Calcium hypochlorite

“Slow killing” P. aeruginosa infection assays were performed as previously described (Tan et al. 1999 (link)). A single colony of P. aeruginosaPA14 was inoculated into 3 ml of Luria-Bertani (LB) medium, and allowed to incubate at 37° for 14–15 hr; 10 μl of this culture was added to 35-mm tissue culture plates containing 4 ml of slow kill agar (0.35% peptone, 0.3% sodium chloride, 1.7% agar, 5 μg/ml cholesterol, 25 mM potassium phosphate, 1 mM magnesium sulfate, 1 mM calcium chloride). Plates were incubated for 24 hr at 37°, and 24 hr at 25°. At 1–2 hr before the start of the assay, 0.1 mg/ml 5-fluorodeoxyuridine (FUDR) was added to the medium to prevent progeny from hatching. A total of 40–50 animals at the young L4 larval stage were picked to each of three or four assay plates per experimental condition. C. elegans was prepared for the pathogenesis assays in the manner described above for the nanoString experiment to ensure that stage-matched nematodes were used for these experiments. Animals were scored as live or dead on a daily basis by gently touching them with a platinum wire. Worms that crawled onto the wall of the tissue culture plate were eliminated from the analysis. P. aeruginosa killing assays were conducted at 25°.
The development assay presented in Figure 1 was conducted by placing approximately 100 hypochlorite-synchronized L1 larval stage animals of the indicated genotype on “slow kill” medium plates (Tan et al. 1999 (link)) containing 140 μM R24 or the solvent control DMSO (1%), and monitoring development to the young adult stage for 3 d at 20° on two replicate plates per condition. For the development assays conducted with RNAi bacteria (Figure 4B), two L4 larval stage animals of the indicated genotype were allowed to lay their brood on RNAi bacteria at 15°. Plates were then transferred to 20° for 3 d. The stage of approximately 300 animals on each of three replicate plates per condition was recorded, and the percentage of animals at the L4 larval stage was reported. Representative animals from each condition in this experiment were photographed. For the experiments with the xbp-1(zc12) mutant (Figure S4), four animals were allowed to lay their brood for 8 hr at 20° in the presence or absence of 70 μM R24. C. elegans carrying the zcIs4 transgene was used as the control for these experiments.

Synthesis and Characterization of Glutathione‐Protected Au Clusters: Glutathione‐protected Au clusters were fabricated according to the previously reported method with modification.29 Freshly prepared aqueous solutions of glutathione (GSH = γ‐Glu‐Cys‐Gly) (Sigma‐Aldrich, USA) (30 × 10⁻³m, 100 mL) and hydrogen tetrachloroaurate trihydrate (HAuCl₄·3H₂O) (Sigma‐Aldrich, USA) (20 × 10⁻³m, 100 mL) were mixed under gentle stirring (500 rpm) at 25 °C for 10 min. Subsequently, the reaction mixture was heated to 70 °C under gentle stirring (500 rpm) for 12 h, after which it was kept at room temperature in the dark for an additional 12 h. A solution of strongly orange‐emitting Au clusters was obtained. The clusters were purified by adding 30 mL of ethanol to 10 mL of the as‐synthesized clusters. The solution was mixed well and then centrifuged at 10 000 rpm for 15 min. Under such conditions, the supernatant containing the free GSH and gold ions was discarded, and the clusters precipitated out of the solution were washed three times using an ultrapure water and ethanol mixture (1:3 volume ratio). The purified clusters were dried under vacuum and redispersed in ultrapure water with the assistance of sodium hydroxide. For further purification, the clusters were purified through an ultrafiltration tube (Millipore, MWCO: 3 KDa) to remove free ions. UV–vis absorption and photoluminescence (PL) spectra of synthesized clusters were recorded using a Shimadzu UV‐1800 photospectrometer (Japan) and a Shimadzu RF‐5301 fluorescence spectrophotometer (Japan), respectively. The molecular composition of the synthesized clusters was analyzed by ESI‐MS. A Bruker microTOF‐Q ESI time‐of‐flight system operating in the positive ion mode was used at a sample injection rate of 25 µL min⁻¹ and a capillary voltage of 4 kV with the nebulizer at 1.5 bar, dry gas at 4 L min⁻¹ at 160 °C, and an m/z of 1000–6000. For the stability study, the synthesized Au clusters were incubated in deionized water, physiological saline, FBS, DMEM medium, and pH 7.4 PBS for 24 h at room temperature. The fluorescence intensity of Au clusters was detected. The appearance of precipitation and fluorescence characteristics under UV light at 365 nm were observed by visual inspection.
