To generate HCV pseudo-particles, 293T cells were transfected with expression vectors encoding the viral components (see Fig. 1 B), i.e., E1E2 glycoproteins, retroviral core proteins, and packaging-competent GFP- or nlslacZ-containing retroviral transfer vectors. In brief, the Gag-Pol packaging construct (8.1 µg), the transfer vector construct (8.1 µg), and the glycoprotein-expressing construct (2.7 µg) DNAs were transfected into 2.5 × 106 293T cells seeded the day before in 10-cm plates using a calcium phosphate transfection protocol (CLONTECH Laboratories, Inc.), as described previously (11 (link)). The medium (8 ml/plate) was replaced 16 h after transfection. Supernatants containing the pseudo-particles were harvested 24 h later, filtered through 0.45-µm pore-sized membranes, and used in infection assays. Purified virus samples were obtained by ultracentrifugation of 10-ml viral supernatants through a 1.5-ml 20% sucrose cushion in an SW 41 Beckman rotor (25,000 rpm, 2.5 h, 4°C). Viral pellets were suspended in 50 µl PBS. Immunoblots of producer cell lysates and purified pseudo-particles were performed as described previously (15 (link)). Fractionation of the sucrose cushion purified viral pellets was achieved by an overnight equilibrium density centrifugation in a 20–60% sucrose gradient at 35,000 rpm and 4°C in a Beckman SW 41 rotor. Fractions of 0.7 ml were collected, precipitated with TCA, and analyzed by Western blotting.
>
Chemicals & Drugs
>
Inorganic Chemical
>
Calcium Phosphates
Calcium Phosphates
Calcium Phosphates are a diverse group of minerals composed of calcium and phosphate ions, which play a crucial role in various physiological processes.
These compounds are essential for the formation and maintenance of bone and teeth, and they also have applications in biomedicine, dentistry, and material science.
PubCompare.ai's AI-driven optimization tools can help researchers effeciently locate the best protocols from literature, pre-prints, and patents, ensuring reproducible and accurate results.
Unlock the secrets of Calcium Phosphates and unlock new insights with PubCompare.ai's intelligent analysis.
These compounds are essential for the formation and maintenance of bone and teeth, and they also have applications in biomedicine, dentistry, and material science.
PubCompare.ai's AI-driven optimization tools can help researchers effeciently locate the best protocols from literature, pre-prints, and patents, ensuring reproducible and accurate results.
Unlock the secrets of Calcium Phosphates and unlock new insights with PubCompare.ai's intelligent analysis.
Most cited protocols related to «Calcium Phosphates»
Biological Assay
Calcium Phosphates
Cells
Centrifugation
Cloning Vectors
DNA
Fractionation, Chemical
Glycoproteins
HEK293 Cells
Immunoblotting
Infection
Pellets, Drug
Retroviridae
Retroviridae Proteins
Sucrose
Tissue, Membrane
Transfection
Ultracentrifugation
Viral Components
Virus
HTLA cells, (an HEK293 cell line stably expressing a tTA-dependent luciferase reporter and a β-arrestin2-TEV fusion gene) were a gift from the lab of Richard Axel, and were maintained in DMEM supplemented with 10% FBS, 2 μg/ml puromycin and 100 μg/ml hygromycin B in a humidified atmosphere at 37°C in 5% CO2. For transfection, cells were plated at 9 to 10 × 106 cells per 150 mm cell culture dish (day 1). The following day (day 2), cells were transfected using the calcium phosphate method. On day 3, transfected cells were transferred at 15,000 to 20,000 cells per well in 40 μl of medium into poly-L-lysine coated and rinsed 384-well white clear-bottom cell culture plates (Greiner Bio-one). On day 4, 3.5x drug stimulation solutions were prepared in filter-sterilized assay buffer, which consisted of 20 mM HEPES and 1x HBSS at pH 7.4, and 20 μl added to each well. On day 5, medium and drug solutions were removed from the wells (by aspiration or shaking), and 20 μl per well of Bright-Glo solution (Promega) diluted 20-fold in assay buffer were added to each well. After incubation for 15 to 20 minutes at room temperature, luminescence was counted in a Trilux luminescence counter. Results in the form of RLU (relative luminescence units) were exported into Excel spreadsheets, and Graphpad Prism was used for analysis of data. To measure constitutive activity, no ligand was added on day 4.
