Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Inorganic Chemical > Sodium persulfate

Sodium persulfate

Sodium persulfate, a powerful oxidizing agent, has a wide range of applications in chemical synthesis, materials science, and environmental remediation.
This inorganic salt is commonly used as an initiator in free radical polymerization reactions, as well as a bleaching and disinfecting agent.
Sodium persulfate's unique properties, such as its ability to generate reactive oxygen species, make it a valuable tool for researchers across diverse fields.
This AI-driven platform, PubCompare.ai, helps scientists optimize the use of sodium persulfate by providing access to the most effective protocols from literature, preprints, and patents, enabling informed decisions and streamlining the research process.
Discover the full potential of sodium persulfate with PubCompare.ai - your ultimate AI-powered research companion.

Most cited protocols related to «Sodium persulfate»

1
Comprehensive Antioxidant and Enzyme Inhibitory Assays
Cited 78 times
Antioxidant (DPPH and ABTS radical scavenging, reducing power (CUPRAC and FRAP), phosphomolybdenum, and metal chelating (ferrozine method)) and enzyme inhibitory activities [cholinesterase (ChE) Elmann’s method], tyrosinase (dopachrome method), α-amylase (iodine/potassium iodide method), and α -glucosidase (chromogenic PNPG method)) were determined using the methods previously described by Zengin et al. (2014) (link) and Dezsi et al. (2015) (link).
For the DPPH (1,1-diphenyl-2-picrylhydrazyl) radical scavenging assay: Sample solution (1 mg/mL; 1 mL) was added to 4 mL of a 0.004% methanol solution of DPPH. The sample absorbance was read at 517 nm after a 30 min incubation at room temperature in the dark. DPPH radical scavenging activity was expressed as millimoles of trolox equivalents (mg TE/g extract).
For ABTS (2,2′-azino-bis(3-ethylbenzothiazoline) 6-sulfonic acid) radical scavenging assay: Briefly, ABTS+ was produced directly by reacting 7 mM ABTS solution with 2.45 mM potassium persulfate and allowing the mixture to stand for 12–16 in the dark at room temperature. Prior to beginning the assay, ABTS solution was diluted with methanol to an absorbance of 0.700 ± 0.02 at 734 nm. Sample solution (1 mg/mL; 1 mL) was added to ABTS solution (2 mL) and mixed. The sample absorbance was read at 734 nm after a 30 min incubation at room temperature. The ABTS radical scavenging activity was expressed as millimoles of trolox equivalents (mmol TE/g extract) (Mocan et al., 2016a (link)).
For CUPRAC (cupric ion reducing activity) activity assay: Sample solution (1 mg/mL; 0.5 mL) was added to premixed reaction mixture containing CuCl2 (1 mL, 10 mM), neocuproine (1 mL, 7.5 mM) and NH4Ac buffer (1 mL, 1 M, pH 7.0). Similarly, a blank was prepared by adding sample solution (0.5 mL) to premixed reaction mixture (3 mL) without CuCl2. Then, the sample and blank absorbances were read at 450 nm after a 30 min incubation at room temperature. The absorbance of the blank was subtracted from that of the sample. CUPRAC activity was expressed as milligrams of trolox equivalents (mg TE/g extract).
For FRAP (ferric reducing antioxidant power) activity assay: Sample solution (1 mg/mL; 0.1 mL) was added to premixed FRAP reagent (2 mL) containing acetate buffer (0.3 M, pH 3.6), 2,4,6-tris(2-pyridyl)-S-triazine (TPTZ) (10 mM) in 40 mM HCl and ferric chloride (20 mM) in a ratio of 10:1:1 (v/v/v). Then, the sample absorbance was read at 593 nm after a 30 min incubation at room temperature. FRAP activity was expressed as milligrams of trolox equivalents (mg TE/g extract).
For phosphomolybdenum method: Sample solution (1 mg/mL; 0.3 mL) was combined with 3 mL of reagent solution (0.6 M sulfuric acid, 28 mM sodium phosphate and 4 mM ammonium molybdate). The sample absorbance was read at 695 nm after a 90 min incubation at 95°C. The total antioxidant capacity was expressed as millimoles of trolox equivalents (mmol TE/g extract) (Mocan et al., 2016c (link)).