Cell Culture: Mouse macrophage RAW 264.7 cells were obtained from the American Type Culture Collection (ATCC). The cells were cultured in Dulbecco's modified Eagle's medium‐F12 (DMEM/F12 1:1) (GibcoTM) supplemented with 10% inactivated FBS, 100 U mL⁻¹ penicillin, and 100 µg mL⁻¹ streptomycin in 5% CO₂ and 95% air at 37 °C. The cells were seeded on 24‐well plates (5 × 10⁵ cells mL⁻¹) and treated with 1 µg mL⁻¹ LPS (Sigma‐Aldrich, USA) and various concentrations of Au clusters in serum‐free medium.
The Induction of OC Formation in vitro: Osteoclastogenesis was induced by primary cultured rat BMMs. Monocytes were isolated from the femoral and tibial bone marrow of 2‐week‐old SD rats30 and then cultured in α‐MEM supplemented with 10% FBS, 100 U mL⁻¹ penicillin, 100 µg mL⁻¹ streptomycin, and 30 ng mL⁻¹ mouse M‐CSF (R&D Systems) at 37 °C in a humidified 5% CO₂ atmosphere. During cell culture, nonadherent cells were removed by changing the medium. After reaching ≈90% confluence, the cells were digested with trypsin and inoculated into culture plates for further experiments. For induction of OC differentiation, the cells were cultured in media containing 50 ng mL⁻¹ mouse RANKL (R&D Systems) and 30 ng mL⁻¹ M‐CSF without or with different concentrations of Au clusters for the indicated days. The culture medium containing different concentrations of Au clusters was changed every two days.
Cell Viability Assay: The RAW 264.7 cells or BMMs were inoculated into 96‐well culture plates at 5 × 10³ cells per well. After incubation overnight, the culture medium was then replaced with different concentrations of Au clusters or monovalent gold compound, auranofin. The cells were incubated at 37 °C in a 5% CO₂ atmosphere for 24–48 h. The cell viability was investigated using a cell counting kit (CCK‐8) (Dojindo Molecular Technologies Inc., Japan) assay.
In vitro OC Formation and Resorption Assay: OC formation was evaluated by TRAP staining and actin ring formation assays. After osteoclastogenic induction for 4 days in the presence of different doses of Au clusters (10 × 10⁻⁶, 50 × 10⁻⁶, and 100 × 10⁻⁶m), the BMMs were washed with PBS once and fixed in 3.7% paraformaldehyde for 15 min at room temperature, followed by permeabilization with 0.1% Triton X‐100 for 10 min. Fixed cells were stained with a TRAP staining kit (387A‐1KT, Sigma‐Aldrich, USA) for 1 h at 37 °C in the dark following the manufacturer's instructions. TRAP‐positive multinucleated (nuclei > 3) cells were counted as OCs using a light microscope (IX71; Olympus).
For the actin ring formation assay, BMMs were seeded onto glass‐bottom dishes (35 mm, MatTek Corporation) at a density of 2 × 10⁴ cells per dish and were incubated in inducing medium for 4 days in the presence of different doses of Au clusters (10 × 10⁻⁶, 50 × 10⁻⁶, and 100 × 10⁻⁶m) to form actin rings. Then, the cells were washed twice with PBS and fixed in 3.7% paraformaldehyde for 20 min, followed by permeabilization with 0.1% Triton X‐100 for 15 min at room temperature. Actin rings were stained by rhodamine‐conjugated phalloidin (Cytoskeleton, Inc., Denver, CO) after washing with PBS, and cell nuclei were stained with DAPI (Invitrogen) for 10 min. The formation of actin rings in each sample was visualized by confocal laser scanning microscopy (Nikon Ti‐E imaging system, Tokyo, Japan).