Atmosphere
beta-Arrestin 1
Biological Assay
Buffers
Calcium Phosphates
Cell Culture Techniques
Cells
Genes, vif
HEK293 Cells
Hemoglobin, Sickle
HEPES
Hygromycin B
Hyperostosis, Diffuse Idiopathic Skeletal
Leukocytes
Ligands
Luciferases
Luminescence
Lysine
Poly A
prisma
Promega
Puromycin
Transfection
Calcium Phosphates
Cre recombinase
Histocytochemistry
Infant, Newborn
Lentivirus
Mice, Laboratory
Neurons
Proteins
Superinfection
Synapsins
Transfection
Virus
Biopharmaceuticals
calcium phosphate
Calcium Phosphates
Cells
Centrifugation
Chromatography, Affinity
Cloning Vectors
Dry Ice
Edetic Acid
Freezing
Hyperostosis, Diffuse Idiopathic Skeletal
Magnesium
Pellets, Drug
Plasmids
Saline Solution
SARS-CoV-2
Transfection
For each affinity purification (26 wild-type and one catalytically dead SARS-CoV-2 baits, one GFP control, one empty vector control), ten million HEK293T/17 cells were plated per 15-cm dish and transfected with up to 15 μg of individual Strep-tagged expression constructs after 20–24 hours. Total plasmid was normalized to 15 μg with empty vector and complexed with PolyJet Transfection Reagent (SignaGen Laboratories) at a 1:3 μg:μl ratio of plasmid to transfection reagent based on manufacturer’s recommendations. After more than 38 hours, cells were dissociated at room temperature using 10 ml Dulbecco’s Phosphate Buffered Saline without calcium and magnesium (D-PBS) supplemented with 10 mM EDTA for at least 5 minutes and subsequently washed with 10 ml D-PBS. Each step was followed by centrifugation at 200 × g, 4°C for 5 minutes. Cell pellets were frozen on dry ice and stored at −80°C. For each bait, n=3 independent biological replicates were prepared for affinity purification.
Biopharmaceuticals
calcium phosphate
Calcium Phosphates
Cells
Centrifugation
Chromatography, Affinity
Cloning Vectors
Dry Ice
Edetic Acid
Freezing
Hyperostosis, Diffuse Idiopathic Skeletal
Magnesium
Pellets, Drug
Plasmids
Saline Solution
SARS-CoV-2
Transfection
Most recents protocols related to «Calcium Phosphates»
Example 2
A. Seed Treatment with Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiably higher biomass than the control corn plants.
The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.
The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.
In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.
B. Seed Treatment with Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiably higher biomass than the control corn plants.
The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.
The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.
In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.
C. Treatment with Agricultural Composition Comprising Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiably higher biomass than the control corn plants.
The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.
The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.
In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.
D. Treatment with Agricultural Composition Comprising Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiably higher biomass than the control corn plants.
The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.
The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.
In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.
A. Seed Treatment with Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.
The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.
B. Seed Treatment with Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.
The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.
C. Treatment with Agricultural Composition Comprising Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the with the agricultural composition will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.
The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.
D. Treatment with Agricultural Composition Comprising Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the with the agricultural composition will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.
The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.
A. Seed Treatment with Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.
The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.
B. Seed Treatment with Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.
A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.
It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.
The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.
C. Treatment with Agricultural Composition Comprising Isolated Microbe
In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.
The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.
D. Treatment with Agricultural Composition Comprising Microbial Consortia
In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.
For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.
A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.
It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.
The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.
The inoculants were prepared from isolates grown as spread plates on R2A incubated at 25° C. for 48 to 72 hours. Colonies were harvested by blending with sterile distilled water (SDW) which was then transferred into sterile containers. Serial dilutions of the harvested cells were plated and incubated at 25° C. for 24 hours to estimate the number of colony forming units (CFU) in each suspension. Dilutions were prepared using individual isolates or blends of isolates (consortia) to deliver 1×105 cfu/microbe/seed and seeds inoculated by either imbibition in the liquid suspension or by overtreatment with 5% vegetable gum and oil.