For metal chelating activity assay: Briefly, sample solution (1 mg/mL; 2 mL) was added to FeCl2 solution (0.05 mL, 2 mM). The reaction was initiated by the addition of 5 mM ferrozine (0.2 mL). Similarly, a blank was prepared by adding sample solution (2 mL) to FeCl2 solution (0.05 mL, 2 mM) and water (0.2 mL) without ferrozine. Then, the sample and blank absorbances were read at 562 nm after 10 min incubation at room temperature. The absorbance of the blank was sub-tracted from that of the sample. The metal chelating activity was expressed as milligrams of EDTA (disodium edetate) equivalents (mg EDTAE/g extract).
For ChE inhibitory activity assay: Sample solution (1 mg/mL; 50 μL) was mixed with DTNB (5,5-dithio-bis(2-nitrobenzoic) acid, Sigma, St. Louis, MO, United States) (125 μL) and AChE [acetylcholines-terase (Electric ell AChE, Type-VI-S, EC 3.1.1.7, Sigma)], or BChE [BChE (horse serum BChE, EC 3.1.1.8, Sigma)] solution (25 μL) in Tris–HCl buffer (pH 8.0) in a 96-well microplate and incubated for 15 min at 25°C. The reaction was then initiated with the addition of acetylthiocholine iodide (ATCI, Sigma) or butyrylthiocholine chloride (BTCl, Sigma) (25 μL). Similarly, a blank was prepared by adding sample solution to all reaction reagents without enzyme (AChE or BChE) solution. The sample and blank absorbances were read at 405 nm after 10 min incubation at 25°C. The absorbance of the blank was subtracted from that of the sample and the cholinesterase inhibitory activity was expressed as galanthamine equivalents (mgGALAE/g extract) (Mocan et al., 2016b (link)).
For Tyrosinase inhibitory activity assay: Sample solution (1 mg/mL; 25 μL) was mixed with tyrosinase solution (40 μL, Sigma) and phosphate buffer (100 μL, pH 6.8) in a 96-well microplate and incubated for 15 min at 25°C. The reaction was then initiated with the addition of L-DOPA (40 μL, Sigma). Similarly, a blank was prepared by adding sample solution to all reaction reagents without enzyme (tyrosinase) solution. The sample and blank absorbances were read at 492 nm after a 10 min incubation at 25°C. The absorbance of the blank was subtracted from that of the sample and the tyrosinase inhibitory activity was expressed as kojic acid equivalents (mgKAE/g extract) (Mocan et al., 2017 (link)).
For α-amylase inhibitory activity assay: Sample solution (1 mg/mL; 25 μL) was mixed with α-amylase solution (ex-porcine pancreas, EC 3.2.1.1, Sigma) (50 μL) in phosphate buffer (pH 6.9 with 6 mM sodium chloride) in a 96-well microplate and incubated for 10 min at 37°C. After pre-incubation, the reaction was initiated with the addition of starch solution (50 μL, 0.05%). Similarly, a blank was prepared by adding sample solution to all reaction reagents without enzyme (α-amylase) solution. The reaction mixture was incubated 10 min at 37°C. The reaction was then stopped with the addition of HCl (25 μL, 1 M). This was followed by addition of the iodine-potassium iodide solution (100 μL). The sample and blank absorbances were read at 630 nm. The absorbance of the blank was subtracted from that of the sample and the α-amylase inhibitory activity was expressed as acarbose equivalents (mmol ACE/g extract) (Savran et al., 2016 (link)).
For α-glucosidase inhibitory activity assay: Sample solution (1 mg/mL; 50 μL) was mixed with glutathione (50 μL), α-glucosidase solution (from Saccharomyces cerevisiae, EC 3.2.1.20, Sigma) (50 μL) in phosphate buffer (pH 6.8) and PNPG (4-N-trophenyl-α-D-glucopyranoside, Sigma) (50 μL) in a 96-well microplate and incubated for 15 min at 37°C. Similarly, a blank was prepared by adding sample solution to all reaction reagents without enzyme (α-glucosidase) solution. The reaction was then stopped with the addition of sodium carbonate (50 μL, 0.2 M). The sample and blank absorbances were read at 400 nm. The absorbance of the blank was subtracted from that of the sample and the α-glucosidase inhibitory activity was expressed as acarbose equivalents (mmol ACE/g extract) (Llorent-Martínez et al., 2016 (link)).