Resorption activity was evaluated by OC‐mediated pit formation. BMMs were cultured in Corning Osteo Assay Surface 24‐well plates coated with calcium phosphate substrate at a density of 2 × 10⁴ cells/well. The medium was removed after 24 h of incubation, and inducing medium containing different doses of Au clusters (10 × 10⁻⁶, 50 × 10⁻⁶, and 100 × 10⁻⁶m) was added. The culture medium was refreshed every two days. After ≈6 days, the cells were removed with a 10% sodium hypochlorite solution and rinsed three times with water. The bone resorption pits were observed and photographed using a light microscope. ImageJ (1.46r) software was used to quantify the percentage of resorbed bone surface area.
Measurement of NO Release: RAW 264.7 cells were seeded into 96‐well plates (1 × 10⁵ cells/well) and treated with or without LPS (1 µg mL⁻¹) and different concentrations of Au clusters (5, 10, 20 and 50 µmol L⁻¹). After incubation for 24 h at 37 °C, 100 µL of culture supernatant was mixed with an equivalent volume of Griess reagent (0.1% N‐[1‐naphthyl]‐ethylenediamine and 1% sulfanilamide in 5% phosphoric acid) (Beyotime Biotechnology, China) and incubated at room temperature for 10 min. The absorbance at 540 nm was measured using a microplate absorbance reader (Bio‐Rad Laboratories Inc.), and a series of known concentrations of sodium nitrite was used to construct a standard curve.
Enzyme‐Linked Immunosorbent Assay (ELISA): The concentrations of TNF‐α, IL‐1β, IL‐6, and PGE₂ in the culture supernatants and the serum and joint tissues lysate supernatants from rats were determined by ELISAs using TNF‐α, IL‐1β, IL‐6, and PGE₂ ELISA kits (Shanghai Haling Biological Technology Co., Ltd., China) according to the manufacturer's instructions.
Western Blot Analysis: RAW 264.7 cells were seeded into 6‐well plates at a density of 2 × 10⁶ cells/well. After incubation without or with LPS (1 µg mL⁻¹) and different concentration of Au nanoclusters for 24 h, the cells were collected and lysed with RIPA buffer (50 mmol L⁻¹ Tris‐HCl, pH 7.4, 150 mmol L⁻¹ NaCl, 1% Triton X‐100, 1% sodium deoxycholate, 0.1% SDS, 1 mmol L⁻¹ sodium orthovanadate, 50 mmol L⁻¹ NaF, and 1 mmol L⁻¹ ethylenediaminetetraacetic acid) along with protease inhibitor (Roche Molecular Biochemicals). The lysate was centrifuged at 13 000 rpm for 10 min, and the supernatant was stored for subsequent analysis. The concentration of protein was determined using a microplate spectrophotometer (SpectraMax M4, Molecular Devices, USA) at a wavelength of 595 nm. An equal quantity of protein (50 µg) was separated by 10% SDS‐PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane (0.45 µm, Millipore, USA). After blocking, the membrane was incubated with specific antibodies for i‐NOS (Cell Signaling Technologies, 13120, 1:1000), COX‐2 (Cell Signaling Technologies, 12282, 1:1000), IL‐1β (Cell Signaling Technologies, 12703, 1:1000), IL‐6 (Cell Signaling Technologies, 12912, 1:1000), TNF‐α (Cell Signaling Technologies, 11948, 1:1000), phosphor‐p65 (Cell Signaling Technologies, 3033, 1:1000), p65 (Cell Signaling Technologies, 3034, 1:1000), phosphor‐IκBα (Cell Signaling Technologies, 2859, 1:1000), IκBα (Cell Signaling Technologies, 4812, 1:1000), IKKα (Cell Signaling Technologies, 2682, 1:1000), IKKβ (Cell Signaling Technologies, 8943, 1:1000), phosphor‐IKKα/β (Cell Signaling Technologies, 2697, 1:1000), phosphor‐p38 (Thr180/Tyr182) (Cell Signaling Technology, 9211, 1:200), p38 (Cell Signaling Technology, 9212, 1:1000), phosphor‐Erk (Thr202/Tyr204) (Cell Signaling Technology, 9101, 1:1000), Erk (Cell Signaling Technology, 4695, 1:1000), phosphor‐JNK (Thr183/Tyr185) (Cell Signaling Technology, 9251, 1:1000), JNK (Cell Signaling Technology, 9258, 1:1000), and actin (Cell Signaling Technologies, 4970, 1:5000), followed by incubation with an appropriate secondary antibody conjugated to horseradish peroxidase (Beyotime Biotechnology, China). To detect protein in BMMs, the cells were stimulated with 30 ng mL⁻¹ M‐CSF and 50 ng mL⁻¹ RANKL for 5, 15, and 30 min along with 100 µmol L⁻¹ Au clusters; the cells were then lysed and subjected to western blotting as described above using specific antibodies for MAPK and NF‐κB signaling pathway analysis.