Seeds corresponding to the plants of table 15 were planted within 24 to 48 hours of treatment in agricultural soil, potting media or inert growing media. Plants were grown in small pots (28 mL to 200 mL) in either a controlled environment or in a greenhouse. Chamber photoperiod was set to 16 hours for all experiments on all species. Air temperature was typically maintained between 22-24° C.
Unless otherwise stated, all plants were watered with tap water 2 to 3 times weekly. Growth conditions were varied according to the trait of interest and included manipulation of applied fertilizer, watering regime and salt stress as follows:
-
- Low N—seeds planted in soil potting media or inert growing media with no applied N fertilizer
- Moderate N—seeds planted in soil or growing media supplemented with commercial N fertilizer to equivalent of 135 kg/ha applied N
- Insol P—seeds planted in potting media or inert growth substrate and watered with quarter strength Pikovskaya's liquid medium containing tri-calcium phosphate as the only form phosphate fertilizer.
- Cold Stress—seeds planted in soil, potting media or inert growing media and incubated at 10° C. for one week before being transferred to the plant growth room.
- Salt stress—seeds planted in soil, potting media or inert growing media and watered with a solution containing between 100 to 200 mg/L NaCl.
Untreated (no applied microbe) controls were prepared for each experiment. Plants were randomized on trays throughout the growth environment. Between 10 and 30 replicate plants were prepared for each treatment in each experiment. Phenotypes were measured during early vegetative growth, typically before the V3 developmental stage and between 3 and 6 weeks after sowing. Foliage was cut and weighed. Roots were washed, blotted dry and weighed. Results indicate performance of treatments against the untreated control.
The data presented in table 15 describes the efficacy with which a microbial species or strain can change a phenotype of interest relative to a control run in the same experiment. Phenotypes measured were shoot fresh weight and root fresh weight for plants growing either in the absence of presence of a stress (assay). For each microbe species, an overall efficacy score indicates the percentage of times a strain of that species increased a both shoot and root fresh weight in independent evaluations. For each species, the specifics of each independent assay is given, providing a strain ID (strain) and the crop species the assay was performed on (crop). For each independent assay the percentage increase in shoot and root fresh weight over the controls is given.
Full text: Click here
Ammonia
Asparagine
Aspartic Acid
Biological Assay
Bosea thiooxidans
Calcium Phosphates
Capsicum
Cells
Chlorophyll
Cold Shock Stress
Cold Temperature
Crop, Avian
Dietary Fiber
DNA Replication
Droughts
Drought Tolerance
Embryophyta
Environment, Controlled
Farmers
Fertilization
Glutamic Acid
Glutamine
Glycine
Growth Disorders
Herbaspirillum
Herbaspirillum huttiense
Leucine
Lolium
Lycopersicon esculentum
Lysine
Maize
Massilia niastensis
Methionine
Microbial Consortia
Nitrates
Nitrites
Nitrogen
Novosphingobium rosa
Paenibacillus
Paenibacillus amylolyticus
Pantoea agglomerans
Pantoea vagans
Phenotype
Phosphates
Photosynthesis
Plant Development
Plant Embryos
Plant Leaves
Plant Proteins
Plant Roots
Plants
Polaromonas ginsengisoli
Pseudoduganella violaceinigra
Pseudomonas
Pseudomonas fluorescens
Rahnella
Rahnella aquatilis
Retention (Psychology)
Rhodococcus erythropolis
Rosa
Salt Stress
Sodium Chloride
Sodium Chloride, Dietary
Stenotrophomonas chelatiphaga
Stenotrophomonas maltophilia
Stenotrophomonas rhizophila
Stenotrophomonas terrae
Sterility, Reproductive
Strains
Technique, Dilution
Threonine
Triticum aestivum
Tryptophan
Tyrosine
Vegetables
Zea mays
Example 10
CD19 was chosen as a B-CAR target, and an antigen binding domain comprising the sequence as shown in SEQ ID NO.:1 was used to construct the B-CAR. A fourth generation lentivirus vector system was used. CA19 CAR vector, packaging vector pMDL-gag, Rev, and envelop vector pMD2.G were co-transduced into HEK293T cells with calcium phosphate or liposome-PEI. The supernatant was collected after 48 hrs, and ultra-centrifuged to concentrate the lentivirus.