All the assays were carried out in triplicate. The results are expressed as mean values and standard deviation (SD). The differences between the different extracts were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s honestly significant difference post hoc test with α = 0.05. This treatment was carried out using SPSS v. 14.0 program.
Uysal S., Zengin G., Locatelli M., Bahadori M.B., Mocan A., Bellagamba G., De Luca E., Mollica A, & Aktumsek A. (2017). Cytotoxic and Enzyme Inhibitory Potential of Two Potentilla species (P. speciosa L. and P. reptans Willd.) and Their Chemical Composition. Frontiers in Pharmacology, 8, 290.
Full text: Click here
Publication 2017
2
Hydrogel Embedding of Fixed Cells
Cited 13 times
Fixed cell samples on 12 mm round coverglass were incubated in monomer solution (1× PBS, 2 M NaCl, 2.5% (w/w) acrylamide, 0.15% (w/w) N,N’-methylenebisacrylamide, 8.625% (w/w) sodium acrylate) for ~1 minute at room temperature prior to gelation. Concentrated stocks of ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) at 10% (w/w) in water were diluted in monomer solution to concentrations of 0.2% (w/w) for gelation, with the initiator (APS) added last. The gelation solution (~70 µl) was placed in a 1 mm deep, 1 cm diameter Teflon well and the coverglass was placed on top of the solution with cells face down. Gelation was allowed to proceed at room temperature for 30 min. The coverglass and gel were removed with tweezers and placed in digestion buffer (1× TAE buffer, 0.5% Triton X-100, 0.8 M guanidine HCl) containing 8 units/mL Proteinase K (EO0491, Thermo or P8107S, New England BioLabs, Ipswich, MA, USA) added freshly. Unless otherwise indicated, gels were digested at 37 °C for various amounts of time as follows: MA-treated cells were digested overnight, GA-treated cells were digested for 30 min to 1 h, and fluorescent protein samples were digested for 30 min maximum. The gels (sometimes still attached to the coverglass) were removed from digestion buffer and placed in ~50 mL DI water to expand. Water was exchanged every 30 min until expansion was complete (typically 3–4 exchanges).
Chozinski T.J., Halpern A.R., Okawa H., Kim H.J., Tremel G.J., Wong R.O, & Vaughan J.C. (2016). Expansion Microscopy with Conventional Antibodies and Fluorescent Proteins. Nature methods, 13(6), 485-488.
Publication 2016
Acrylamide acrylate ammonium peroxydisulfate Buffers Cells Digestion Endopeptidase K Gels Guanidine Lanugo N,N'-methylenebisacrylamide Proteins Sodium Sodium Chloride Teflon tetramethylethylenediamine tris-acetate-EDTA buffer Triton X-100
3
In Vitro RNA Transcription and Purification
Cited 9 times
All RNAs were prepared as in prior work24 (link)41 (link) by in vitro transcription with T7 RNA polymerase from PCR products (with the 20 bp T7 promoter sequence TTCTAATACGACTCACTATA included at the 5′ end), with transcription volumes up to 1.5 mL. Transcriptions were precipitated by adding 1/10 volume of sodium acetate (pH 5.2) and 3 volumes of cold ethanol (taken out of −20°C storage), cooling on dry ice for at least 15 minutes, and centrifuging at 14,000 g for 1.5 hours. After removal of supernatant, pellets were rinsed with 1 mL 70% cold ethanol twice, dried in air for at least 30 minutes, and resolubilized in deionized water at volumes equal to 1/10 of the original transcription. A half volume of denaturing loading buffer (90% formamide, 0.1% xylene cyanol, 0.1% bromophenol blue) was added, and the samples were loaded onto polyacrylamide gels. The gels were 0.5 mm in thickness, 20 cm in height (direction of electrophoresis), and 27 cm in width. The gel mix contained 1x TBE (89 mM Tris-Borate, 1 mM EDTA), 8% polyacrylamide (29:1 acrylamide:bis, Sigma), and 7 M urea, and were polymerized by the addition of 1/100 volume of 10% ammonium persulfate and 1/1000 volume of TEMED (N,N,N′,N′-Tetramethylethylenediamine); after pouring between glass plates, the gels were given at least 1.5 hours to polymerize. Variations with longer polymerization times and use of flavin mononucleotide as the polymerization activating reagent are discussed in SI Figure S1. Gels were run at 25 W or less for 1 to 3 hours (temperatures remained less than 40°C under electrophoresis conditions).