Reverse‐Transcriptase PCR and Quantitative Real‐Time PCR (qPCR): Total RNA was extracted using an RNeasy Plus Mini Kit (Qiagen NV, Venlo, the Netherlands). First, 1 µg of purified total RNA was reverse transcribed into complementary DNA using an Oligo(dT)15 Primer (Promega Corporation, Fitchburg, WI, USA) and M‐MLV Reverse Transcriptase (Promega) following the manufacturer's instructions. The concentrations of mRNA were quantified by absorption at 260 nm. Equal amounts of mRNA were used to perform PCR with the corresponding primers, and β‐actin was used as an internal control. The amplification products were visualized by agarose gel electrophoresis. The oligonucleotide primers used were as follows: i‐NOS, sense, 5′‐AGCTCCTCCCAGGACCACAC‐3′, and antisense, 5′‐ACGCTGAGTACCTCATTGGC‐3′; COX‐2, sense, 5′‐ACGGAGAGAGTTCATCCCTGACCC‐3′, and antisense, 5′‐TGACTGTGGGGGGATACACCTCTC‐3′; IL‐1β, sense, 5′‐CAGGATGAGGACATGAGCACC‐3′, and antisense, 5′‐CTCTGCAGACTCAAACTCCAC‐3′; TNF‐α, sense, 5′‐CCTGTAGCCCACGTCGTAGC‐3′, and antisense, 5′‐TTGACCTCAGCGCTGAGTTG‐3′; IL‐6, sense, 5′‐GTACTCCAGAAGACCAGAGG‐3′, and antisense, 5′‐TGCTGGTGACAACCACGGCC‐3′; and β‐actin, sense, 5′‐GTGGGCCGCCCTAGGCACCAG‐3′, and antisense, 5′‐GGAGGAAGAGGATGCGGCAGT‐3′.
qPCR was performed with the iQ5 Multicolor Real‐Time PCR Detection System (Bio‐Rad Laboratories, Inc., Hercules, CA, USA) according to the manufacturer's recommendations. Total RNA was extracted using an RNeasy Plus Mini Kit (Qiagen NV, Venlo, the Netherlands). Purified RNA was reverse transcribed into complementary DNA by using an Oligo(dT)15 Primer (Promega Corporation, Fitchburg, WI, USA) and M‐MLV Reverse Transcriptase (Promega) following the manufacturer's instructions. qPCR was performed with the iQ SYBR Green Supermix (Bio‐Rad) via the standard protocol. Sequences of the primers were as follows: c‐fos, sense, 5′‐GGATTTGACTGGAGGTCTGC‐3′, and antisense, 5′‐TTGCTGATGCTCTTGACTGG‐3′; NFATc1, sense, 5′‐CTCGAAAGACAGCACTGGAGCAT‐3′, and antisense, 5′‐CGGCTGCCTTCCGTCTCATAG‐3′; TRAP, sense, 5′‐CTGGAGTGCACGATGCCAGCGACA‐3′, and antisense, 5′‐TCCGTGCTCGGCGATGGACCAGA‐3′; OSCAR, sense, 5′‐TCTGCCCCCTATGTGCTATC‐3′, and antisense, 5′‐CTCCTGCTGTGCCAATCAC‐3′; and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH), sense, 5′‐CATGGCCTTCCGTGTTCCTACCC‐3′, and antisense, 5′‐CCTCAGTGTAGCCCAAGATGCCCT‐3′. The amplification factor was calculated by the comparative threshold cycle method. The ratios of gene expression fold changes were calculated using GAPDH as a control.