CD19 lentivirus titration was conducted on a three-fold serial dilution. 293T cells were collected after transduced with 50 ul lentivirus for 48 to 72 hrs, and then stained for CAR expression. The percentage of CAR+ (CAR+%) was analyzed via flow cytometry, and titration calculated as:
Titration (TU/ml)=(Number of starting 293T cells)*CAR+%*Fold of dilution*20 (first CAR+%<20%)
Lentivirus titration was calculated. Titration over 3*107 was considered ready for further use.
Full text: Click here
Antigens
B-Lymphocytes
Calcium Phosphates
Cell Membrane Proteins
Cells
Cloning Vectors
Flow Cytometry
HEK293 Cells
Lentivirus
Liposomes
Technique, Dilution
Titrimetry
Example 4
A fourth generation lentivirus vector system was used. PD1/CD28 vector, packaging vector pMDL-gag, Rev, and envelop vector pMD2.G were co-transfected into HEK293T cells with calcium phosphate or liposome-PEI. The supernatant was collected after 48 hrs, and centrifuged to concentrate the lentivirus.
Lentivirus titration was conducted on a three-fold serial dilution. HEK293T cells were collected after transduction with 50 ul lentivirus for 48 to 72 hrs, and then stained with PD-1. The percentage of PD-1+(PD-1+%) was analyzed by flow cytometry, and titration was calculated as:
Titration (TU/ml)=40000-45000(which is the number of starting HEK293T cells)*PD1+%*Fold of dilution*20 (first PD1+%<20%)
Full text: Click here
Calcium Phosphates
CD28 Antigens
Cells
Cloning Vectors
Figs
Flow Cytometry
Lentivirus
Liposomes
Technique, Dilution
Titrimetry
PLXNB2 knockdown was commonly achieved by lentiviral‐mediated transfer of a validated puromycin‐selectable construct expressing a targeted shRNA and GFP marker (Origene, cat. TL317033B; targeting seq. 5′‐CCACTGGCTGTGGAGCCGAAGCAAGTCCT‐3′). For validation experiments, we transferred an independent shRNA sequence carried by TRCN0000048188 clone (targeting seq. 5′‐GCTCTACCAATACACGCAGAA‐3′), provided by Sigma‐Aldrich. For overexpression experiments, a cDNA construct encoding human PlxnB2 (VSV‐tagged, provided by Jun Takagi, Osaka, Japan) was subcloned into the lentiviral expression construct pLVX. Moreover, a cDNA fragment containing the sequence encoding PLXNB2‐G842C mutation was produced by gene synthesis (BioCat GmbH, Heidelberg, Germany) and replaced to the wild‐type sequence, by restriction site‐mediated recombination, in the expression construct.
Lentiviral‐mediated gene transfer was performed as described previously (Follenzi & Naldini, 2002 (link); Brown et al, 2020 (link)). Briefly, nonreplicating viral particles containing constructs expressing cDNA or shRNAs (or pGFP‐C‐shRNA Vector [Origene], as control) were produced in HEK‐293 T packaging cells by the calcium phosphate precipitation method. The harvesting of viral particles was carried out 48 h after transfection: the conditioned medium was filtered and centrifuged at 19,500 rpm for 2 h to obtain concentrated viral suspensions. Host cells were then incubated with viral particle‐containing media in the presence of 8 μg/ml polybrene at 37° (multiplicity of infection [moi] = 5); CUP cells were dissociated from agnospheres and incubated with viral particles in suspension. Gene‐transduced cells were then selected by 0.5 μg/ml puromycin treatment.
Lentiviral‐mediated gene transfer was performed as described previously (Follenzi & Naldini, 2002 (link); Brown et al, 2020 (link)). Briefly, nonreplicating viral particles containing constructs expressing cDNA or shRNAs (or pGFP‐C‐shRNA Vector [Origene], as control) were produced in HEK‐293 T packaging cells by the calcium phosphate precipitation method. The harvesting of viral particles was carried out 48 h after transfection: the conditioned medium was filtered and centrifuged at 19,500 rpm for 2 h to obtain concentrated viral suspensions. Host cells were then incubated with viral particle‐containing media in the presence of 8 μg/ml polybrene at 37° (multiplicity of infection [moi] = 5); CUP cells were dissociated from agnospheres and incubated with viral particles in suspension. Gene‐transduced cells were then selected by 0.5 μg/ml puromycin treatment.