Gels were transferred from gel plates onto UV-transparent plastic wrap (Saran), covered with wrap on both sides, and placed on a fluorescent TLC plate (Life Technologics). Samples were exposed to UV hand-held lamps (Ultraviolet Products UVG-54, 254 nm, 6 W; unless specified otherwise) and boxes were marked on plastic wrap around band locations with Sharpie markers. In most cases, half of the lanes were exposed, with the other half being covered with aluminum foil; the halves were excised separately, with the covered portions serving as UV-untreated controls. The radiation exposure was estimated assuming that the radiation was reflected into one hemisphere underneath the lamp, decreasing as distance squared; this is an underestimate since the radiating tubes are not point sources but extend over approximately 10 cm. For time course measurements (Fig. 2), early timepoints were acquired by turning on the lamp for a few seconds (for warm-up) and transiently removing the foil for the presented times. Gel slices were excised with sterile, disposable scalpels (BD) after peeling back plastic wrap and placed in 1.5 mL Eppendorf tubes with 200 μL deionized water. RNAs passively eluted into the water during incubation overnight at 4°C, and concentrations were estimated by absorption measurements at 260 nm on a Nanodrop spectrophotometer.
Kladwang W., Hum J, & Das R. (2012). Ultraviolet Shadowing of RNA Can Cause Significant Chemical Damage in Seconds. Scientific Reports, 2, 517.
Publication 2012
Acrylamide Aluminum ammonium peroxydisulfate ARID1A protein, human bacteriophage T7 RNA polymerase Borates Bromphenol Blue Buffers Cold Temperature Dry Ice Edetic Acid Electrophoresis Ethanol formamide Neoplasm Metastasis Pellets, Drug polyacrylamide polyacrylamide gels Polymerization Radiation Radiation Exposure Riboflavin 5'-Phosphate RNA Saran Sodium Acetate Sterility, Reproductive tetramethylethylenediamine Transcription, Genetic Tromethamine Urea xylene cyanol
4
Ultrastructure Expansion Microscopy of Parasites
Cited 9 times
Ultrastructure Expansion Microscopy (U-ExM) was performed as previously described [16 (link),22 (link),36 (link)], with significant modification.
Coverslips (Fisher Cat. No. NC1129240) that were 12 mm round were treated with poly-d-lysine for 1 h at 37 °C, washed twice with MilliQ water, and placed in the wells of a 12-well plate. Parasite cultures were set to 0.5% hematocrit, and 1 mL of parasite culture was allowed to settle onto the coverslip for 15 min at 37 °C. Culture supernatants were removed, and cultures were fixed with 1 mL of 4% w/v PFA/PBS for 15 min at 37 °C. Following fixation, coverslips were washed three times with PBS pre-warmed to 37 °C before being treated with 1 mL of 1.4 % v/v formaldehyde/2% v/v acrylamide (FA/AA) in PBS. After the addition of the FA/AA solution, the 12 well-plate was parafilmed shut and left to incubate at 37 °C overnight.
A monomer solution (19% w/w sodium acrylate (Sigma Cat. No. 408220), 10% v/v acrylamide (Sigma Cat. No. A4058, St. Louis, MO, USA), 2% v/v N,N’-methyllenebisacrylamide (Sigma Cat. No. M1533) in PBS) was made in 1 mL batches on Day 1 and stored as 90 µL aliquots at −20 °C overnight.
