min, 35 °C; 12 min, 220 °C; 17 min, 220 °C, followed by returning to 35 °C for the next injection. Other GC parameters were: injection volume 1 μl; He as carrier gas at a flow rate of 1.2 ml min⁻¹; inlet temperature 250 °C; transfer line temperature 280 °C. Mass spectrometry detection was in electron impact ionization mode, with SIM scans of m/z 240.3 and 242.3 for unlabelled and ¹³C₂-acetate, respectively.
Free fatty acids in serum samples (thawed on ice) were extracted by adding 200 μl ethyl acetate at room temperature to 10 μl serum samples, followed by vortexing for 10 s, incubation at 4 °C for 10 min, and centrifugation at 16,000g for 10 min. The top layer of approximately 190 μl was transferred to a new glass vial before being dried under nitrogen gas flow. The dried extract was dissolved in 100 μl 1:1 isopopanol: methanol before being loaded onto the LC–MS. MS analysis was conducted on an Exactive orbitrap mass spectrometer (Thermo Fisher Scientific) scanning at 1 Hz and 100,000 resolution operating in negative ion mode. LC separation was on reversed-phase ion-pairing chromatography on a Luna C8 column (150 × 2.0 mm, 3 μm particle size, 100 Å pore size; Phenomenex) with a gradient of solvent A (10 mM tributylamine + 15 mM acetic acid in 97:3 water:methanol, pH 4.5) and solvent B (methanol). Flow rate was 250 μl min⁻¹. The gradient was: 0 min, 80% B; 10 min, 90% B; 11 min, 99% B; 25 min, 99% B; 26 min, 80% B; 30 min, 80% B.