Full text: Click here
Calcium Phosphates
Cells
Clone Cells
Cloning Vectors
Culture Media, Conditioned
DNA, Complementary
Genes
Gene Transfer, Horizontal
HEK293 Cells
Homo sapiens
Infection
Mutation
Polybrene
Puromycin
Recombination, Genetic
Short Hairpin RNA
Synthetic Genes
Transfection
Virion
To avoid the unspecific activation of endogenous PIEZO1, we used throughout this study HEK293 cells KO for PIEZO1 (ref. 25 (link)), named HEK-P1KO. These cells were a gift from Dr. Ardem Patapoutian (The Scripps Research Institute, La Jolla, CA, USA) and Dr. Eric Honoré (Institut de Pharmacologie Moléculaire et Cellulaire, CNRS, Valbonne, France) and were not authenticated. HEK-P1KO cells were maintained in Dubecco’s Modified Eagle’s Medium–high glucose (DMEM) supplemented with GlutaMax (Gibco, Life Technologies), 10% heat inactivated-fetal bovine serum (Gibco, Life Technologies), 100 units mL−1 penicillin and 100 μg mL−1 streptomycin (Gibco, Life Technologies) incubated at 37 °C in a 5% CO2 atmosphere. Cells were passaged twice a week using 0.05% trypsin-EDTA (Gibco, Life Technologies) and used between passages 15–25 for the experiments. Cells were seeded in poly-l -lysine-treated 9-mm coverslips for patch-clamp at 5% confluence and poly-l -lysine-treated 12 mm coverslips for calcium imaging at 10–20% confluence 1 day before transfection.
Transfection was carried out using the calcium phosphate method in 35-mm well plates containing the seeded cells in the corresponding coverslips. We transfected 1 or 4 μg (for mP1 or Y2464C respectively) of plasmid per 35-mm dish for cell-attached experiments, 0.27 μg for whole-cell, and 2 μg for calcium imaging, and 5 μg per 100-mm dish for cell-surface biotinylation assay (unless stated otherwise).
Transfection was carried out using the calcium phosphate method in 35-mm well plates containing the seeded cells in the corresponding coverslips. We transfected 1 or 4 μg (for mP1 or Y2464C respectively) of plasmid per 35-mm dish for cell-attached experiments, 0.27 μg for whole-cell, and 2 μg for calcium imaging, and 5 μg per 100-mm dish for cell-surface biotinylation assay (unless stated otherwise).
Full text: Click here
Atmosphere
Biological Assay
Biotinylation
Calcium
Calcium Phosphates
Cells
Eagle
Edetic Acid
Fetal Bovine Serum
Glucose
HEK293 Cells
Hyperostosis, Diffuse Idiopathic Skeletal
Lysine
Penicillins
Plasmids
Poly A
Streptomycin
Transfection
Trypsin
Top products related to «Calcium Phosphates»
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
Sourced in United States, Germany, China, Sao Tome and Principe, United Kingdom, Macao, Canada, France, Japan, Switzerland, Italy, Australia, Netherlands, Morocco, Israel, Ireland, Belgium, Denmark, Norway
Polybrene is a cationic polymer used as a transfection reagent in cell biology research. It facilitates the introduction of genetic material into cells by enhancing the efficiency of DNA or RNA uptake.
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
Sourced in United States, Switzerland, China, Japan, Germany, United Kingdom, France, Canada
PsPAX2 is a packaging plasmid used for the production of lentiviral particles. It contains the necessary genes for lentiviral packaging, but does not contain the viral genome. PsPAX2 is commonly used in lentiviral production workflows.
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
Sourced in United States, Germany, China, Sao Tome and Principe, United Kingdom, Macao, Canada, Japan, Italy, Switzerland, France, Israel, Australia, Spain, Belgium, Morocco, Sweden
Puromycin is a laboratory product manufactured by Merck Group. It functions as an antibiotic that inhibits protein synthesis in eukaryotic cells.