Aliquots of 10% v/v tetraethylenediamine (TEMED; ThermoFisher Cat. No. 17919) and 10% w/v ammonium persulfate (APS; ThermoFisher Cat. No. 17874) were thawed on ice, while a humidity chamber containing parafilm was stored at −20 °C before also being placed on ice. The FA/AA solution was removed, coverslips were washed once with PBS, dried, and placed cell-side up on the parafilm in the humidity chamber. Subsequently, 5 µL of both TEMED and APS were added per 90 µL of monomer solution, which was briefly vortexed, and 35 µL was pipetted onto the parafilm before the coverslip was placed cell-side down onto the monomer solution. The gels were then incubated at 37 °C for 1 h before being transferred into the wells of a 6-well plate filled with the denaturation buffer for 15 min at room temperature (200 mM sodium dodecyl sulfate (SDS), 200 mM NaCl, 50 mM Tris, pH 9). The gels were then separated from coverslips and transferred into Eppendorf tubes containing the denaturation buffer and denatured at 95 °C for 90 min. The denatured gels were transferred into 10 cm Petri dishes filled with 25 mL MilliQ water and placed on a platform shaker for 30 min, with the water replaced twice, each for a further 30 min. After the first expansion in water, the expanded gels were shrunk by adding 25 mL to PBS washes each for 15 min. The shrunken gels were placed into the wells of a 6-well plate filled with a blocking buffer (3% BSA-PBS) and blocked for 1 h at room temperature on a platform shaker. After blocking, primary antibodies were prepared in 1 mL of blocking buffer and gels were incubated with a primary antibody overnight at room temperature on a platform shaker.
The gels were washed three times in 0.5% v/v PBS-Tween 20 (PBS-T), each for 10 min, before being incubated with 1 mL of secondary antibodies, NHS ester and/or nuclear stain diluted in PBS for 2.5 h at room temperature on a platform shaker. Following secondary incubation, the gels were washed three times in PBS-T. The stained gels were then transferred back to 10 cm Petri dishes and underwent a second round of expansion with three 30 min washes in 25 mL MilliQ water.
The diameter of the fully expanded gels was measured using a tape measure, and the expansion factor was determined by dividing the expanded gel size (in mm) by the initial coverslip size (12 mm). The gel diameter and expansion factor for all gels prepared in this study can be found Figure S1.
For the gels stained with BODIPY TR Ceramide (BODIPY TRc), sections of the expanded gel were cut and placed into the wells of a 6-well plate containing 1 mL 2 µM BODIPY TRc in MilliQ and incubated on a platform shaker overnight.
To prepare gels for imaging, small sections were cut from the larger gel and gently dried before being placed into 35 mm #1.5 coverslip bottomed imaging dishes (Cellvis; Fisher Cat. No. NC0409658) that had been pre-coated with poly-d-lysine.
Liffner B, & Absalon S. (2021). Expansion Microscopy Reveals Plasmodium falciparum Blood-Stage Parasites Undergo Anaphase with A Chromatin Bridge in the Absence of Mini-Chromosome Maintenance Complex Binding Protein. Microorganisms, 9(11), 2306.
Full text: Click here
Publication 2021
5
Hydrogel-based Tissue Expansion and Analysis
Cited 7 times
For AcX anchored fluorescent proteins and antibody staining, the following steps – gelation, digestion and expansion – can be performed as described previously1 . Briefly, monomer solution (1× PBS, 2 M NaCl, 8.625% (w/w) sodium acrylate, 2.5% (w/w) acrylamide, 0.15% (w/w) N,N′-methylenebisacrylamide) was mixed, frozen in aliquots, and thawed before use. Monomer solution was cooled to 4°C before use. Concentrated stocks (10% w/w) of ammonium persulfate (APS) initiator and tetramethylethylenediamine (TEMED) accelerator were added to the monomer solution up to 0.2% (w/w) each. For slices, the inhibitor 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-hydroxy-TEMPO) was added up to 0.01% (w/w) from a 0.5% (w/w) stock to inhibit gelation during diffusion of the monomer solution into tissue sections. Cells or tissue slices were incubated with the monomer solution plus APS/TEMED (and 4-hydroxy-TEMPO for slices) at 4°C for one minute, 30 minutes for cultured cells, and brain slices respectively, and then transferred to a humidified 37°C incubator for two hours for gelation.