Immunofluorescence: RAW 264.7 cells were seeded onto glass‐bottom dishes (35 mm, MatTek Corporation) and treated with or without LPS (1 µg mL⁻¹) and/or 5–50 µmol L⁻¹ of Au clusters. After 24 h, the cells were fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton X‐100 for 20 min, and blocked with 5% BSA in PBS at room temperature for 1 h. Then, the cells were incubated with the primary antibodies for phosphor‐p65 (1:100), p65 (1:100), phosphor‐IκBα (1:100), and IκBα (1:100) at 37 °C for 1 h, followed by a 1 h incubation with fluorescein isothiocyanate (FITC)‐conjugated goat‐antirabbit IgG (Beyotime, China). The cell nuclei were stained with 10 µg mL⁻¹ DAPI (Invitrogen) for 10 min. After being washed three times with PBS, the cells were observed and imaged by confocal laser scanning microscopy (Nikon Ti‐e microscope, CLSM) with excitation at wavelengths of 405 and 488 nm.
CIA and Treatment Protocols: All animal care and experiments were conducted in compliance with the requirements of the National Act on the use of experimental animals (China) and were approved by the Institutional Animal Care and Ethic Committee at the Chinese Academy of Sciences (Approved No. SYXK (jing) 2014‐0023). An immune emulsion was prepared by dissolving bovine type II collagen (CII) (Chondrex, Inc.) in 0.1 × 10⁻³m acetic acid at 4 °C overnight and emulsifying with an equal volume of incomplete Freund's adjuvant (Chondrex, Inc). Male 5‐ to 6‐week‐old Wistar rats (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were intradermally injected at the base of the tail with 0.2 mL of the emulsion containing 400 µg of CII. On day 7 after the primary immunization, the rats were boosted intradermally with 200 µg of CII. Rats were closely monitored for arthritis disease severity and progression by ankle circumference, clinical arthritis score, and body weight. The clinical arthritis score was assessed by grading each paw from 0 to 4 according to the extent of erythema and swelling: score 0 = no erythema or swelling; score 1 = slight erythema or swelling of one of the toes or fingers; score 2 = erythema and swelling of more than one toe or finger; score 3 = erythema and swelling of the ankle or wrist; score 4 = complete erythema and swelling of toes or fingers and ankle or wrist.31 Each limb was graded, and a mean score was given for each animal.
At 14 days after the secondary CII immunization, and only when the clinical scores reached 3–4, the rats were randomly assigned to the following groups, each consisting of 10 animals: Group I, saline‐injected normal control; Group II, saline‐injected CIA control; Group III, arthritic rats orally administered MTX (Shanghai Xinyi Pharmaceutical Co., Ltd, China; Batch number: 036151102) as reference (0.5 mg kg⁻¹, twice a week); and Group IV, arthritic rats injected (i.p.) with Au clusters in saline (5 mg of Au kg⁻¹ day⁻¹). Treatment was initiated from day 22 and continued up to day 64 after primary immunization. On day 64 after arthritis induction, blood was collected from all the groups of animals for hematological and blood biochemical evaluation as well as for the measurement of cytokine levels in serum specimens. Rats were euthanized by excess CO₂ inhalation, and ankle joint tissues were isolated from the hind paws of rats and homogenized with T‐PER reagent containing 1 × cocktail protease inhibitor for the detection of tissue cytokines. The major organs were excised and fixed in 10% formalin for histopathological examination.
MicroCT Analyses and Histopathological Analysis: The hind limb of each rat was harvested after sacrifice and imaged with 3D microcomputed tomography (microCT, Siemens Inveon MM Gantry CT, Germany) at a voltage of 70 kV and an electric current of 400 µA. The exposure time was 800 ms, and the scan area was 26.42 mm × 26.42 mm × 30 mm around the metatarsal bone articulations. 3D analysis and BMD were analyzed using microCT software.