Sourced in United States, Switzerland, China, Germany, France, Japan, United Kingdom, Canada
The PMD2.G is a lab equipment product. It is a plasmid that can be used for various research applications.
Sourced in United States, France
The Calcium phosphate transfection kit is a laboratory product designed to facilitate the introduction of DNA or RNA into cells. It utilizes a calcium phosphate precipitation method to deliver the genetic material into the target cells. The kit provides the necessary reagents and protocols to perform this transfection procedure.
Sourced in United States, Germany, China, United Kingdom, Canada, France, Japan, Switzerland, Holy See (Vatican City State), Israel
HEK293T cells are a widely used human embryonic kidney cell line. They are derived from human embryonic kidney cells transformed with sheared adenovirus 5 DNA. HEK293T cells are commonly used for a variety of applications, including gene expression, viral production, and cell-based assays.
More about "Calcium Phosphates"
Calcium phosphates are a diverse family of minerals composed of calcium and phosphate ions, playing a crucial role in various physiological processes.
These compounds are essential for the formation and maintenance of bone and teeth, and they also have applications in biomedicine, dentistry, and material science.
Calcium phosphates include a range of compounds such as hydroxyapatite, tricalcium phosphate, and dicalcium phosphate, each with unique properties and applications.
These minerals are crucial for the mineralization and remodeling of bone and teeth, providing structural integrity and supporting biological functions.
Beyond their physiological importance, calcium phosphates have garnered attention in the fields of biomedicine and material science.
They are commonly used in bone grafts, dental implants, and other medical devices, leveraging their biocompatibility and ability to integrate with surrounding tissues.
Researchers are also exploring the use of calcium phosphates in drug delivery systems, tissue engineering, and regenerative medicine.
To study calcium phosphates effectively, researchers often utilize various experimental techniques and tools.
This includes the use of transfection reagents like Lipofectamine 2000, Polybrene, and calcium phosphate transfection kits to introduce genetic material into cells.
Cell lines such as HEK293T are commonly employed in these studies.
Additionally, culturing cells in media like DMEM, supplemented with fetal bovine serum (FBS) and antibiotics like penicillin/streptomycin, provides a suitable environment for investigating calcium phosphate-related processes.
PubCompare.ai's AI-driven optimization tools can be invaluable in this research landscape.
By efficiently locating the best protocols from literature, preprints, and patents, researchers can ensure reproducible and accurate results, unlocking new insights into the complex world of calcium phosphates.
Unlock the secrets of these essential minerals and drive your research forward with the power of PubCompare.ai's intelligent analysis.
These compounds are essential for the formation and maintenance of bone and teeth, and they also have applications in biomedicine, dentistry, and material science.
Calcium phosphates include a range of compounds such as hydroxyapatite, tricalcium phosphate, and dicalcium phosphate, each with unique properties and applications.
These minerals are crucial for the mineralization and remodeling of bone and teeth, providing structural integrity and supporting biological functions.
Beyond their physiological importance, calcium phosphates have garnered attention in the fields of biomedicine and material science.
They are commonly used in bone grafts, dental implants, and other medical devices, leveraging their biocompatibility and ability to integrate with surrounding tissues.
Researchers are also exploring the use of calcium phosphates in drug delivery systems, tissue engineering, and regenerative medicine.
To study calcium phosphates effectively, researchers often utilize various experimental techniques and tools.
This includes the use of transfection reagents like Lipofectamine 2000, Polybrene, and calcium phosphate transfection kits to introduce genetic material into cells.
Cell lines such as HEK293T are commonly employed in these studies.
Additionally, culturing cells in media like DMEM, supplemented with fetal bovine serum (FBS) and antibiotics like penicillin/streptomycin, provides a suitable environment for investigating calcium phosphate-related processes.
PubCompare.ai's AI-driven optimization tools can be invaluable in this research landscape.
By efficiently locating the best protocols from literature, preprints, and patents, researchers can ensure reproducible and accurate results, unlocking new insights into the complex world of calcium phosphates.
Unlock the secrets of these essential minerals and drive your research forward with the power of PubCompare.ai's intelligent analysis.