Proteinase K (New England Biolabs) was diluted 1:100 to 8 units/mL in digestion buffer (50 mM Tris (pH 8), 1 mM EDTA, 0.5% Triton X-100, 1 M NaCl) and incubated with the gels fully immersed in proteinase solution overnight at RT (this step can also be performed at 37° C for 4 hours). Digested gels were next placed in excess volumes of doubly de-ionized water for 0.25–2 hours to expand, with longer times for thicker gels. This step was repeated 3–5 times in fresh water, until the size of the expanding sample plateaued.
Tillberg P.W., Chen F., Piatkevich K.D., Zhao Y., Yu C.C., English B.P., Gao L., Martorell A., Suk H.J., Yoshida F., DeGennaro E.M., Roossien D.H., Gong G., Seneviratne U., Tannenbaum S.R., Desimone R., Cai D, & Boyden E.S. (2016). Protein-retention expansion microscopy of cells and tissues labeled using standard fluorescent proteins and antibodies. Nature biotechnology, 34(9), 987-992.
Publication 2016
Acrylamide acrylate ammonium peroxydisulfate Brain Buffers Cardiac Arrest Cells Cultured Cells Diffusion Digestion Edetic Acid Endopeptidase K Endopeptidases Freezing Gels Immunoglobulins N,N'-methylenebisacrylamide Proteins Sodium Sodium Chloride TEMPOL-H tetramethylethylenediamine Tissues Triton X-100 Tromethamine

Most recents protocols related to «Sodium persulfate»

1
Photocatalytic Degradation of Reactive Dye
The commercial low-pressure UV lamps of 80W at 185 nm and 254 nm were purchased from Suzhou Hemingway Environmental Protection Equipment Co., Ltd. The low-pressure UV lamps were stalled in a pilot UV device manufactured by Guangzhou Anders Electromechanical Equipment Co., Ltd. Reactive red (B-3BF) dye was purchased from Jize County Shunde Dye Distribution Co., Ltd. Sulfuric acid (H2SO4), sodium hydroxide (NaOH) and sodium persulfate (Na2S2O8) were of analytical grade and purchased from Weisi (Beijing) Experimental Supplies Co., Ltd. The dye wastewater was prepared by the reactive red (B-3BF) dye and deionized water. The chemical structure of B-3BF dye is given in Fig. 1

Chemical structure of B-3BF dye.

Wang C., Li Y., Wan J., Hu Y., Huang Y, & Qiu J. (2024). Degradation of reactive red (B-3BF) dye wastewater using UV irradiation (254/185 nm) with sodium persulfate in a pilot UV device. Scientific Reports, 14, 12036.
Full text: Click here
Publication 2024
2
Synthesis of Polymeric Materials
Not available on PMC !
Ethanol (99.5%), and polyethylene glycol-400 (PEG-400) were purchased from Sigma Aldrich (Steinheim, Germany). Thiourea, sublimated sulfur powder, sodium hydroxide, copper nitrate, methyl methacrylate, methacrylic acid, sodium dodecyl sulfate, ammonium persulfate, and sodium chloride were purchased from Merck (Darmstadt, Germany).
Jalali E., & Maghsoudi S. (2024). Enhancing the UV Radiation Protection of Bacillus thuringiensis Formulation using Sulfur Quantum Dots: A Biotechnological Approach.
Publication 2024
3
Comprehensive Metabolite Extraction and Analysis
The solvent for extractions, LC-MS and NMR analysis, deuterium oxide (D2O) plus TSP (4,4-dimethyl-4-silapentane-1-sulfonic acid, sodium dihydrogen phosphate (NaH2PO4), sodium hydrogen phosphate (Na2HPO4), sodium azide (NaN3), potassium phosphate buffer, potassium persulfate (K2S2O8), Folin–Ciocalteu phenol reagent, polyvinylpolypyrrolidone (PVPP), NaNO2, AlCl3, NaOH, rutin and gallic acid were purchased from Sigma Aldrich (Milano, Italy).
Polcaro L.M., Samani M.R., Piacente S, & Masullo M. (2024). Development of a New Extraction Method for Pomegranate and Metabolite Profiling by a LC-MS and 1H NMR Combined Approach. Foods, 13(10), 1429.