For histopathological analysis, hind paws were fixed in 10% formalin after removal of the skin and were then decalcified in 5% formic acid, embedded in paraffin, microtomically sectioned into 5 µm slices, and stained with hematoxylin and eosin.
Immunohistochemistry: The hind paws were treated as above for histopathological analysis, except they were decalcified with 10% EDTA instead of 5% formic acid. The 5 µm tissue sections were deparaffinized, rehydrated, and rinsed in PBS. To inactivate endogenous peroxide, 3% H₂O₂ was applied. Antigens in the tissue sections were repaired by heating for 20 min in sodium citrate buffer at 95 °C in a microwave oven, followed by cooling for 20 min at room temperature. The sections were blocked with 5% goat serum; incubated with primary antibodies against phosphor‐p65 (Abcam, ab86299, 1:70), phosphor‐IκBα (Geme Tex, GTX32224, 1:30), phosphor‐IKKα/β (Geme Tex, GTX52310, 1:50), and RANK (Bioss, bs‐2695R, 1:50) at 37 °C for 70 min; and then incubated for 30 min with HRP‐conjugated secondary antibody (Beyotime, China) at 37 °C. After rinsing extensively, the sections were incubated with a diaminobenzidine (DAB) solution for 3 min at room temperature and were then counterstained with hematoxylin. The images were observed and analyzed using an Olympus CX31 light microscope.
Statistical Analyses: Sample size was determined according to preliminary data and observed effect sizes. Data are represented as the mean ± SD Data were previously tested with homogeneity of variance using Levene's test. Statistical significance of overall differences between multiple groups was determined by one‐way analysis of variance. If the test was significant, pairwise comparisons were performed using the Student's t‐test. p < 0.05 was considered statistically significant.

Four beagle dogs were anaesthetized by intraperitoneal injection with 3% pentobarbital sodium (30 mg/kg body weight, Aikonchem, Jiangsu, China) and the pulp chambers of the teeth studied were opened. The canals were exposed to the oral environment for 4 weeks to induce a chronic AP. Cone beam computed tomography (CBCT) was taken to observe the periapical lesion. One of the dogs was sacrificed, and its canals were randomly divided into two groups, including 10 exposed canals and 10 non-infected canals (control group), for hematoxylin and eosin (H&E) stains. Periradicular tissue responses were histologically classified into four categories, according to the amount of inflammatory cells and the degree of apical bone and root destruction (Table S1).
Four weeks later, the canals of another 3 dogs were instrumented using K-files and finished at #25 by the step-back technique, with irrigation by 1.0% sodium hypochlorite (Longly, Wuhan, China). Then, the root canals were dried with sterile paper points and filled with calcium hydroxide (Ivoclar Vivadent, Schaan, Liechtenstein), followed by access cavity sealing with Filtek^TMZ350XT adhesive resin (3M, St. Paul, MN, USA). CBCT was taken to observe the periapical lesion for all 3 dogs, and one of the dogs was sacrificed for histopathological examination.
After 2 weeks of disinfection, the canals of the remaining two dogs were divided into the control group, E. faecalis group and multi-bacteria group. Then, the canals were prepared to #30 and irrigated with 1.0% sodium hypochlorite (Longly, Wuhan, China), followed by inoculation of bacterial suspension. For the E.faecalis group, the bacteria concentration was 10⁶ colony-forming units [CFUs]/mL. For the multi-bacteria group, bacterial suspensions were mixed to obtain an inoculum containing E.faecalis (10⁶ CFUs/mL), L. acidophilus (10⁶ CFUs/mL), A. neisseriae (10⁶ CFUs/mL) and S. gordonii (10⁶ CFUs/mL). For the control group, the root canals were injected with sterile normal saline. The cavity was sealed with adhesive resin (3M, St. Paul, MN, USA). Two weeks later, CBCT was taken to observe the periapical lesion for 2 dogs, and all of them were sacrificed for histopathological examination.