Full text: Click here
Publication 2024
4
Investigating Anti-Inflammatory Efficacy
The chemicals and solvents used included Tris HCl, sodium phosphate, potassium persulfate, carrageenan, disodium hydrogen phosphate, casein, sodium dihydrogen phosphate trypsin, sodium chloride and perchloric acid (Sigma-Aldrich, Germany), methanol, hexane chloroform, propylene glycol and gum acacia (Merck, Germany), aspirin (Highnoon Laboratories Limited, Pakistan), dexamethasone (Remington Laboratories, Lahore, Pakistan), ethyl acetate (Daejung, Korea), and normal saline (Surge Laboratories, Sheikhupura, Pakistan).
Shahwar D.E., Shehzadi N., Khan M.T., Zia S., Saleem M., Akhtar S., Saghir F., Iftikhar S., Mobashar A., Naheed S., Bukhari N.I, & Hussain K. (2024). A new anti-inflammatory lupane in Ziziphus jujuba (L.) Gaertn. var. hysudrica Edgew.. Heliyon, 10(9), e29989.
Full text: Click here
Publication 2024
5
Reagents for Expansion Microscopy
Reagents for ExM experiments were purchased from Sigma-Aldrich, including acrylamide (AAm; A4058), N, N'methylenebis (acrylamide; BIS; M1533), sodium acrylate (SA; 408220), sodium chloride (NaCl; S5886), Tris- (hydroxymethyl)-aminomethane (Tris; 1.08382), ammonium persulfate (APS; A3678), and N, N, N', N'-tetramethylethylenediamine (TEMED; T7024). APS and TEMED were prepared as 10% (w/v) stock solutions in ddH2O. Additionally, sodium dodecyl sulfate (SDS; AM9820) was obtained from Invitrogen.
Sachs S., Reinhard S., Eilts J., Sauer M, & Werner C. (2024). Visualizing the trans-synaptic arrangement of synaptic proteins by expansion microscopy. Frontiers in Cellular Neuroscience, 18, 1328726.
Full text: Click here
Publication 2024

Top products related to «Sodium persulfate»

1
Potassium persulfate by Merck Group
Sourced in United States, Germany, Italy, Poland, Spain, Portugal, Australia, United Kingdom, Canada, India, Switzerland, France, China, Mexico, Singapore, Hungary, Slovenia, Israel, Brazil
Potassium persulfate is an oxidizing agent used in various laboratory and industrial applications. It is a white, crystalline solid that is soluble in water. Potassium persulfate is commonly used as an initiator in free-radical polymerization reactions, as an oxidizing agent, and as a bleaching agent.
2
Gallic acid by Merck Group
Sourced in United States, Germany, Italy, Spain, France, India, China, Poland, Australia, United Kingdom, Sao Tome and Principe, Brazil, Chile, Ireland, Canada, Singapore, Switzerland, Malaysia, Portugal, Mexico, Hungary, New Zealand, Belgium, Czechia, Macao, Hong Kong, Sweden, Argentina, Cameroon, Japan, Slovakia, Serbia
Gallic acid is a naturally occurring organic compound that can be used as a laboratory reagent. It is a white to light tan crystalline solid with the chemical formula C6H2(OH)3COOH. Gallic acid is commonly used in various analytical and research applications.
3
Ammonium persulfate by Merck Group
Sourced in United States, Germany, India, United Kingdom, Spain, Italy, Canada, China, Australia, Macao, Belgium, Sao Tome and Principe, Japan, Brazil, Switzerland
Ammonium persulfate is a white crystalline chemical compound that is commonly used as an initiator in various chemical reactions, particularly in the field of polymerization. It serves as an oxidizing agent and is known for its ability to generate free radicals, which are essential for initiating and accelerating polymerization processes.
4
Sodium hydroxide (naoh) by Merck Group
Sourced in Germany, United States, India, United Kingdom, Italy, China, Spain, France, Australia, Canada, Poland, Switzerland, Singapore, Belgium, Sao Tome and Principe, Ireland, Sweden, Brazil, Israel, Mexico, Macao, Chile, Japan, Hungary, Malaysia, Denmark, Portugal, Indonesia, Netherlands, Czechia, Finland, Austria, Romania, Pakistan, Cameroon, Egypt, Greece, Bulgaria, Norway, Colombia, New Zealand, Lithuania
Sodium hydroxide is a chemical compound with the formula NaOH. It is a white, odorless, crystalline solid that is highly soluble in water and is a strong base. It is commonly used in various laboratory applications as a reagent.
5
Hydrochloric acid (hcl) by Merck Group
Sourced in Germany, United States, United Kingdom, India, Italy, France, Spain, Australia, China, Poland, Switzerland, Canada, Ireland, Japan, Singapore, Sao Tome and Principe, Malaysia, Brazil, Hungary, Chile, Belgium, Denmark, Macao, Mexico, Sweden, Indonesia, Romania, Czechia, Egypt, Austria, Portugal, Netherlands, Greece, Panama, Kenya, Finland, Israel, Hong Kong, New Zealand, Norway
Hydrochloric acid is a commonly used laboratory reagent. It is a clear, colorless, and highly corrosive liquid with a pungent odor. Hydrochloric acid is an aqueous solution of hydrogen chloride gas.
6
2 2 diphenyl 1 picrylhydrazyl (dpph) by Merck Group
Sourced in United States, Germany, Italy, India, China, Spain, Poland, France, United Kingdom, Australia, Brazil, Singapore, Switzerland, Hungary, Mexico, Japan, Denmark, Sao Tome and Principe, Chile, Malaysia, Argentina, Belgium, Cameroon, Canada, Ireland, Portugal, Israel, Romania, Czechia, Macao, Indonesia
DPPH is a chemical compound used as a free radical scavenger in various analytical techniques. It is commonly used to assess the antioxidant activity of substances. The core function of DPPH is to serve as a stable free radical that can be reduced, resulting in a color change that can be measured spectrophotometrically.
7
Sodium carbonate by Merck Group
Sourced in United States, Germany, Italy, India, France, Spain, United Kingdom, Australia, Switzerland, Poland, Portugal, China, Canada, Sao Tome and Principe, Brazil, Ireland, Mexico, Sweden, Hungary, Singapore, Malaysia, Pakistan, Thailand, Cameroon, Japan, Chile
Sodium carbonate is a water-soluble inorganic compound with the chemical formula Na2CO3. It is a white, crystalline solid that is commonly used as a pH regulator, water softener, and cleaning agent in various industrial and laboratory applications.
8
Methanol by Merck Group
Sourced in Germany, United States, Italy, India, United Kingdom, China, France, Poland, Spain, Switzerland, Australia, Canada, Sao Tome and Principe, Brazil, Ireland, Japan, Belgium, Portugal, Singapore, Macao, Malaysia, Czechia, Mexico, Indonesia, Chile, Denmark, Sweden, Bulgaria, Netherlands, Finland, Hungary, Austria, Israel, Norway, Egypt, Argentina, Greece, Kenya, Thailand, Pakistan
Methanol is a clear, colorless, and flammable liquid that is widely used in various industrial and laboratory applications. It serves as a solvent, fuel, and chemical intermediate. Methanol has a simple chemical formula of CH3OH and a boiling point of 64.7°C. It is a versatile compound that is widely used in the production of other chemicals, as well as in the fuel industry.
9
Trolox by Merck Group
Sourced in United States, Germany, Italy, France, Spain, Brazil, India, Poland, Switzerland, Canada, China, New Zealand, United Kingdom, Chile, Macao, Mexico, Australia, Portugal, Czechia, Hungary, Japan, Belgium, Singapore, Argentina, Ireland, Sao Tome and Principe, Denmark, Thailand, Israel, Morocco, Cameroon
Trolox is a water-soluble vitamin E analog that functions as an antioxidant. It is commonly used in research applications as a reference standard for measuring antioxidant capacity.
10
Folin ciocalteu reagent by Merck Group
Sourced in United States, Germany, Italy, India, France, Poland, Spain, China, Chile, Sao Tome and Principe, United Kingdom, Switzerland, Australia, Brazil, Canada, Singapore, Portugal, Mexico, Malaysia, New Zealand, Macao, Croatia, Belgium, Lithuania, Romania, Argentina, Finland
The Folin-Ciocalteu reagent is a colorimetric reagent used for the quantitative determination of phenolic compounds. It is a mixture of phosphomolybdic and phosphotungstic acid complexes that undergo a color change when reduced by phenolic compounds.

More about "Sodium persulfate"